DNA Typing.pptx

•Download as PPTX, PDF•

0 likes•9 views

alizain9604

kjh lk b

Internet

DNA
TYPING
ALI ZAIN
Lecturer
Department of
Biotechnology

OBJECTIVE
1. History
2. Definition
3. Techniques
4. Applications
5. Advantages
6. Disadvantages

PROFESSOR
ALEC
JEFFREY
first application of DNA
typing in forensic science

TECHNIQUES
1. RFLP - Restriction Fragment
Length Polymorphism
2. PCR - Polymerase Chain
Reaction
3. STR - Short Tandem Repeats
4. Mitochondrial DNA Analysis
5. Rapid DNA ID Microchip-
Based Genetic Detectors

RFLP
DNA is cut into fragments by
restriction enzymes
Chops the DNA in two at every place where the
GCGC pattern occurs

GCGCATTGTTGCGCAAGAGCGC
GCGCATTGAATGCAAGTAGCGC
1st person:
2nd person:

GCGCATTGTTGCGCAAGAGCGC
GCGCATTGAATGCAAGTAGCGC
1st person:
2nd person:
2 small fragments
1 large fragments

SOURCES OF BIOLOGICAL
EVIDENCES
• Blood
• Teeth
• Semen
• Saliva
• Hair
• Urine
• Bone
• Tissue

APPLICATIONS
• Paternity disputes
• Maternity resolution
• Establishment of biological
relationship
• Identification of rapist
• Identification of bodies in
exhumation cases

ADVANTAGES
• Require Small Sample
• Can be applied on very
old stains
• Most conclusive method

DISADVANTAGES
• Cannot differentiate
identical twins
• Very expensive
• Interpretation of results
requires a great deal of
expertise and experience

Similar to DNA Typing.pptx

Presentation dna fingerprinting

Dev Dixit

Role of biotechnology in forensic science

Kamalesh Gupta B

Dna fingerprinting

Jamia Hamdard New Delhi

Dna fingerprinting

Shweta Chavan

Dna fingerprinting

Zeeshan Ahmed

DNA fingerprinting

Zeeshan Ahmed

Molecular Techniques in Microbiology.pptx

KeeziaKhurshid1

Pcr based gene cloning

BipashaDatta1

Dna sequening

Muthu Kumar M

Types of different blotting techniques.pptx

khadijarafiq2012

AFLP, RFLP & RAPD

DOCTOR WHO

Sanger sequencing

JYOTI PAWAR

Detailed explanation about gene sequencing methods Sequencing the gene is an important step toward understanding the gene. A gene sequence contains some clues about where genes are. Gene sequencing give us understanding how the genome as a whole works-how genes work together to direct the growth, development and maintenance of an entire organism. It help scientists to study the part of genome outside the genes-regulatory regions

Gene sequencing (pharmacology) (sem 1)

Baidehi Mitra

Northern blotting

Nabajit Roy

Dna chips, RFLPs & dna fingerprint

Tapeshwar Yadav

DNA FINGERPRINTING :- “DNA fingerprinting is a technique that shows the genetic makeup of living things. It is a method of finding the difference between the satellite DNA regions in the genome.” Content:- 1) Introduction : What is DNA Fingerprinting? 2) Biological samples used 3) Discovery : Who invented DNA Fingerprinting? 4) Procedure : Basic steps and procedure for DNA Fingerprinting 5) Application : Various applications of DNA Fingerprinting

DNA Fingerprinting

HRUTUJA24

Next generation sequencing technologies for crop improvement

Presentation1

485 lec6 sequencing

Northern blotting

Similar to DNA Typing.pptx (20)

Presentation dna fingerprinting

Role of biotechnology in forensic science

Dna fingerprinting

DNA fingerprinting

Molecular Techniques in Microbiology.pptx

Pcr based gene cloning

Dna sequening

Types of different blotting techniques.pptx

AFLP, RFLP & RAPD

Sanger sequencing

Gene sequencing (pharmacology) (sem 1)

