This document discusses molecular evolution at the sequence level. It provides context on molecular evolution and defines key terms like purifying selection, neutral theory, and positive selection. It describes how the genetic code works, including synonymous and nonsynonymous substitutions. Methods for estimating substitution rates and codon usage biases are introduced. Applications of molecular evolution analysis to subjects like human/primate relationships and disease origins are also mentioned.
This document presents information on complementation tests. It defines complementation tests as a method used to determine if two mutations are in the same gene or different genes. It explains that if the mutations are complementary (in different genes), the offspring will show the parental phenotypes, but if they are not complementary (in the same gene), the offspring will show a new phenotype. Three examples of using complementation test results to determine the number of genes involved are provided. The document concludes by citing a reference for more information on assigning mutations to genes using complementation tests.
Molecular evolution, four class of chromosomal mutation, Negative Selection and Positive Selection, Mutations in DNA and protein, Neutral Theory of Molecular Evolution, Evidence supporting neutral evolution, Phylogenetic trees, Methods of Tree reconstruction
This document provides an overview of molecular evolution. It defines molecular evolution as the process of change in DNA, RNA, and protein sequences across generations, as examined using principles of evolutionary biology and population genetics. The history and key developments in the field are discussed, including the neutral theory of molecular evolution. Applications like revealing evolutionary dynamics, indicating chronological change, and identifying phylogenetic relationships are covered. Details are provided about sequence alignments, substitutions, molecular clocks, and variation in evolutionary rates within genes.
Complementation test; AC-DS System in MaizeAVKaaviya
The document discusses the Ac-Ds transposable element system in maize and complementation testing. It notes that Ac is an autonomous transposable element that enables the movement of Ds elements. McClintock discovered that Ac, Ds, and the C gene are responsible for color instability in maize seeds. Complementation testing determines if two recessive mutations represent alleles of the same gene or different genes.
A complementation test (sometimes called a "cis-trans" test) can be used to test whether the mutations in two strains are in different genes. By taking an example of Benzer's work, complementation has been explained.
Phylogenetic Tree, types and Applicantion Faisal Hussain
Phylogenetic trees are diagrams that show evolutionary relationships between organisms. They depict how groups of organisms are genetically related based on similarities and differences in physical or genetic characteristics. Charles Darwin first published phylogenetic trees in his 1859 book On the Origin of Species. Phylogenetic trees are used to understand human and animal origins, biogeography, traits, and disease. They can be rooted or unrooted, bifurcating or multi-furcating. Computational programs are used to construct phylogenetic trees based on criteria like efficiency, power, and consistency.
Genetic drift is a mechanism of evolution that causes changes in allele frequencies in a population due to random sampling of organisms. It is common in small populations and can cause some alleles to become more common or disappear entirely over time. There are two main types of genetic drift: the bottleneck effect, which occurs when a disaster reduces population size, and the founder effect, which happens when a group founds a new population. Both types can lead to new populations becoming genetically distinct from the original population and play a role in evolution and speciation.
This document presents information on complementation tests. It defines complementation tests as a method used to determine if two mutations are in the same gene or different genes. It explains that if the mutations are complementary (in different genes), the offspring will show the parental phenotypes, but if they are not complementary (in the same gene), the offspring will show a new phenotype. Three examples of using complementation test results to determine the number of genes involved are provided. The document concludes by citing a reference for more information on assigning mutations to genes using complementation tests.
Molecular evolution, four class of chromosomal mutation, Negative Selection and Positive Selection, Mutations in DNA and protein, Neutral Theory of Molecular Evolution, Evidence supporting neutral evolution, Phylogenetic trees, Methods of Tree reconstruction
This document provides an overview of molecular evolution. It defines molecular evolution as the process of change in DNA, RNA, and protein sequences across generations, as examined using principles of evolutionary biology and population genetics. The history and key developments in the field are discussed, including the neutral theory of molecular evolution. Applications like revealing evolutionary dynamics, indicating chronological change, and identifying phylogenetic relationships are covered. Details are provided about sequence alignments, substitutions, molecular clocks, and variation in evolutionary rates within genes.
Complementation test; AC-DS System in MaizeAVKaaviya
The document discusses the Ac-Ds transposable element system in maize and complementation testing. It notes that Ac is an autonomous transposable element that enables the movement of Ds elements. McClintock discovered that Ac, Ds, and the C gene are responsible for color instability in maize seeds. Complementation testing determines if two recessive mutations represent alleles of the same gene or different genes.
A complementation test (sometimes called a "cis-trans" test) can be used to test whether the mutations in two strains are in different genes. By taking an example of Benzer's work, complementation has been explained.
Phylogenetic Tree, types and Applicantion Faisal Hussain
Phylogenetic trees are diagrams that show evolutionary relationships between organisms. They depict how groups of organisms are genetically related based on similarities and differences in physical or genetic characteristics. Charles Darwin first published phylogenetic trees in his 1859 book On the Origin of Species. Phylogenetic trees are used to understand human and animal origins, biogeography, traits, and disease. They can be rooted or unrooted, bifurcating or multi-furcating. Computational programs are used to construct phylogenetic trees based on criteria like efficiency, power, and consistency.
Genetic drift is a mechanism of evolution that causes changes in allele frequencies in a population due to random sampling of organisms. It is common in small populations and can cause some alleles to become more common or disappear entirely over time. There are two main types of genetic drift: the bottleneck effect, which occurs when a disaster reduces population size, and the founder effect, which happens when a group founds a new population. Both types can lead to new populations becoming genetically distinct from the original population and play a role in evolution and speciation.
This document discusses exon shuffling, which is a mechanism by which new genes can form through the rearrangement of exons from different genes. Exon shuffling was first proposed in 1978 and involves recombination within introns that allows exons to be assorted independently, generating new exon combinations. There are three main types of exon shuffling: exon duplication, insertion, and deletion. Exon shuffling generates genetic variation and mosaic proteins, and it has played a major role in evolution. The mechanisms involved are crossover during sexual recombination and transposon-mediated movements that can cut, paste, or copy and paste exons into new locations.
