SlideShare a Scribd company logo
1 of 23
DNA
TYPING
NUR HANISAH
BINTI ZAINOREN
OBJECTIVE
1. History
2. Definition
3. Techniques
4. Applications
5. Advantages
6. Disadvantages
PROFESSOR
ALEC
JEFFREY
first application of DNA
typing in forensic science
DEFINITION
• A procedure wherein
DNA extracted from a
biological sample
obtained from an
individual is analyzed
• DNA is processed to
generate a pattern for
each person that is
generally termed as a
'DNA profile'
TECHNIQUES
1. RFLP - Restriction Fragment
Length Polymorphism
2. PCR - Polymerase Chain
Reaction
3. STR - Short Tandem Repeats
4. Mitochondrial DNA Analysis
5. Rapid DNA ID Microchip-
Based Genetic Detectors
RFLP
DNA is cut into fragments by
restriction enzymes
Chops the DNA in two at every place where the
GCGC pattern occurs
GCGCATTGTTGCGCAAGAGCGC
GCGCATTGAATGCAAGTAGCGC
1st person:
2nd person:
GCGCATTGTTGCGCAAGAGCGC
GCGCATTGAATGCAAGTAGCGC
1st person:
2nd person:
GCGCATTGTTGCGCAAGAGCGC
GCGCATTGAATGCAAGTAGCGC
1st person:
2nd person:
GCGCATTGTTGCGCAAGAGCGC
GCGCATTGAATGCAAGTAGCGC
1st person:
2nd person:
2 small fragments
1 large fragments
STR
SOURCES OF BIOLOGICAL
EVIDENCES
• Blood
• Teeth
• Semen
• Saliva
• Hair
• Urine
• Bone
• Tissue
PROCEDURE - COLLECTION &
FORWARDING OF SAMPLES
• To be done.
• As told by my lecturer,
this is actually the
important part for a
doctor to know 
APPLICATIONS
• Paternity disputes
• Maternity resolution
• Establishment of biological
relationship
• Identification of rapist
• Identification of bodies in
exhumation cases
DNA TYPING IN PATERNITY TEST
ADVANTAGES
• Require small sample
• Can be applied on very
old stains
• Most conclusive method
DISADVANTAGES
• Cannot differentiate
identical twins
• Very expensive
• Interpretation of results
requires a great deal of
expertise and experience
REFERENCES
THANK YOU

More Related Content

What's hot

What's hot (20)

Dna sequencing and its types
Dna sequencing and its typesDna sequencing and its types
Dna sequencing and its types
 
Maxam–Gilbert sequencing
Maxam–Gilbert sequencingMaxam–Gilbert sequencing
Maxam–Gilbert sequencing
 
Role of biotechnology in forensic science
Role of biotechnology in forensic scienceRole of biotechnology in forensic science
Role of biotechnology in forensic science
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
 
Maxam-Gilbert method of DNA sequencing
Maxam-Gilbert method of DNA sequencingMaxam-Gilbert method of DNA sequencing
Maxam-Gilbert method of DNA sequencing
 
Rflp presentation
Rflp presentationRflp presentation
Rflp presentation
 
Molecular probes
Molecular probesMolecular probes
Molecular probes
 
Sanger sequencing (DNA sequencing by ENZYMATIC METHOD)
Sanger sequencing (DNA sequencing by ENZYMATIC METHOD)Sanger sequencing (DNA sequencing by ENZYMATIC METHOD)
Sanger sequencing (DNA sequencing by ENZYMATIC METHOD)
 
DNA Sequencing
DNA SequencingDNA Sequencing
DNA Sequencing
 
Microbial forensics and it's importance
Microbial forensics and it's importanceMicrobial forensics and it's importance
Microbial forensics and it's importance
 
DNA microarray
DNA microarrayDNA microarray
DNA microarray
 
L10. enzymes used in genetic engineering i-1
L10. enzymes used in genetic engineering i-1L10. enzymes used in genetic engineering i-1
L10. enzymes used in genetic engineering i-1
 