Northern blotting

Dna chips, RFLPs & dna fingerprint

DNA Fingerprinting

Next generation sequencing technologies for crop improvement

Presentation1

485 lec6 sequencing

Northern blotting

Recently uploaded

Call Now ☎ 8264348440 !! Call Girls in Rani Bagh Escort Service Delhi N.C.R. Why you Choose Us- +91-8264348440 I Have Extremely Beautiful Broad Minded Cute Sexy & Hot Call Girls Delhi and Escorts, We Are Located in 3* 4* 5* Hotels. Safe & Secure High Class Services Affordable Rate 100% Satisfaction, Unlimited Enjoyment. Any Time for Model/Teens Escort in Delhi High class luxury and premium escorts agency. ★ CALL US High Class Luxury and Premium Escort Service We Provide Well Educated,Royal Class Female,High-Class Escort Service Offering a Top High Class Escort Service In The & Several Nearby All Places of . ★ To Enjoy With Hot and Sexy Girls . ★ We Are Providing :- • 3* 5* 7*Hotels Service • Hygienic Full AC Neat and Clean Rooms Avail. • Daily New Escorts Staff Available • Minimum to Maximum Range Available. Our escort service •BJ (Blowjob) •FK (French kissing) •Kissing with tongue •O-Level (Oral sex) •Long Silky Brown Hair •69 (69 sex) •A-Level (5 start Escort) •Dating {{{N.M}}} 30-04-2024

Call Now ☎ 8264348440 !! Call Girls in Rani Bagh Escort Service Delhi N.C.R.

soniya singh

BooK Now Call us at +918448380779 to hire a gorgeous and seductive call girl for sex. Take a Delhi Escort Service. The help of our escort agency is mostly meant for men who want sexual Indian Escorts In Delhi NCR. It should be noted that any impersonator will get 100 attention from our Young Girls Escorts in Delhi. They will assume the position of reliable allies. VIP Call Girl With Original Photos Book Tonight +918448380779 Our Cheap Price 1 Hour not available 2 Hours 5000 Full Night 8000 TAG: Call Girls in Delhi, Noida, Gurgaon, Ghaziabad, Connaught Place, Greater Kailash Delhi, Lajpat Nagar Delhi, Mayur Vihar Delhi, Chanakyapuri Delhi, New Friends Colony Delhi, Majnu Ka Tilla, Karol Bagh, Malviya Nagar, Saket, Khan Market, Noida Sector 18, Noida Sector 76, Noida Sector 51, Gurgaon Mg Road, Iffco Chowk Gurgaon, Rajiv Chowk Gurgaon All Delhi Ncr Free Home Deliver

Enjoy Night⚡Call Girls Dlf City Phase 3 Gurgaon >༒8448380779 Escort Service

Delhi Call girls

Call Girls Dubai Dubai Call Girls Agency +971525547819 Vip Call Girls Dubai Hot Call Girls Dubai Out Call Girls Dubai Best Call Girls Dubai Indian And Pakistani Call Girls Dubai Independent Call Girls Dubai Dubai Indian Call Girls Agency Class Call Girls In Dubai #First Class Call Girls In Dubai #Full Massage Services Call Girls In Dubai Full Night Call Girls Dubai Hourly Call Girls Dubai Call Girls Deira Dubai Dating Call Girls In Deira Dubai Silicon Oasis Call Girls Dubai International City Call Girls Dubai Al Jaddaf Al Satwa Al Quoz Al Barsha South Media City Discovery Garden Call Girls Dubai Al Jaffiliya,Business Bay,Al Karama,Bur Dubai,Deira,Dubai,Palm Jumeirah,Al Wasl,Trade Centre,Dubai Mall,JBR,JVC,JLT,Discovery Garden Al Nahda Call Girls Dubai Al Qusais Call Girls Dubai Dating Call Girls Dubai Dubai Call Girls Services Provide In Ajman_Dubai_RAK_UMQ_Fujairah_Abu_Dhabi#Indian #Tamil #Kerala #Russian #Philippine #Morocco #Thailand #English Models In Dubai #If You Want Serv#Dubai Pakistani Call Girls Agency #Beautiful Call Girls in Dubai #High ices Just Send Me Text On Whatsapp +971525547819 #Website Link http://Dubaicallgirls.pro https://chatwith.io/s/65d1df48b2992