Extrachromosomal inheritance involves the transmission of genetic traits from parent to offspring through cytoplasmic organelles like chloroplasts and mitochondria, rather than through nuclear genes. Three examples are given: (1) variegated leaves in four o'clock plants are inherited cytoplasmically, (2) streptomycin resistance in Chlamydomonas is inherited through chloroplasts, and (3) "poky" phenotype and abnormal cytochromes in Neurospora are inherited maternally through mitochondria. Cytoplasmic inheritance can also cause traits like cytoplasmic male sterility in plants. Maternal effects occur when the female parent's genotype influences offspring traits regardless of the male parent's genotype.
This document provides an overview of phylogenetic analysis, including:
1) Phylogenetic analysis involves inferring evolutionary relationships between taxa by building phylogenetic trees and analyzing character evolution.
2) Phylogenetic trees show the branching patterns and relationships between taxa, with internal nodes representing hypothetical ancestors.
3) Phylogenetic analysis can provide insights into questions like human evolution, disease transmission, and the origins of genetic elements.
Introduction
Genetics of somatic cell
Somatic cell genetics
Somatic cell nuclear transfer
Somatic cell hybridization
Mapping human genes by using human rodent hybrids
In medical application
Production of monoclonal antibodies by using hybridoma technology
Conclusion
References
The lac operon controls the breakdown of lactose in E. coli bacteria. It consists of three structural genes (lacZ, lacY, lacA) that are regulated by a single promoter and operator region. In the absence of lactose, a lac repressor binds to the operator, preventing transcription of the structural genes. When lactose is present, it binds to the repressor and causes a conformational change, releasing it from the operator and allowing transcription. Mutations in the operator, structural genes, or promoter region provided insights into the operon's control mechanism.
Somatic cell hybridization involves fusing cells from two different species, such as human and mouse cells, to form hybrid cells containing chromosomes from both species. This technique allows genes to be mapped to specific chromosomes. It works by using selective growth conditions that require the hybrid cell to retain certain human chromosomes in order to survive. Over successive cell divisions, human chromosomes are eliminated at random except for those required for survival. This allows the creation of cell lines containing partial sets of human chromosomes that can be analyzed to correlate genes with specific chromosomes. The technique has been important for mapping the human genome.
This Presentation will be helpful to undergraduate and postgraduate students of biology and biotechnology in understanding the significance of COT curves in determination of gene and genome complexity amoug various organisms
A brief description on Molecular Evolution, Kimura's theory of Molecular evolution, Neutral theory vs. Natural Selection, Neutral theory: The Null Hypothesis of Molecular Evolution
Cot value and Cot Curve analysis is a technique for measuring DNA complexity based on renaturation kinetics. DNA is denatured and allowed to reanneal, with larger DNA taking longer. Cot value accounts for DNA concentration, time, and buffer effects, representing repetitive sequences - lower Cot means more repeats. Examples show bacteria have nearly all single-copy DNA, while mouse has varying proportions of single-copy, middle repetitive, and highly repetitive sequences. Cot curve analysis provides information on genome size, complexity, and proportions of sequence types.
Cytoplasmic or extranuclear inheritance involves the transmission of traits controlled by genes located outside the cell nucleus, such as in mitochondria or chloroplasts. This form of inheritance does not follow Mendel's laws and instead is maternally inherited, with traits expressed based on the phenotype of the female parent. Examples discussed in the document include mitochondrial inheritance in humans, cytoplasmic factors influencing disease susceptibility in mice, and chloroplast genes controlling leaf color in plants.
Phylogeny is the evolutionary history of a taxonomic group as represented by a phylogenetic tree. The goals of phylogeny are to show relationships between species based on evolutionary time. There are several tools and methods used to build phylogenetic trees, including distance-based methods like UPGMA and neighbor joining which use sequence similarities, and character-based methods like maximum parsimony. Software like MEGA, Dendroscope, and Phylotree.js can be used to construct and visualize phylogenetic trees.
The document discusses neutral theory of molecular evolution, which holds that most genetic changes are due to neutral mutations that do not affect organismal fitness. It proposes that neutral mutations accumulate over time at a constant rate, allowing relative divergence times to be estimated. The theory aims to explain high genetic variation and presence of neutral substitutions between species. Several lines of evidence are presented, including comparative rates of evolution between functionally important and unimportant genes and gene regions.
GenBank is a database that contains annotated nucleotide and protein sequences. It includes genomic DNA, mRNA, and EST sequences. There are three main sections in a GenBank file - the header, features, and sequence. The header provides definition, accession number, organism, and reference information. The features section contains gene and protein annotation. The sequence section displays the actual nucleotide or amino acid sequence. Understanding the GenBank file format helps effectively search and retrieve sequences from this important biological database.
RNA splicing is a process where introns are removed from precursor messenger RNA (pre-mRNA) and exons are joined together to produce mature mRNA. It occurs in the nucleus and is essential for eukaryotes to produce proteins. The spliceosome, a large complex of RNA and proteins, facilitates two transesterification reactions that remove introns and ligate exons. RNA splicing generates protein diversity through alternative splicing and is important for cellular functions and disease processes.
1. Genetic mapping involves determining the linear order and distance between linked genes on chromosomes through test crosses.
2. Key processes include determining linkage groups, calculating map distances in morgan or centimorgan units, and using two-point and three-point test crosses to order genes.
3. Maps are constructed by combining map segments and are useful for understanding inheritance, disease diagnosis, and evolution.
The document discusses factors that can alter allelic frequencies in a population. It describes six main factors: 1) Mutation introduces new alleles, 2) Genetic drift like bottle neck effects can change frequencies randomly, 3) Migration through gene flow affects frequencies, 4) Natural selection increases frequencies of beneficial alleles and decreases unfavorable ones, 5) Non-random mating influences which individuals reproduce more, and 6) Inbreeding increases homozygosity. These genetic and evolutionary factors all impact the proportion of alleles in a population over time.
CYTOPLASMIC INHERITANCE WITH REFERENCETO MITOCHONDRIAL INHERITANCE IN YEASTBishnuPatra1
This document summarizes a presentation on cytoplasmic inheritance with reference to mitochondrial inheritance in yeast. It discusses how cytoplasmic inheritance transmits genes outside the nucleus, usually from the female parent. Mitochondria contain their own circular DNA called mt-DNA. Mitochondrial inheritance refers to traits encoded in the mitochondrial genome being inherited, generally from the female parent. The document uses petite mutations in yeast mitochondria as an example, describing three types of petite mutants: 1) Segregational petite mutants created by nuclear mutations that segregate mendelianly, 2) Neutral petite mutants whose offspring are wild type when crossed with wild type yeast, and 3) Suppressive petite mutants that dominate and suppress wild type mitochondrial function in offspring
Nucleosomes are the fundamental repeating subunits of eukaryotic chromatin that package DNA into a compact structure. They are composed of 146 base pairs of DNA wrapped around an octamer of histone proteins, resembling beads on a string. This represents the first order of DNA compaction. Higher orders of compaction involve the nucleosomes winding further to form solenoid fibers, scaffold loops, chromatids, and finally full chromosomes. Nucleosomes allow the long DNA molecules to fit within cell nuclei while also regulating genetic expression.