Polymerase Chain Reaction
Polymerase Chain ReactionPolymerase Chain Reaction
Polymerase Chain Reaction
 
Single Nucleotide Polymorphism (SNP)
Single Nucleotide Polymorphism (SNP)Single Nucleotide Polymorphism (SNP)
Single Nucleotide Polymorphism (SNP)
 
Dna profiling
Dna profilingDna profiling
Dna profiling
 
DNA Analysis
DNA Analysis DNA Analysis
DNA Analysis
 
AFLP, RFLP & RAPD
AFLP, RFLP & RAPDAFLP, RFLP & RAPD
AFLP, RFLP & RAPD
 
PHYSICAL MAPPING STRATEGIES IN GENOMICS
PHYSICAL MAPPING STRATEGIES IN GENOMICSPHYSICAL MAPPING STRATEGIES IN GENOMICS
PHYSICAL MAPPING STRATEGIES IN GENOMICS
 
Genome organisation
Genome organisationGenome organisation
Genome organisation
 
Forensic DNA Profiling
Forensic DNA ProfilingForensic DNA Profiling
Forensic DNA Profiling
 

Viewers also liked

Dna Fingerprinting And Forensic Applications
Dna Fingerprinting And Forensic ApplicationsDna Fingerprinting And Forensic Applications
Dna Fingerprinting And Forensic Applications
dheva B
 
Gel electrophoresis
Gel electrophoresisGel electrophoresis
Gel electrophoresis
1996Jessica
 
Gel electrophoresis power point
Gel electrophoresis power pointGel electrophoresis power point
Gel electrophoresis power point
ellie4goals
 

Viewers also liked (10)

Detecting STR Peaks in Degraded DNA samples
Detecting STR Peaks in Degraded DNA samplesDetecting STR Peaks in Degraded DNA samples
Detecting STR Peaks in Degraded DNA samples
 
Dna Fingerprinting And Forensic Applications
Dna Fingerprinting And Forensic ApplicationsDna Fingerprinting And Forensic Applications
Dna Fingerprinting And Forensic Applications
 
DNA Fingerprinting
DNA FingerprintingDNA Fingerprinting
DNA Fingerprinting
 
Forensic dna typing by John M Butler
Forensic dna typing by John M ButlerForensic dna typing by John M Butler
Forensic dna typing by John M Butler
 
Forensic DNA Typing-M. Asif
Forensic DNA Typing-M. AsifForensic DNA Typing-M. Asif
Forensic DNA Typing-M. Asif
 
DNA fingerprinting 7 jan 2015
DNA fingerprinting 7 jan 2015DNA fingerprinting 7 jan 2015
DNA fingerprinting 7 jan 2015
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
 
Gel electrophoresis
Gel electrophoresisGel electrophoresis
Gel electrophoresis
 
Gel electrophoresis power point
Gel electrophoresis power pointGel electrophoresis power point
Gel electrophoresis power point
 
DNA structure, Functions and properties
DNA structure, Functions and propertiesDNA structure, Functions and properties
DNA structure, Functions and properties
 

Similar to DNA TYPING

Dna chips, RFLPs & dna fingerprint
Dna chips, RFLPs & dna fingerprintDna chips, RFLPs & dna fingerprint
Dna chips, RFLPs & dna fingerprint
Tapeshwar Yadav
 

Similar to DNA TYPING (20)

DNA Typing.pptx
DNA Typing.pptxDNA Typing.pptx
DNA Typing.pptx
 
Blotting techniques ppt
Blotting techniques pptBlotting techniques ppt
Blotting techniques ppt
 
DNA sequencing by kk sahu sir
DNA sequencing by kk sahu sirDNA sequencing by kk sahu sir
DNA sequencing by kk sahu sir
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
 
Presentation dna fingerprinting
Presentation  dna fingerprintingPresentation  dna fingerprinting
Presentation dna fingerprinting
 