Dubai Call Girls Milky O525547819 Call Girls Dubai Soft Dating

kojalkojal131

Ganeshkhind ! Call Girls Pune - 450+ Call Girl Cash Payment 8005736733 Neha Thakur Booking Now open +91- 8005736733 Why you Choose Us- +91- 8005736733 HOT⇄ 8005736733 Mr ashu ji Call Mr ashu Ji +91- 8005736733 𝐇𝐨𝐭𝐞𝐥 𝐑𝐨𝐨𝐦𝐬 𝐈𝐧𝐜𝐥𝐮𝐝𝐢𝐧𝐠 𝐑𝐚𝐭𝐞 𝐒𝐡𝐨𝐭𝐬/𝐇𝐨𝐮𝐫𝐲🆓 .█▬█⓿▀█▀ 𝐈𝐍𝐃𝐄𝐏𝐄𝐍𝐃𝐄𝐍𝐓 𝐆𝐈𝐑𝐋 𝐕𝐈𝐏 𝐄𝐒𝐂𝐎𝐑𝐓 Hello Guys ! High Profiles young Beauties and Good Looking standard Profiles Available , Enquire Now if you are interested in Hifi Service and want to get connect with someone who can understand your needs. Service offers you the most beautiful High Profile sexy independent female Escorts in genuine ✔✔$V15 ✔✔To enjoy with hot and sexy girls ✔✔✔ ★providing:- • Models • vip Models • Russian Models • Foreigner Models • TV Actress and Celebrities • Receptionist • Air Hostess • Call Center Working Girls/Women • Hi-Tech Co. Girls/Women • Housewife

Ganeshkhind ! Call Girls Pune - 450+ Call Girl Cash Payment 8005736733 Neha T...

SUHANI PANDEY

Trump Diapers Over Dems t shirts Sweatshirt

rahman018755

VVIP Pune Call Girls Sinhagad WhatSapp Number 8005736733 With Elite Staff And Reasonable Packages Near You Booking Now open +91- 8005736733 Why you Choose Us- +91- 8005736733 HOT⇄ 8005736733 Mr ashu ji Call Mr ashu Ji +91- 8005736733 𝐇𝐨𝐭𝐞𝐥 𝐑𝐨𝐨𝐦𝐬 𝐈𝐧𝐜𝐥𝐮𝐝𝐢𝐧𝐠 𝐑𝐚𝐭𝐞 𝐒𝐡𝐨𝐭𝐬/𝐇𝐨𝐮𝐫𝐲🆓 .█▬█⓿▀█▀ 𝐈𝐍𝐃𝐄𝐏𝐄𝐍𝐃𝐄𝐍𝐓 𝐆𝐈𝐑𝐋 𝐕𝐈𝐏 𝐄𝐒𝐂𝐎𝐑𝐓 Hello Guys ! High Profiles young Beauties and Good Looking standard Profiles Available , Enquire Now if you are interested in Hifi Service and want to get connect with someone who can understand your needs. Service offers you the most beautiful High Profile sexy independent female Escorts in genuine ✔✔✔ To enjoy with hot and sexy girls ✔✔✔$V15 ★providing:- • Models • vip Models • Russian Models • Foreigner Models • TV Actress and Celebrities • Receptionist • Air Hostess • Call Center Working Girls/Women • Hi-Tech Co. Girls/Women • Housewife

VVIP Pune Call Girls Sinhagad WhatSapp Number 8005736733 With Elite Staff And...

SUHANI PANDEY

Call Girls Dubai Dubai Call Girls Agency Vip Call Girls Dubai Hot Call Girls Dubai Out Call Girls Dubai Best Call Girls Dubai Indian And Pakistani Call Girls Dubai Independent Call Girls Dubai Dubai Indian Call Girls Agency Class Call Girls In Dubai #First Class Call Girls In Dubai #Full Massage Services Call Girls In Dubai Full Night Call Girls Dubai Hourly Call Girls Dubai Call Girls Deira Dubai Dating Call Girls In Deira Dubai Silicon Oasis Call Girls Dubai International City Call Girls Dubai Al Jaddaf Al Satwa Al Quoz Al Barsha South Media City Discovery Garden Call Girls Dubai Al Jaffiliya,Business Bay,Al Karama,Bur Dubai,Deira,Dubai,Palm Jumeirah,Al Wasl,Trade Centre,Dubai Mall,JBR,JVC,JLT,Discovery Garden Al Nahda Call Girls Dubai Al Qusais Call Girls Dubai Dating Call Girls Dubai Dubai Call Girls Services Provide In Ajman_Dubai_RAK_UMQ_Fujairah_Abu_Dhabi#Indian #Tamil #Kerala #Russian #Philippine #Morocco #Thailand #English Models In Dubai #If You Want Serv#Dubai Pakistani Call Girls Agency #Beautiful Call Girls in Dubai #High ices Just Send Me Text On Whatsapp #