Chemical evolution theory of life’s originsrozh bahman
in this presentation the first stage of chemical evolution and origin of life is explained and also the oparin-haldane and urey miller experiment are explained too
The neutral theory of evolution proposes that most genetic mutations are selectively neutral or nearly neutral. Under this theory, genetic drift rather than natural selection is the primary determinant of whether a mutation becomes fixed in a population or lost. The neutral theory makes specific, testable predictions about levels of genetic polymorphism within species and rates of genetic divergence between species. Motoo Kimura developed the neutral theory in the 1950s-60s as an alternative to the prevailing view that natural selection determined the fate of most mutations.
This document discusses exon shuffling, which is a mechanism by which new genes can form through the rearrangement of exons from different genes. Exon shuffling was first proposed in 1978 and involves recombination within introns that allows exons to be assorted independently, generating new exon combinations. There are three main types of exon shuffling: exon duplication, insertion, and deletion. Exon shuffling generates genetic variation and mosaic proteins, and it has played a major role in evolution. The mechanisms involved are crossover during sexual recombination and transposon-mediated movements that can cut, paste, or copy and paste exons into new locations.
Extrachromosomal inheritance involves the transmission of genetic traits from parent to offspring through cytoplasmic organelles like chloroplasts and mitochondria, rather than through nuclear genes. Three examples are given: (1) variegated leaves in four o'clock plants are inherited cytoplasmically, (2) streptomycin resistance in Chlamydomonas is inherited through chloroplasts, and (3) "poky" phenotype and abnormal cytochromes in Neurospora are inherited maternally through mitochondria. Cytoplasmic inheritance can also cause traits like cytoplasmic male sterility in plants. Maternal effects occur when the female parent's genotype influences offspring traits regardless of the male parent's genotype.
This document provides an overview of phylogenetic analysis, including:
1) Phylogenetic analysis involves inferring evolutionary relationships between taxa by building phylogenetic trees and analyzing character evolution.
2) Phylogenetic trees show the branching patterns and relationships between taxa, with internal nodes representing hypothetical ancestors.
3) Phylogenetic analysis can provide insights into questions like human evolution, disease transmission, and the origins of genetic elements.
Introduction
Genetics of somatic cell
Somatic cell genetics
Somatic cell nuclear transfer
Somatic cell hybridization
Mapping human genes by using human rodent hybrids
In medical application
Production of monoclonal antibodies by using hybridoma technology
Conclusion
References
The lac operon controls the breakdown of lactose in E. coli bacteria. It consists of three structural genes (lacZ, lacY, lacA) that are regulated by a single promoter and operator region. In the absence of lactose, a lac repressor binds to the operator, preventing transcription of the structural genes. When lactose is present, it binds to the repressor and causes a conformational change, releasing it from the operator and allowing transcription. Mutations in the operator, structural genes, or promoter region provided insights into the operon's control mechanism.
Somatic cell hybridization involves fusing cells from two different species, such as human and mouse cells, to form hybrid cells containing chromosomes from both species. This technique allows genes to be mapped to specific chromosomes. It works by using selective growth conditions that require the hybrid cell to retain certain human chromosomes in order to survive. Over successive cell divisions, human chromosomes are eliminated at random except for those required for survival. This allows the creation of cell lines containing partial sets of human chromosomes that can be analyzed to correlate genes with specific chromosomes. The technique has been important for mapping the human genome.
This Presentation will be helpful to undergraduate and postgraduate students of biology and biotechnology in understanding the significance of COT curves in determination of gene and genome complexity amoug various organisms
A brief description on Molecular Evolution, Kimura's theory of Molecular evolution, Neutral theory vs. Natural Selection, Neutral theory: The Null Hypothesis of Molecular Evolution
Cot value and Cot Curve analysis is a technique for measuring DNA complexity based on renaturation kinetics. DNA is denatured and allowed to reanneal, with larger DNA taking longer. Cot value accounts for DNA concentration, time, and buffer effects, representing repetitive sequences - lower Cot means more repeats. Examples show bacteria have nearly all single-copy DNA, while mouse has varying proportions of single-copy, middle repetitive, and highly repetitive sequences. Cot curve analysis provides information on genome size, complexity, and proportions of sequence types.
Cytoplasmic or extranuclear inheritance involves the transmission of traits controlled by genes located outside the cell nucleus, such as in mitochondria or chloroplasts. This form of inheritance does not follow Mendel's laws and instead is maternally inherited, with traits expressed based on the phenotype of the female parent. Examples discussed in the document include mitochondrial inheritance in humans, cytoplasmic factors influencing disease susceptibility in mice, and chloroplast genes controlling leaf color in plants.
Phylogeny is the evolutionary history of a taxonomic group as represented by a phylogenetic tree. The goals of phylogeny are to show relationships between species based on evolutionary time. There are several tools and methods used to build phylogenetic trees, including distance-based methods like UPGMA and neighbor joining which use sequence similarities, and character-based methods like maximum parsimony. Software like MEGA, Dendroscope, and Phylotree.js can be used to construct and visualize phylogenetic trees.
The document discusses neutral theory of molecular evolution, which holds that most genetic changes are due to neutral mutations that do not affect organismal fitness. It proposes that neutral mutations accumulate over time at a constant rate, allowing relative divergence times to be estimated. The theory aims to explain high genetic variation and presence of neutral substitutions between species. Several lines of evidence are presented, including comparative rates of evolution between functionally important and unimportant genes and gene regions.
GenBank is a database that contains annotated nucleotide and protein sequences. It includes genomic DNA, mRNA, and EST sequences. There are three main sections in a GenBank file - the header, features, and sequence. The header provides definition, accession number, organism, and reference information. The features section contains gene and protein annotation. The sequence section displays the actual nucleotide or amino acid sequence. Understanding the GenBank file format helps effectively search and retrieve sequences from this important biological database.