Generations of sequencing technologies.
Generations of sequencing technologies. Generations of sequencing technologies.
Generations of sequencing technologies.
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
 
DNA fingerprinting
DNA fingerprintingDNA fingerprinting
DNA fingerprinting
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
 
Microarray (DNA and SNP microarray)
Microarray (DNA and SNP microarray)Microarray (DNA and SNP microarray)
Microarray (DNA and SNP microarray)
 
microarrayppt-170906064529.pdf
microarrayppt-170906064529.pdfmicroarrayppt-170906064529.pdf
microarrayppt-170906064529.pdf
 
RFLP
RFLP RFLP
RFLP
 
Chapter 5 bio 300 obe
Chapter 5 bio 300 obeChapter 5 bio 300 obe
Chapter 5 bio 300 obe
 
DNA Fingerprinting
DNA Fingerprinting DNA Fingerprinting
DNA Fingerprinting
 
Pcr based gene cloning
Pcr based gene cloningPcr based gene cloning
Pcr based gene cloning
 
Dna chips, RFLPs & dna fingerprint
Dna chips, RFLPs & dna fingerprintDna chips, RFLPs & dna fingerprint
Dna chips, RFLPs & dna fingerprint
 
Dna fingerprinting by laxmee dahal
Dna fingerprinting by laxmee dahalDna fingerprinting by laxmee dahal
Dna fingerprinting by laxmee dahal
 
Microarray technique
Microarray techniqueMicroarray technique
Microarray technique
 
marker system presentation shiv shankar.pptx
marker system presentation shiv shankar.pptxmarker system presentation shiv shankar.pptx
marker system presentation shiv shankar.pptx
 
theoretical perspectives on marriage and family
theoretical perspectives on marriage and familytheoretical perspectives on marriage and family
theoretical perspectives on marriage and family
 

More from hanisahwarrior

PREVENTION & CONTROL OF OCCUPATIONAL DISEASES (Engineering measures)
PREVENTION & CONTROL OF OCCUPATIONAL DISEASES (Engineering measures)PREVENTION & CONTROL OF OCCUPATIONAL DISEASES (Engineering measures)
PREVENTION & CONTROL OF OCCUPATIONAL DISEASES (Engineering measures)
hanisahwarrior
 

More from hanisahwarrior (20)

Kursus perawatan ibadah pesakit
Kursus perawatan ibadah pesakitKursus perawatan ibadah pesakit
Kursus perawatan ibadah pesakit
 
SCROTAL SWELLING
SCROTAL SWELLINGSCROTAL SWELLING
SCROTAL SWELLING
 
MOOD DISORDERS
MOOD DISORDERSMOOD DISORDERS
MOOD DISORDERS
 
Preoperative Preparations
Preoperative PreparationsPreoperative Preparations
Preoperative Preparations
 
Hypoglycemia
Hypoglycemia Hypoglycemia
Hypoglycemia
 
SHOULDER SPORT INJURIES
SHOULDER SPORT INJURIES SHOULDER SPORT INJURIES
SHOULDER SPORT INJURIES
 
PAEDIATRICS HIV
PAEDIATRICS HIVPAEDIATRICS HIV
PAEDIATRICS HIV
 
BENIGN LESIONS OF UTERUS
BENIGN LESIONS OF UTERUSBENIGN LESIONS OF UTERUS
BENIGN LESIONS OF UTERUS
 
MEDICAL CERTIFICATE
MEDICAL CERTIFICATEMEDICAL CERTIFICATE
MEDICAL CERTIFICATE
 
Dyslipidaemia
DyslipidaemiaDyslipidaemia
Dyslipidaemia
 
CHILD HEALTH
CHILD HEALTHCHILD HEALTH
CHILD HEALTH
 
URBANIZATION IN MALAYSIA
URBANIZATION IN MALAYSIAURBANIZATION IN MALAYSIA
URBANIZATION IN MALAYSIA
 
PREVENTION & CONTROL OF OCCUPATIONAL DISEASES (Engineering measures)
PREVENTION & CONTROL OF OCCUPATIONAL DISEASES (Engineering measures)PREVENTION & CONTROL OF OCCUPATIONAL DISEASES (Engineering measures)
PREVENTION & CONTROL OF OCCUPATIONAL DISEASES (Engineering measures)
 