Al Barsha Night Partner +0567686026 Call Girls Dubai

Escorts Call Girls

Call Girl In Delhi ☎92055#41914 ¶¶ Indian,Russian Best Quality full Educated And Full Cooperative Independent Call Girls Escort Services In New Delhi- I Have Extremely Beautiful Broad Minded Cute Sexy & Hot Call Girls and Escorts, We Are Located in 3* 4* 5* Hotels in Delhi. Safe & Secure High Class Services Affordable Rate 100% Satisfaction, Unlimited Enjoyment. Any Time for Model/Teens Escort in Delhi High class luxury and premium escorts agency Indian Russian Call Girls In Delhi Booking Good High Profile Escorts (Call Girls) In Delhi 5 Star Hotel ,Incall Service,OutCall Service, We provide services by Call Girls,College Girls,Modals Get High Profile queens,Well Educated,Good Looking,Full Cooperative Model, Russian Models,Punjabi Girls Kashmeri Girls Services etc… We Provide Hottest Female With Safe And Consensual With Most Limits Respected Complete Satisfaction Guaranteed…Service. Call Me Spacial For Including Incall//outcall Service In New Delhi Indian Russian Escorts Service

Hire↠Young Call Girls in Tilak nagar (Delhi) ☎️ 9205541914 ☎️ Independent Esc...

Delhi Call girls

Low Sexy Call Girls In Mohali 9053900678 🥵Have Save And Good Place 🥵 (Simran) Call Girls in Chandigarh- 9053900678Escorts Service 50% Off with Cash ON Delivery★ 😋 Chandigarh Call girls ✂️ Service Hello my dear gentleman ❤️ Are you looking for a smart, beautiful Girl ? I will seduce you and intoxicate you from head to toe, with beautiful green eyes, soft pout, curly hair, big natural breasts, and flawless curves. I'm flirtatious, I exude confidence and incredible attractiveness, and I've mastered the art of seduction, which makes me the perfect companion for any occasion that calls for a little depraved play. Unforgettable appointment at your hotel or in my apartment. Call Girls in Chandigarh Chandigarh Call Girl Service call girl Chandigarh Chandigarh call girl escort in Chandigarh Chandigarh escort. Chandigarh escort service, Escort service in Chandigarh, Chandigarh escorts service, Chandigarh escorts agency. I Have Extremely Beautiful Broad Minded Cute Sexy & Hot Call Girls and Escorts, We Are Located in 3* 4* 5* Hotels in Chandigarh. Safe & Secure High-Class Services Affordable Rate 100% Satisfaction, Unlimited Enjoyment. Any Time for Model/Teens Escort in Chandigarh High-Class luxury and Premium Escorts ServiCe. Hot And Sexy Independent Model Escort Service In Chandigarh Unlimited Enjoy Genuine 100% Profiles And Trusted Door Step Call Girls Feel Free To Call Us Female Service Hot Busty & Sexy Party Girls Available For Complete Enjoyment. We Guarantee Full Satisfaction & In Case Of Any Unhappy Experience, We Would Refund Your Fees, Without Any Questions. Feel Free To Call Us Female Service Provider Hours Open Thanks. ★ CALL US High Class Luxury and Premium Escorts ServiCe We Provide Well Educated, Royal Class Female, High-Class Escorts Offering a Top High-Class Escorts Service In the & Several Nearby All Places Of . ★ Get The High Profile, Bollywood Queens , Well Educated , Good Looking , Full Cooperative Model Services. You Can See Me at My Comfortable Hotels or I Can Visit You In hotel Our Service Available IN All SERVICE, 3/4/5 STAR HOTEL , In Call /Out Call Services.24 hrs , ★ To Enjoy With Hot and Sexy Girls . ★ We Are Providing :- • Models • Vip Models • Russian Models • Foreigner Models • TV Actress and Celebrities • Receptionist • Air Hostess • Call Center Working Girls/Women • Hi-Tech Co. Girls/Women • Housewife • Collage Going Girls. • Travelling Escorts. • Ramp-Models • Foreigner And Many More.. Incall & Outcall Available… • INDEPENDENT GIRLS / HOUSE WIFES ★ I Guarantee You To Have An Unforgettable Experience With Me.A Curvy Body, long Hair and Silky Smooth Skin. She Is an Independent Escorts Model Will Give You More Pleasure & Full Satisfaction. ★OUR BEST SERVICES: – FOR BOOKING CALL Call/WhatsApp ☎+91-9115573837☎ ★ A-Level (5 Star Escort) ★ Strip-Tease ★ BBBJ (Bareback Blowjob) ★ Spending time in my rooms ★ BJ (Blowjob Without a Condom) ★ COF (Come On Face) ★ Completion ★ (Oral To Completion) ★ Special Massage ★ O-Level (Oral s