RNA splicing is a process where introns are removed from precursor messenger RNA (pre-mRNA) and exons are joined together to produce mature mRNA. It occurs in the nucleus and is essential for eukaryotes to produce proteins. The spliceosome, a large complex of RNA and proteins, facilitates two transesterification reactions that remove introns and ligate exons. RNA splicing generates protein diversity through alternative splicing and is important for cellular functions and disease processes.
1. Genetic mapping involves determining the linear order and distance between linked genes on chromosomes through test crosses.
2. Key processes include determining linkage groups, calculating map distances in morgan or centimorgan units, and using two-point and three-point test crosses to order genes.
3. Maps are constructed by combining map segments and are useful for understanding inheritance, disease diagnosis, and evolution.
The document discusses factors that can alter allelic frequencies in a population. It describes six main factors: 1) Mutation introduces new alleles, 2) Genetic drift like bottle neck effects can change frequencies randomly, 3) Migration through gene flow affects frequencies, 4) Natural selection increases frequencies of beneficial alleles and decreases unfavorable ones, 5) Non-random mating influences which individuals reproduce more, and 6) Inbreeding increases homozygosity. These genetic and evolutionary factors all impact the proportion of alleles in a population over time.
CYTOPLASMIC INHERITANCE WITH REFERENCETO MITOCHONDRIAL INHERITANCE IN YEASTBishnuPatra1
This document summarizes a presentation on cytoplasmic inheritance with reference to mitochondrial inheritance in yeast. It discusses how cytoplasmic inheritance transmits genes outside the nucleus, usually from the female parent. Mitochondria contain their own circular DNA called mt-DNA. Mitochondrial inheritance refers to traits encoded in the mitochondrial genome being inherited, generally from the female parent. The document uses petite mutations in yeast mitochondria as an example, describing three types of petite mutants: 1) Segregational petite mutants created by nuclear mutations that segregate mendelianly, 2) Neutral petite mutants whose offspring are wild type when crossed with wild type yeast, and 3) Suppressive petite mutants that dominate and suppress wild type mitochondrial function in offspring
Nucleosomes are the fundamental repeating subunits of eukaryotic chromatin that package DNA into a compact structure. They are composed of 146 base pairs of DNA wrapped around an octamer of histone proteins, resembling beads on a string. This represents the first order of DNA compaction. Higher orders of compaction involve the nucleosomes winding further to form solenoid fibers, scaffold loops, chromatids, and finally full chromosomes. Nucleosomes allow the long DNA molecules to fit within cell nuclei while also regulating genetic expression.
Chemical evolution theory of life’s originsrozh bahman
in this presentation the first stage of chemical evolution and origin of life is explained and also the oparin-haldane and urey miller experiment are explained too
The neutral theory of evolution proposes that most genetic mutations are selectively neutral or nearly neutral. Under this theory, genetic drift rather than natural selection is the primary determinant of whether a mutation becomes fixed in a population or lost. The neutral theory makes specific, testable predictions about levels of genetic polymorphism within species and rates of genetic divergence between species. Motoo Kimura developed the neutral theory in the 1950s-60s as an alternative to the prevailing view that natural selection determined the fate of most mutations.
The Miller-Urey experiment simulated early Earth conditions and provided evidence supporting the hypothesis that organic compounds could form naturally through non-biological means. In the experiment, Stanley Miller and Harold Urey created a mixture of gases thought to exist in the early atmosphere - methane, ammonia, hydrogen and water vapor. When this mixture was exposed to electrical sparks simulating lightning, amino acids and other organic compounds began to form within a week. This provided experimental support for the idea that life may have originated from naturally occurring chemical reactions on the early Earth before the emergence of life.
Lecture 2 : Evolutionary Patterns, Rates And Trendsguest42a8fbf
The document discusses evidence for evolution from various fields including biogeography, fossils, comparative anatomy, embryology, biochemistry and genetics. It explains key concepts in evolution like macroevolutionary events, morphological divergence and convergence, reproductive isolation mechanisms, molecular clocks and models of speciation. Continental drift theory and plate tectonics helped explain distribution of fossils and living species, while radiometric dating techniques helped establish geological timescales.
Molecular Phylogenetic relationships among the species of geckos in Adams’pe...Gayathri Amarakoon
A ten month survey was undertaken to document the diversity and abundance of lizards at the Adam’s peak in Sri Lanka. We use 700 bp of mitochondrial (cytb) and nuclear (RAG1 and Phosducine) DNA sequence data to recover phylogenetic relationships and our well resolved tree, to elucidate a biographic pattern and close relationship among lizards. Our data demonstrate the phylogenetic utility of Phosducine, a noval marker in squmate phylogenetics at the intrageneric level.
The complete genome sequence of a neanderthal article presentationSveta Jagannathan
Ancient toe phalanx found in a cave in Siberia after analysis of the mitochondrial DNA (mtDNA) showed it to be genetically distinct yet similar from the mtDNAs of Neanderthals and modern humans
Chemical reactions involve the rearrangement of atoms, not their creation or destruction. Indications of a chemical reaction include the evolution of light, heat, gas, or a color change. Chemical equations use symbols to represent the reactants and products, with arrows or double arrows to show the reaction and whether it is reversible. For the equation to be balanced, it must have the same number and type of atoms on both sides according to the law of conservation of mass.
LHCにおける素粒子ビッグデータの解析とROOTライブラリ(Big Data Analysis at LHC and ROOT)Akira Shibata
Tokyo Web Mining #45でお話させていただいた内容です。
アブストラクト:
実験素粒子物理学においては、加速器を使った高エネルギー素粒子の衝突実験から生まれる大量のデータを分析するため、かつてよりあらゆる科学分野の中でも最もデータ量の多い領域でした。スイスのCERN研究所で行われている最新の実験、LHC(Large Hadron Collider)では、最初の2年間で、1PB(ペタバイト)のデータが生成され、その一部は昨年オープン化されました。本講演では、LHCのビッグデータがどのように解析されたのか、インフラ及びアプリケーションレベルの観点ご紹介します。特に、アプリケーションレベルにおいては、独自の統計解析ライブラリであるROOTが幅広く使われており、この講演を通じ、ROOTが現在のデータ解析パラダイムのどこに位置しているのかを参加者の皆様と議論したいと思います。
This presentation entitled 'Molecular phylogenetics and its application' deals with all the developmental ideas and basics in the field of bioinformatics.