NEURO-OPHTHALMOLOGY
NEURO-OPHTHALMOLOGY NEURO-OPHTHALMOLOGY
NEURO-OPHTHALMOLOGY
 
NASAL POLYPS
NASAL POLYPSNASAL POLYPS
NASAL POLYPS
 
NASAL BONE FRACTURE
NASAL BONE FRACTURENASAL BONE FRACTURE
NASAL BONE FRACTURE
 
FINGERPRINTS AND ADVANCES
FINGERPRINTS AND ADVANCESFINGERPRINTS AND ADVANCES
FINGERPRINTS AND ADVANCES
 
PRINCIPLE OF ULTRAOUND
PRINCIPLE OF ULTRAOUNDPRINCIPLE OF ULTRAOUND
PRINCIPLE OF ULTRAOUND
 
COMPLICATIONS OF SPINAL & EPIDURAL ANAESTHESIA
COMPLICATIONS OF SPINAL & EPIDURAL ANAESTHESIACOMPLICATIONS OF SPINAL & EPIDURAL ANAESTHESIA
COMPLICATIONS OF SPINAL & EPIDURAL ANAESTHESIA
 
Fracture of distal radius
Fracture of distal radiusFracture of distal radius
Fracture of distal radius
 

Recently uploaded

Industrial Training Report- AKTU Industrial Training Report
Industrial Training Report- AKTU Industrial Training ReportIndustrial Training Report- AKTU Industrial Training Report
Industrial Training Report- AKTU Industrial Training Report
Avinash Rai
 
ppt your views.ppt your views of your college in your eyes
ppt your views.ppt your views of your college in your eyesppt your views.ppt your views of your college in your eyes
ppt your views.ppt your views of your college in your eyes
ashishpaul799
 
The basics of sentences session 4pptx.pptx
The basics of sentences session 4pptx.pptxThe basics of sentences session 4pptx.pptx
The basics of sentences session 4pptx.pptx
heathfieldcps1
 

Recently uploaded (20)

Application of Matrices in real life. Presentation on application of matrices
Application of Matrices in real life. Presentation on application of matricesApplication of Matrices in real life. Presentation on application of matrices
Application of Matrices in real life. Presentation on application of matrices
 
Features of Video Calls in the Discuss Module in Odoo 17
Features of Video Calls in the Discuss Module in Odoo 17Features of Video Calls in the Discuss Module in Odoo 17
Features of Video Calls in the Discuss Module in Odoo 17
 
B.ed spl. HI pdusu exam paper-2023-24.pdf
B.ed spl. HI pdusu exam paper-2023-24.pdfB.ed spl. HI pdusu exam paper-2023-24.pdf
B.ed spl. HI pdusu exam paper-2023-24.pdf
 
The impact of social media on mental health and well-being has been a topic o...
The impact of social media on mental health and well-being has been a topic o...The impact of social media on mental health and well-being has been a topic o...
The impact of social media on mental health and well-being has been a topic o...
 
Students, digital devices and success - Andreas Schleicher - 27 May 2024..pptx
Students, digital devices and success - Andreas Schleicher - 27 May 2024..pptxStudents, digital devices and success - Andreas Schleicher - 27 May 2024..pptx
Students, digital devices and success - Andreas Schleicher - 27 May 2024..pptx
 
Pragya Champions Chalice 2024 Prelims & Finals Q/A set, General Quiz
Pragya Champions Chalice 2024 Prelims & Finals Q/A set, General QuizPragya Champions Chalice 2024 Prelims & Finals Q/A set, General Quiz
Pragya Champions Chalice 2024 Prelims & Finals Q/A set, General Quiz
 