Low Sexy Call Girls In Mohali 9053900678 🥵Have Save And Good Place 🥵

Chandigarh Call girls 9053900678 Call girls in Chandigarh

VIP Call Girls Pollachi 7001035870 Whatsapp Number, 24/07 Booking Escorts Service Available Whatsapp SABANA ☎️ : [+91-7001035870] Escorts Service are always ready to make their clients happy. Their exotic looks and sexy personalities are sure to turn heads. You can enjoy with them, including massages and erotic encounters. Our area Escorts are young and sexy, so you can expect to have an exotic time with them. They are trained to satiate your naughty nerves and they can handle anything that you want. They are also intelligent, so they know how to make you feel comfortable and relaxed Independent Escorts Service They know all the sex positions and can satisfy you in any way that you desire. They can even give you erotic massages to help you relax before your session. This is essential, because a man who is stressed won’t be receptive to the pleasures of sex. They also know how to play with your sexy organs, so you’ll have plenty of foreplay and cuddling. P252024SS SERVICE ✅ ❣️ ⭐➡️HOT & SEXY MODELS // COLLEGE GIRLS HOUSE WIFE RUSSIAN , AIR HOSTES ,VIP MODELS . AVAILABLE FOR COMPLETE ENJOYMENT WITH HIGH PROFILE INDIAN MODEL AVAILABLE HOTEL & HOME ★ SAFE AND SECURE HIGH CLASS SERVICE AFFORDABLE RATE ★ SATISFACTION,UNLIMITED ENJOYMENT. ★ All Meetings are confidential and no information is provided to any one at any cost. ★ EXCLUSIVE PROFILes Are Safe and Consensual with Most Limits Respected ★ Service Available In: - HOME & HOTEL Star Hotel Service .In Call & Out call SeRvIcEs : ★ A-Level (star escort) ★ Strip-tease ★ BBBJ (Bareback Blowjob)Receive advanced sexual techniques in different mode make their life more pleasurable. ★ Spending time in hotel rooms ★ BJ (Blowjob Without a Condom) ★ Completion (Oral to completion) ★ Covered (Covered blowjob Without condom ★ANAL SERVICES.

VIP Call Girls Pollachi 7001035870 Whatsapp Number, 24/07 Booking

dharasingh5698

Call Now ☎ 8264348440 !! Call Girls in Green Park Escort Service Delhi N.C.R. Why you Choose Us- +91-8264348440 I Have Extremely Beautiful Broad Minded Cute Sexy & Hot Call Girls Delhi and Escorts, We Are Located in 3* 4* 5* Hotels. Safe & Secure High Class Services Affordable Rate 100% Satisfaction, Unlimited Enjoyment. Any Time for Model/Teens Escort in Delhi High class luxury and premium escorts agency. ★ CALL US High Class Luxury and Premium Escort Service We Provide Well Educated,Royal Class Female,High-Class Escort Service Offering a Top High Class Escort Service In The & Several Nearby All Places of . ★ To Enjoy With Hot and Sexy Girls . ★ We Are Providing :- • 3* 5* 7*Hotels Service • Hygienic Full AC Neat and Clean Rooms Avail. • Daily New Escorts Staff Available • Minimum to Maximum Range Available. Our escort service •BJ (Blowjob) •FK (French kissing) •Kissing with tongue •O-Level (Oral sex) •Long Silky Brown Hair •69 (69 sex) •A-Level (5 start Escort) •Dating