This document discusses the history and development of evolutionary thought from ancient Greek philosophers to modern times. It covers key figures like Charles Darwin who proposed natural selection as the mechanism of evolution, and Gregor Mendel who discovered the basic principles of heredity through his experiments with pea plants. Later scientists like Watson, Crick and others integrated Mendel's ideas of genetics into evolutionary theory by discovering the structure of DNA and how it transfers hereditary information between generations and allows for mutation.
115 1.08 hematology review no case studies (2) - copyvirudoshi007
The seminar covered hematologic disorders and focused on different types of anemia. It discussed the anatomy and composition of blood, functions of red blood cells and platelets, and blood grouping systems. In terms of anemia management, it described causes, symptoms, and treatments for hemolytic anemia, iron deficiency anemia, anemias related to renal disease, and aplastic anemia. Diagnostic findings and medical management approaches were provided for evaluating and managing various anemias.
This document provides an overview of Charles Darwin's theory of evolution by natural selection. It discusses key figures and findings that influenced Darwin's thinking, such as Linnaeus' taxonomy, Lamarck's theory of inheritance of acquired traits, and Lyell and Hutton's theories of gradual geological change. The document also summarizes Darwin's two main ideas in Origin of Species: that evolution explains life's diversity and unity, and that natural selection is a mechanism of adaptive evolution. It provides examples of natural selection in action and evidence that supports evolution, such as molecular homologies and transitional fossils.
Biology Unit 7 Notes: Evidence for Evolution & Phylogenetic Treesrozeka01
The document provides evidence for evolution from several sources: fossil records, comparative anatomy, biogeography, carbon dating and genetics. It discusses how comparative anatomy of skeletal structures between animals can show homologous, analogous, and vestigial structures, indicating connections to common ancestors. Phylogenetic trees are diagrams that depict evolutionary relationships and order of evolution between organisms, informed by fossils, anatomy, DNA, and geology. They illustrate the progression from a common ancestor to more recently evolved organisms and the traits associated with different branches in their development.
- Phylogeny is the evolutionary history and relationships between species as depicted in phylogenetic trees. These trees show how species are related through shared ancestors.
- Systematists use both morphological and molecular data to determine homologies and construct phylogenetic trees. Molecular data, like DNA sequences, provide especially strong evidence of evolutionary relationships.
- Phylogenetic trees group species into monophyletic clades based on shared derived characters. Cladistics aims to classify organisms based strictly on evolutionary relationships inferred from phylogenies.
Evolution is the central theme of biology. It refers to change over time in allele frequencies in populations, driven primarily by natural selection. Speciation occurs through mechanisms like allopatric speciation. Charles Darwin developed the theory of evolution by natural selection, which proposes that heritable traits better suited to an organism's environment will increase the organism's fitness and chances of survival and reproduction, driving populations to change over generations. Phylogenies illustrate evolutionary relationships and history based on homologous traits in ancestors.
The document discusses phylogeny and its role in modern taxonomy. It explains that phylogeny is the study of evolutionary relatedness between species through phylogenetic trees, which function similar to family trees. Phylogenetic trees show how species have evolved over time from common ancestors. Modern taxonomy uses phylogenetics and DNA barcoding to more accurately determine evolutionary relationships compared to traditional taxonomy which was based on physical characteristics.
This document discusses biodiversity hotspots in India. It notes that India contains a significant amount of the world's biodiversity, with high percentages of the world's mammal, bird, amphibian, reptile, fish, and flowering plant species having native ranges within India. Several regions in India qualify as biodiversity hotspots due to their large numbers of endemic species and habitat loss, including the Western Ghats, Nilgiris, Anaimalai, Darjeeling hills, and the Andaman Islands. The Western Ghats hotspot contains over 39 protected areas and is considered one of the most biologically diverse regions in the world.
MUTATION OF DNA IN AN ORGANISM DELETION INSERTIONMaryJoyBAtendido
This document discusses different types of genetic mutations, including point mutations like substitutions, insertions, and deletions, as well as frameshift and chromosomal mutations. It provides examples of how different mutations could change a DNA sequence and potentially the resulting protein. Mutations can be caused by errors in DNA replication or exposure to mutagens, and they may have no effect, be harmful, or provide benefits to the organism depending on where they occur in the genetic code.
Mutations are alterations in a genome's nucleotide sequence that can occur in somatic or gamete cells. They can be caused by point mutations like missense or nonsense mutations which change single nucleotides, or frameshift mutations like insertions or deletions which alter the reading frame. Mutations can have harmful effects and cause diseases, but can also occasionally provide benefits by allowing organisms to adapt to their environments. The ability to drink milk as an adult is an example of a helpful mutation.
The document discusses gene regulation and structure. It provides information on how genes are regulated through transcription factors binding to DNA and responding to environmental conditions. It also describes where gene regulation occurs, such as during transcription, translation and protein modifications. Additionally, it contrasts differences between prokaryotic and eukaryotic genes and gene structure, such as the presence of introns and exons in eukaryotes. Common methods for finding genes like the use of consensus splice sites and coding bias are also summarized.
The ATP binding cassette (ABC) transporter ABCG5/ABCG8 mediates sterol excretion in liver and intestines. Mutations inactivating either ABCG5 or ABCG8 cause sitosterolemia, a rare autosomal recessive genetic disorder characterized by hypercholesteromelia and premature atherosclerosis. We crystallized human ABCG5/ABCG8 in lipid bilayers and solved an X-ray structure. ABCG5/ABCG8 is the first ABCG transporter structurally characterized at atomic resolution and presents a new transmembrane fold for the ABC transporter superfamily. It shows the asymmetric nucleotide-binding sites interacting with the transmembrane domain through a conserved polar network, where the coupling-connecting helices are structurally asymmetric. The structure reveals new features of sterol transport at the bilayer-transporter interface, allows us to propose a sterol transport model and provides a new framework to study active lipid transport and to model other ABC transporters. This presentation share slides that describes the background of the physiology, protein purification, structural determination and interpretation of human ABCG5/ABCG8.