Incoming and Outgoing Shipments in 2 STEPS Using Odoo 17
Incoming and Outgoing Shipments in 2 STEPS Using Odoo 17Incoming and Outgoing Shipments in 2 STEPS Using Odoo 17
Incoming and Outgoing Shipments in 2 STEPS Using Odoo 17
 
The Art Pastor's Guide to Sabbath | Steve Thomason
The Art Pastor's Guide to Sabbath | Steve ThomasonThe Art Pastor's Guide to Sabbath | Steve Thomason
The Art Pastor's Guide to Sabbath | Steve Thomason
 
Post Exam Fun(da) Intra UEM General Quiz - Finals.pdf
Post Exam Fun(da) Intra UEM General Quiz - Finals.pdfPost Exam Fun(da) Intra UEM General Quiz - Finals.pdf
Post Exam Fun(da) Intra UEM General Quiz - Finals.pdf
 
Industrial Training Report- AKTU Industrial Training Report
Industrial Training Report- AKTU Industrial Training ReportIndustrial Training Report- AKTU Industrial Training Report
Industrial Training Report- AKTU Industrial Training Report
 
The Benefits and Challenges of Open Educational Resources
The Benefits and Challenges of Open Educational ResourcesThe Benefits and Challenges of Open Educational Resources
The Benefits and Challenges of Open Educational Resources
 
ppt your views.ppt your views of your college in your eyes
ppt your views.ppt your views of your college in your eyesppt your views.ppt your views of your college in your eyes
ppt your views.ppt your views of your college in your eyes
 
Salient features of Environment protection Act 1986.pptx
Salient features of Environment protection Act 1986.pptxSalient features of Environment protection Act 1986.pptx
Salient features of Environment protection Act 1986.pptx
 
Benefits and Challenges of Using Open Educational Resources
Benefits and Challenges of Using Open Educational ResourcesBenefits and Challenges of Using Open Educational Resources
Benefits and Challenges of Using Open Educational Resources
 
Dementia (Alzheimer & vasular dementia).
Dementia (Alzheimer & vasular dementia).Dementia (Alzheimer & vasular dementia).
Dementia (Alzheimer & vasular dementia).
 
Telling Your Story_ Simple Steps to Build Your Nonprofit's Brand Webinar.pdf
Telling Your Story_ Simple Steps to Build Your Nonprofit's Brand Webinar.pdfTelling Your Story_ Simple Steps to Build Your Nonprofit's Brand Webinar.pdf
Telling Your Story_ Simple Steps to Build Your Nonprofit's Brand Webinar.pdf
 
The basics of sentences session 4pptx.pptx
The basics of sentences session 4pptx.pptxThe basics of sentences session 4pptx.pptx
The basics of sentences session 4pptx.pptx
 
How to Manage Notification Preferences in the Odoo 17
How to Manage Notification Preferences in the Odoo 17How to Manage Notification Preferences in the Odoo 17
How to Manage Notification Preferences in the Odoo 17
 
The Last Leaf, a short story by O. Henry
The Last Leaf, a short story by O. HenryThe Last Leaf, a short story by O. Henry
The Last Leaf, a short story by O. Henry
 
50 ĐỀ LUYỆN THI IOE LỚP 9 - NĂM HỌC 2022-2023 (CÓ LINK HÌNH, FILE AUDIO VÀ ĐÁ...
50 ĐỀ LUYỆN THI IOE LỚP 9 - NĂM HỌC 2022-2023 (CÓ LINK HÌNH, FILE AUDIO VÀ ĐÁ...50 ĐỀ LUYỆN THI IOE LỚP 9 - NĂM HỌC 2022-2023 (CÓ LINK HÌNH, FILE AUDIO VÀ ĐÁ...
50 ĐỀ LUYỆN THI IOE LỚP 9 - NĂM HỌC 2022-2023 (CÓ LINK HÌNH, FILE AUDIO VÀ ĐÁ...
 

DNA TYPING