Call Now ☎ 8264348440 !! Call Girls in Green Park Escort Service Delhi N.C.R.

soniya singh

Wagholi & High Class Call Girls Pune Neha 8005736733 | 100% Gennuine High Class Independent Escorts service Booking Now open +91- 8005736733 Why you Choose Us- +91- 8005736733 HOT⇄ 8005736733 Mr ashu ji Call Mr ashu Ji +91- 8005736733 𝐇𝐨𝐭𝐞𝐥 𝐑𝐨𝐨𝐦𝐬 𝐈𝐧𝐜𝐥𝐮𝐝𝐢𝐧𝐠 𝐑𝐚𝐭𝐞 𝐒𝐡𝐨𝐭𝐬/𝐇𝐨𝐮𝐫𝐲🆓 .█▬█⓿▀█▀ 𝐈𝐍𝐃𝐄𝐏𝐄𝐍𝐃𝐄𝐍𝐓 𝐆𝐈𝐑𝐋 𝐕𝐈𝐏 𝐄𝐒𝐂𝐎𝐑𝐓 Hello Guys ! High Profiles young Beauties and Good Looking standard Profiles Available , Enquire Now if you are interested in Hifi Service and want to get connect with someone who can understand your needs. Service offers you the most beautiful High Profile sexy independent female Escorts in genuine ✔✔$V15 ✔✔To enjoy with hot and sexy girls ✔✔✔ ★providing:- • Models • vip Models • Russian Models • Foreigner Models • TV Actress and Celebrities • Receptionist • Air Hostess • Call Center Working Girls/Women • Hi-Tech Co. Girls/Women • Housewife

Wagholi & High Class Call Girls Pune Neha 8005736733 | 100% Gennuine High Cla...

SUHANI PANDEY

Call Girls Ludhiana Just Call 98765-12871 Top Class Call Girl Service Available

Seo

Shikrapur - Call Girls in Pune Neha 8005736733 | 100% Gennuine High Class Independent Escorts service Booking Now open +91- 8005736733 Why you Choose Us- +91- 8005736733 HOT⇄ 8005736733 Mr ashu ji Call Mr ashu Ji +91- 8005736733 𝐇𝐨𝐭𝐞𝐥 𝐑𝐨𝐨𝐦𝐬 𝐈𝐧𝐜𝐥𝐮𝐝𝐢𝐧𝐠 𝐑𝐚𝐭𝐞 𝐒𝐡𝐨𝐭𝐬/𝐇𝐨𝐮𝐫𝐲🆓 .█▬█⓿▀█▀ 𝐈𝐍𝐃𝐄𝐏𝐄𝐍𝐃𝐄𝐍𝐓 𝐆𝐈𝐑𝐋 𝐕𝐈𝐏 𝐄𝐒𝐂𝐎𝐑𝐓 Hello Guys ! High Profiles young Beauties and Good Looking standard Profiles Available , Enquire Now if you are interested in Hifi Service and want to get connect with someone who can understand your needs. Service offers you the most beautiful High Profile sexy independent female Escorts in genuine ✔✔$V15 ✔✔To enjoy with hot and sexy girls ✔✔✔ ★providing:- • Models • vip Models • Russian Models • Foreigner Models • TV Actress and Celebrities • Receptionist • Air Hostess • Call Center Working Girls/Women • Hi-Tech Co. Girls/Women • Housewife

Shikrapur - Call Girls in Pune Neha 8005736733 | 100% Gennuine High Class Ind...