This document discusses various types of mutations including their causes and effects. It begins by defining mutation as a sudden, random change in genetic material that causes cells to differ from normal cells. Mutations can be caused by errors during DNA replication or exposure to mutagens. There are several types of mutations including point mutations, which involve a single base pair change, and frameshift mutations, which alter the reading frame. Mutations can be classified based on whether they occur in somatic or germ cells, their location in genes or chromosomes, and their effects. Overall, mutations provide the raw material for evolution by generating genetic variation.
Mutations are alterations in a genome's nucleotide sequence that can occur in somatic or germ-line cells. Mutations can be harmful and cause diseases, beneficial by allowing organisms to better survive, or neutral with no observable effects. There are several types of mutations including point mutations like missense, nonsense, and silent mutations as well as frameshift mutations involving insertions or deletions of nucleotide bases. Chromosomal mutations can also occur and affect multiple genes.
This document discusses various types of mutations including somatic and germline mutations. It describes different categories of mutations such as base substitutions, insertions, deletions, missense, nonsense, silent and frameshift mutations. The document also discusses different causes of mutations including chemical mutagens like base analogs and alkylating agents, physical mutagens like radiation, and endogenous mutagens like reactive oxygen species. It provides examples of specific mutagens and the types of mutations they cause.
This document discusses the process of PCR-based cloning. It explains that PCR is used to amplify a DNA sequence of interest and add restriction enzyme sites to the ends to allow for cloning into a plasmid. It provides details on designing forward and reverse primers, including adding a leader sequence, restriction site, and hybridization sequence. The document provides an example of adding EcoRI and NotI sites to a gene of interest for cloning into a recipient plasmid. It discusses factors to consider when choosing restriction enzymes and provides the specific primer sequences designed for the example.
Proteins have many essential functions in living systems including acting as enzymes, transporters, regulators, and providing structure. There are 20 standard amino acids that make up proteins and their side chains determine each protein's unique properties. A protein's amino acid sequence is encoded in DNA and the sequence folds into complex three-dimensional structures that enable proteins to carry out their diverse roles.
Proteins have many essential functions in living systems including acting as enzymes, transporters, regulators, and structural components. They are composed of amino acid monomers that form linear chains. The specific sequence of amino acids determines the protein's shape and function. DNA encodes the amino acid sequence of proteins.
1. Gene mutations can affect a single gene by causing changes in a single codon through substitutions, inversions, additions or deletions.
2. Substitution mutations may not have serious effects unless they change an amino acid essential to the protein structure/function. For example, a single nucleotide change in the beta-globin gene causes sickle cell anemia.
3. The genetic code is degenerate, meaning a mutation in the third base may not affect the phenotype if it does not change the amino acid. Frameshift mutations from additions or deletions can have more significant effects.
Point mutations occur when a single nucleotide in the DNA sequence is changed. This can lead to different types of mutations at the protein level including nonsense, missense, and silent mutations. Nonsense mutations result in a premature stop codon. Missense mutations result in a different amino acid being incorporated. Silent mutations do not change the amino acid. While most mutations are harmful, some can be beneficial by allowing organisms to adapt to environmental changes and increase chances of survival.
Gene mutations occur when there is a change in the DNA sequence, such as a substitution, insertion, or deletion of nucleotide bases. Substitution mutations have the smallest effect, often not changing the resulting amino acid. Insertion and deletion mutations are more likely to impact the protein as they disrupt the reading frame. An example where a single nucleotide change causes disease is sickle cell anemia. The most impactful mutations occur in gametes or early embryonic development. Mutagens like radiation or chemicals can induce mutations.
Mutations are changes in genetic material that can result from errors during DNA replication or damage to DNA. There are two main types of mutations: chromosomal mutations and genetic mutations. Chromosomal mutations include deletions, duplications, inversions, and translocations that involve changes in chromosome structure. Genetic mutations are changes in DNA sequence, such as point mutations involving substitutions, insertions, or deletions of nucleotide bases. Insertion and deletion mutations tend to have the largest effects as they can alter multiple amino acids and proteins, while substitution mutations often have the smallest effects since only a single amino acid may change. Examples of diseases caused by mutations include sickle cell anemia from a substitution and Huntington's disease from an expansion insertion.
1. The document discusses variant calling from NGS data and prioritizing variants. It covers calling variants, identifying somatic mutations by comparing tumor and normal samples, and identifying inherited variants using trio analysis.
2. Key steps include calling variants, filtering, identifying somatic mutations as variants present in tumor but not normal, and identifying inherited variants by applying models of inheritance to family trio data.
3. Prioritization considers functional impact, population frequencies, and visual inspection to select candidates for follow up.
The document discusses DNA structure and genetics tools for DNA analysis. It describes the structure of DNA nucleotides and how they bond together in the DNA double helix. It then explains the principles and steps of polymerase chain reaction (PCR), a method for amplifying targeted DNA sequences. Finally, it covers Sanger sequencing, the first method for DNA sequencing and still the gold standard. It details how Sanger sequencing uses dideoxynucleotides to terminate DNA strand extension at different positions, allowing the sequenced fragments to be resolved on a gel to determine the DNA sequence.
Pyrosequencing slide presentation rev3.Robert Bruce
Pyrosequencing was evaluated as an alternative to Sanger sequencing for HIV drug resistance genotyping. Three assays were designed to detect mutations in the protease gene using a 356 bp amplicon and three sequencing primers. The assays demonstrated good linearity and sensitivity below 5% in quantifying mixed bases. However, read lengths were limited due to signal degradation, making it difficult to sequence large amplicons. Overall, pyrosequencing showed promise as a method for HIV genotyping but further optimization was needed to improve read lengths and mixed variant detection.
The document discusses the genetic code and mutations. It describes key discoveries such as the experiments demonstrating that codons consist of three DNA bases and the identification of the first genetic codes. It defines terms like codon, codon table, degenerate codons. It describes types of mutations like substitutions, insertions, deletions and their effects. It discusses mutagens like radiation, chemicals, and their mechanisms. It provides clinical examples of mutations causing conditions like sickle cell anemia, thalassemia, cystic fibrosis.
Gene mutations can occur when there is a change in the DNA code, such as a substitution, insertion, or deletion of nucleotide bases. Substitution mutations, where one base is swapped for another, typically have the smallest effect since only one amino acid may change. Insertion and deletion mutations, which add or remove bases, can have larger effects by disrupting the reading frame of the entire DNA sequence. An example is sickle cell anemia, a substitution mutation that causes red blood cells to take on a sickle shape.