SUHANI PANDEY

valsad Escorts Service ☎️ 6378878445 ( Sakshi Sinha ) High Profile Call Girls In valsad Book All India 5 Star Hotels 👄 Escorts Service Available Whatsapp Chaya ☎️ : [+91-6378878445] Escorts Service are always ready to make their clients happy. Their exotic looks and sexy personalities are sure to turn heads. You can enjoy with them, including massages and erotic encounters. Our area Escorts are young and sexy, so you can expect to have an exotic time with them. They are trained to satiate your naughty nerves and they can handle anything that you want. They are also intelligent, so they know how to make you feel comfortable and relaxed Independent Escorts Service They know all the sex positions and can satisfy you in any way that you desire. They can even give you erotic massages to help you relax before your session. This is essential, because a man who is stressed won’t be receptive to the pleasures of sex. They also know how to play with your sexy organs, so you’ll have plenty of foreplay and cuddling. P452024SS SERVICE ✅ ❣️ ⭐➡️HOT & SEXY MODELS // COLLEGE GIRLS HOUSE WIFE RUSSIAN , AIR HOSTES ,VIP MODELS . AVAILABLE FOR COMPLETE ENJOYMENT WITH HIGH PROFILE INDIAN MODEL AVAILABLE HOTEL & HOME ★ SAFE AND SECURE HIGH CLASS SERVICE AFFORDABLE RATE ★ SATISFACTION,UNLIMITED ENJOYMENT. ★ All Meetings are confidential and no information is provided to any one at any cost. ★ EXCLUSIVE PROFILes Are Safe and Consensual with Most Limits Respected ★ Service Available In: - HOME & HOTEL Star Hotel Service .In Call & Out call SeRvIcEs : ★ A-Level (star escort) ★ Strip-tease ★ BBBJ (Bareback Blowjob)Receive advanced sexual techniques in different mode make their life more pleasurable. ★ Spending time in hotel rooms ★ BJ (Blowjob Without a Condom) ★ Completion (Oral to completion) ★ Covered (Covered blowjob Without condom ★ANAL SERVICES.

valsad Escorts Service ☎️ 6378878445 ( Sakshi Sinha ) High Profile Call Girls...

Call Girls In Delhi Whatsup 9873940964 Enjoy Unlimited Pleasure

VIP Model Call Girls NIBM ( Pune ) Call ON 8005736733 Starting From 5K to 25K High Profile Escorts In Pune Booking Now open +91- 8005736733 Why you Choose Us- +91- 8005736733 HOT⇄ 8005736733 Mr ashu ji Call Mr ashu Ji +91- 8005736733 (V030524]N) 𝐇𝐨𝐭𝐞𝐥 𝐑𝐨𝐨𝐦𝐬 𝐈𝐧𝐜𝐥𝐮𝐝𝐢𝐧𝐠 𝐑𝐚𝐭𝐞 𝐒𝐡𝐨𝐭𝐬/𝐇𝐨𝐮𝐫𝐲🆓 .█▬█⓿▀█▀ 𝐈𝐍𝐃𝐄𝐏𝐄𝐍𝐃𝐄𝐍𝐓 𝐆𝐈𝐑𝐋 𝐕𝐈𝐏 𝐄𝐒𝐂𝐎𝐑𝐓 Hello Guys ! High Profiles young Beauties and Good Looking standard Profiles Available , Enquire Now if you are interested in Hifi Service and want to get connect with someone who can understand your needs. Service offers you the most beautiful High Profile sexy independent female Escorts in genuine ✔✔✔ To enjoy with hot and sexy girls ✔✔✔ ★providing:- • Models • vip Models • Russian Models • Foreigner Models • TV Actress and Celebrities • Receptionist • Air Hostess • Call Center Working Girls/Women • Hi-Tech Co. Girls/Women • Housewife

VIP Model Call Girls NIBM ( Pune ) Call ON 8005736733 Starting From 5K to 25K...