What is greenhouse gasses and how many gasses are there to affect the Earth.moosaasad1975
What are greenhouse gasses how they affect the earth and its environment what is the future of the environment and earth how the weather and the climate effects.
When I was asked to give a companion lecture in support of ‘The Philosophy of Science’ (https://shorturl.at/4pUXz) I decided not to walk through the detail of the many methodologies in order of use. Instead, I chose to employ a long standing, and ongoing, scientific development as an exemplar. And so, I chose the ever evolving story of Thermodynamics as a scientific investigation at its best.
Conducted over a period of >200 years, Thermodynamics R&D, and application, benefitted from the highest levels of professionalism, collaboration, and technical thoroughness. New layers of application, methodology, and practice were made possible by the progressive advance of technology. In turn, this has seen measurement and modelling accuracy continually improved at a micro and macro level.
Perhaps most importantly, Thermodynamics rapidly became a primary tool in the advance of applied science/engineering/technology, spanning micro-tech, to aerospace and cosmology. I can think of no better a story to illustrate the breadth of scientific methodologies and applications at their best.
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...Ana Luísa Pinho
Functional Magnetic Resonance Imaging (fMRI) provides means to characterize brain activations in response to behavior. However, cognitive neuroscience has been limited to group-level effects referring to the performance of specific tasks. To obtain the functional profile of elementary cognitive mechanisms, the combination of brain responses to many tasks is required. Yet, to date, both structural atlases and parcellation-based activations do not fully account for cognitive function and still present several limitations. Further, they do not adapt overall to individual characteristics. In this talk, I will give an account of deep-behavioral phenotyping strategies, namely data-driven methods in large task-fMRI datasets, to optimize functional brain-data collection and improve inference of effects-of-interest related to mental processes. Key to this approach is the employment of fast multi-functional paradigms rich on features that can be well parametrized and, consequently, facilitate the creation of psycho-physiological constructs to be modelled with imaging data. Particular emphasis will be given to music stimuli when studying high-order cognitive mechanisms, due to their ecological nature and quality to enable complex behavior compounded by discrete entities. I will also discuss how deep-behavioral phenotyping and individualized models applied to neuroimaging data can better account for the subject-specific organization of domain-general cognitive systems in the human brain. Finally, the accumulation of functional brain signatures brings the possibility to clarify relationships among tasks and create a univocal link between brain systems and mental functions through: (1) the development of ontologies proposing an organization of cognitive processes; and (2) brain-network taxonomies describing functional specialization. To this end, tools to improve commensurability in cognitive science are necessary, such as public repositories, ontology-based platforms and automated meta-analysis tools. I will thus discuss some brain-atlasing resources currently under development, and their applicability in cognitive as well as clinical neuroscience.
ESPP presentation to EU Waste Water Network, 4th June 2024 “EU policies driving nutrient removal and recycling
and the revised UWWTD (Urban Waste Water Treatment Directive)”
Current Ms word generated power point presentation covers major details about the micronuclei test. It's significance and assays to conduct it. It is used to detect the micronuclei formation inside the cells of nearly every multicellular organism. It's formation takes place during chromosomal sepration at metaphase.
hematic appreciation test is a psychological assessment tool used to measure an individual's appreciation and understanding of specific themes or topics. This test helps to evaluate an individual's ability to connect different ideas and concepts within a given theme, as well as their overall comprehension and interpretation skills. The results of the test can provide valuable insights into an individual's cognitive abilities, creativity, and critical thinking skills
The binding of cosmological structures by massless topological defectsSérgio Sacani
Assuming spherical symmetry and weak field, it is shown that if one solves the Poisson equation or the Einstein field
equations sourced by a topological defect, i.e. a singularity of a very specific form, the result is a localized gravitational
field capable of driving flat rotation (i.e. Keplerian circular orbits at a constant speed for all radii) of test masses on a thin
spherical shell without any underlying mass. Moreover, a large-scale structure which exploits this solution by assembling
concentrically a number of such topological defects can establish a flat stellar or galactic rotation curve, and can also deflect
light in the same manner as an equipotential (isothermal) sphere. Thus, the need for dark matter or modified gravity theory is
mitigated, at least in part.
Nucleophilic Addition of carbonyl compounds.pptxSSR02
Nucleophilic addition is the most important reaction of carbonyls. Not just aldehydes and ketones, but also carboxylic acid derivatives in general.
Carbonyls undergo addition reactions with a large range of nucleophiles.
Comparing the relative basicity of the nucleophile and the product is extremely helpful in determining how reversible the addition reaction is. Reactions with Grignards and hydrides are irreversible. Reactions with weak bases like halides and carboxylates generally don’t happen.
Electronic effects (inductive effects, electron donation) have a large impact on reactivity.
Large groups adjacent to the carbonyl will slow the rate of reaction.
Neutral nucleophiles can also add to carbonyls, although their additions are generally slower and more reversible. Acid catalysis is sometimes employed to increase the rate of addition.
ESR spectroscopy in liquid food and beverages.pptxPRIYANKA PATEL
With increasing population, people need to rely on packaged food stuffs. Packaging of food materials requires the preservation of food. There are various methods for the treatment of food to preserve them and irradiation treatment of food is one of them. It is the most common and the most harmless method for the food preservation as it does not alter the necessary micronutrients of food materials. Although irradiated food doesn’t cause any harm to the human health but still the quality assessment of food is required to provide consumers with necessary information about the food. ESR spectroscopy is the most sophisticated way to investigate the quality of the food and the free radicals induced during the processing of the food. ESR spin trapping technique is useful for the detection of highly unstable radicals in the food. The antioxidant capability of liquid food and beverages in mainly performed by spin trapping technique.
2. •The increasing available completely sequenced
organisms and the importance of evolutionary processes
that affect the species history, have stressed the interest in
studying the molecular evolution events at the sequence
level.
Molecular evolution
3. Plan
• Context
• selection pressure (definitions)
• Genetic code and inherent properties of codons and
amino-acids
• Estimations of synonymous and nonsynomynous
substitutions
• Codons volatility
• Applications
7. Homolog - Paralog - Ortholog
A1
A2B1
B2
Homologs: A1, B1, A2, B2
Paralogs: A1 vs B1 and A2 vs B2
Orthologs: A1 vs A2 and B1 vs B2
S1 S2
a b
A
O
B
Species-1
Species-2
A1
A2B1
B2
Sequence analysis
8. Molecular evolutionary analysis
• Aim at understanding and modeling evolutionary
events;
• Evolutionary modeling extrapolates from the divergence
between sequences that are assumed homologous, the
number of events which have occurred since the genes
diverged;
• If rate of evolution is known, then a time since
divergence can be estimated.