SUHANI PANDEY

Yerawada ] Independent Escorts in Pune - Book 8005736733 Call Girls Available 24 Hours In All City Booking Now open +91- 8005736733 Why you Choose Us- +91- 8005736733 HOT⇄ 8005736733 Mr ashu ji Call Mr ashu Ji +91- 8005736733 𝐇𝐨𝐭𝐞𝐥 𝐑𝐨𝐨𝐦𝐬 𝐈𝐧𝐜𝐥𝐮𝐝𝐢𝐧𝐠 𝐑𝐚𝐭𝐞 𝐒𝐡𝐨𝐭𝐬/𝐇𝐨𝐮𝐫𝐲🆓 .█▬█⓿▀█▀ 𝐈𝐍𝐃𝐄𝐏𝐄𝐍𝐃𝐄𝐍𝐓 𝐆𝐈𝐑𝐋 𝐕𝐈𝐏 𝐄𝐒𝐂𝐎𝐑𝐓 Hello Guys ! High Profiles young Beauties and Good Looking standard Profiles Available , Enquire Now if you are interested in Hifi Service and want to get connect with someone who can understand your needs. Service offers you the most beautiful High Profile sexy independent female Escorts in genuine ✔✔$V15 ✔✔To enjoy with hot and sexy girls ✔✔✔ ★providing:- • Models • vip Models • Russian Models • Foreigner Models • TV Actress and Celebrities • Receptionist • Air Hostess • Call Center Working Girls/Women • Hi-Tech Co. Girls/Women • Housewife

Yerawada ] Independent Escorts in Pune - Book 8005736733 Call Girls Available...

SUHANI PANDEY

Enjoy Night⚡Call Girls Samalka Delhi >༒8448380779 Escort Service

Delhi Call girls

VIP Call Girls Himatnagar 7001035870 Whatsapp Number, 24/07 Booking Escorts Service Available Whatsapp SABANA ☎️ : [+91-7001035870] Escorts Service are always ready to make their clients happy. Their exotic looks and sexy personalities are sure to turn heads. You can enjoy with them, including massages and erotic encounters. Our area Escorts are young and sexy, so you can expect to have an exotic time with them. They are trained to satiate your naughty nerves and they can handle anything that you want. They are also intelligent, so they know how to make you feel comfortable and relaxed Independent Escorts Service They know all the sex positions and can satisfy you in any way that you desire. They can even give you erotic massages to help you relax before your session. This is essential, because a man who is stressed won’t be receptive to the pleasures of sex. They also know how to play with your sexy organs, so you’ll have plenty of foreplay and cuddling. P252024SS SERVICE ✅ ❣️ ⭐➡️HOT & SEXY MODELS // COLLEGE GIRLS HOUSE WIFE RUSSIAN , AIR HOSTES ,VIP MODELS . AVAILABLE FOR COMPLETE ENJOYMENT WITH HIGH PROFILE INDIAN MODEL AVAILABLE HOTEL & HOME ★ SAFE AND SECURE HIGH CLASS SERVICE AFFORDABLE RATE ★ SATISFACTION,UNLIMITED ENJOYMENT. ★ All Meetings are confidential and no information is provided to any one at any cost. ★ EXCLUSIVE PROFILes Are Safe and Consensual with Most Limits Respected ★ Service Available In: - HOME & HOTEL Star Hotel Service .In Call & Out call SeRvIcEs : ★ A-Level (star escort) ★ Strip-tease ★ BBBJ (Bareback Blowjob)Receive advanced sexual techniques in different mode make their life more pleasurable. ★ Spending time in hotel rooms ★ BJ (Blowjob Without a Condom) ★ Completion (Oral to completion) ★ Covered (Covered blowjob Without condom ★ANAL SERVICES.

VIP Call Girls Himatnagar 7001035870 Whatsapp Number, 24/07 Booking

dharasingh5698

All Time Service Available Call Girls Mg Road 👌 ⏭️ 6378878445 Why you Choose Us- +91-6378878445 Bangalore Escort Service includes providing maximum physical satisfaction to their clients as well as engaging conversation that keeps your time enjoyable and entertaining. Plus they look fabulously elegant; making an impressionable I Have Extremely Beautiful Broad Minded Cute Sexy & Hot Call Girls and Escorts, We Are Located in 3* 4* 5* Hotels. Safe & Secure High Class Services Affordable Rate 100% Satisfaction, Unlimited Enjoyment. Any Time for Model/Teens Escort in Delhi High class luxury and premium escorts agency. CALL US High Class Luxury and Premium Escort Service We Provide Well Educated,Royal Class Female,High-Class Escort Service Offering a Top High Class Escort Service In The & Several Nearby All Places of . (L030524]k)

All Time Service Available Call Girls Mg Road 👌 ⏭️ 6378878445

ruhi

Recently uploaded (20)