9. Applications:
Molecular evolution analysis has clarified:
• the evolutionary relationships between humans and
other primates;
• the origins of AIDS;
• the origin of modern humans and population migration;
• speciation events;
• genetic material exchange between species.
• origin of some deseases (cancer, etc...)
• .....
Molecular evolution
11. Molecular evolution
• Mutations arise due to inheritable changes in
genomic DNA sequence;
• Mechanisms which govern changes at the
protein level are most likely due to nucleotide
substitution or insertions/deletions;
• Changes may give rise to new genes which
become fixed if they give the organism an
advantage in selection;
GACGACCATAGACCAGCATAG
GACTACCATAGA-CTGCAAAG
12. Molecular evolution: Definitions
Purifying (negative) selection
• A consequence of gene “drift” through random
mutations, is that many mutations will have deleterious
effects on fitness.
• “Purifying selective force” prevents accumulation of
mutation at important functional sites, resulting in
sequence conservation.
-> “Purifying selection” is a natural selection against
deleterious mutations.
-> The term is used interchangeably with “negative
selection” or “selection constraints”.
13. Neutral theory
• Majority of evolution at the molecular level is caused by
random genetic “drift” through mutations that are
selectively neutral or nearly neutral.
• Describes cases in which selection (purifying or positive)
is not strong enough to outweigh random events.
• Neutral mutation is an ongoing process which gives rise
to genetic polymorphisms; changes in environment can
select for certain of these alleles.
14. Positive selection
• Positive selection is a darwinian selection fixing
advantageous mutations.
The term is used interchangeably with “molecular
adaptation” and “adaptive molecular evolution”.
• Positive selection can be shown to play a role in some
evolutionary events
• This is demonstrated at the molecular level if the rate of
nonsynonymous mutation at a site is greater than the rate
of synonymous mutation
• Most substitution rates are determined by either neutral
evolution of purifying selection against deleterious
mutations
15. Molecular evolution
• We observe and try to decode the process of
molecular evolution from the perspective of
accumulated differences among related genes
from one or diverse organisms.
• The number of mutations that have occurred
can only be estimated.
Real individual events are blurred by a long
history of changes.
16. -GGAGCCATATTAGATAGA-
-GGAGCAATTTTTGATAGA-
Gly Ala Ile Leu asp Arg
Gly Ala Ile Phe asp Arg
DNA yields more phylogenetic information than proteins. The
nucleotide sequences of a pair of homologous genes have a higher
information content than the amino acid sequences of the
corresponding proteins, because mutations that result in synonymous
changes alter the DNA sequence but do not affect the amino acid
sequence.
• 3 different DNA positions but
only one different amino acid
position:
2 of the nucleotide substitutions
are therefore synonymous and
one is non-synonymous.
Nucleotide, amino-acid sequences
-> gene
-> protein
17. Kinds of nucleotide substitutions
Given 2 nucleotide sequences, we can ask how their similarities and
differences arose from a common ancestor?
A
A
C
Single substitution
1 change, 1 difference
T
A
A
C
Multiple substitution
2 changes, 1 difference
A
C
G
Coincidental substitution
2 change, 1 difference
A
C
C
Parallel substitution
2 changes, no difference
A
T
T
C
Convergent substitution
3 changes, no difference
A
A
A
C
Back substitution
2 changes, no difference
18. Substitution: Transition -
transversion
transition changes one
purine for another or one
pyrimidine for another.
transversion changes a
purine for a pyrimidine or
vice versa.
Nucleotides are either purine or pyrimidines :
G (Guanine) and A (Adenine) are called purine;
C (Cytosine) and T (Thymine) are called pyrimidines.
transitions occur at least 2 times as frequently as transversions
A G
C T
19. Standard genetic code
•The genetic code specifies how a combination of any of the
four bases (A,G,C,T) produces each of the 20 amino acids.
•The triplets of bases are called codons and with four
bases, there are 64 possible codons:
(43
) possible codons that code for 20 amino acids (and stop
signals).
20. Second position
| T | C | A | G |
----+--------------+--------------+--------------+--------------+----
| TTT Phe (F) | TCT Ser (S) | TAT Tyr (Y) | TGT Cys (C) | T
T | TTC " | TCC " | TAC | TGC | C
F | TTA Leu (L) | TCA " | TAA Ter | TGA Ter | A T
i | TTG " | TCG " | TAG Ter | TGG Trp (W) | G h
r --+--------------+--------------+--------------+--------------+-- i
s | CTT Leu (L) | CCT Pro (P) | CAT His (H) | CGT Arg (R) | T r
t C | CTC " | CCC " | CAC " | CGC " | C d
| CTA " | CCA " | CAA Gln (Q) | CGA " | A
P | CTG " | CCG " | CAG " | CGG " | G P
o --+--------------+--------------+--------------+--------------+-- o
s | ATT Ile (I) | ACT Thr (T) | AAT Asn (N) | AGT Ser (S) | T s
i A | ATC " | ACC " | AAC " | AGC " | C i
t | ATA " | ACA " | AAA Lys (K) | AGA Arg (R) | A t
i | ATG Met (M) | ACG " | AAG " | AGG " | G i
o --+--------------+--------------+--------------+--------------+-- o
n | GTT Val (V) | GCT Ala (A) | GAT Asp (D) | GGT Gly (G) | T n
G | GTC " | GCC " | GAC " | GGC " | C
| GTA " | GCA " | GAA Glu (E) | GGA " | A
| GTG " | GCG " | GAG " | GGG " | G
----+--------------+--------------+--------------+--------------+----
Standard genetic
code
chargé(basique), chargé (acidique),
hydrophile, hydrophobe
A Ala Alanine GCT GCC GCA GCG
R Arg Arginine CGT CGC CGA CGG AGA AGG
N Asn Asparagine AAT AAC
D Asp Aspartic acid GAT GAC
C Cys Cysteine TGT TGC
Q Gln Glutamine CAA CAG
E Glu Glutamic acid GAG GAA
G Gly Glycine GGG GGA GGT GGC
H His Histidine CAT CAC
I Ile Isoleucine ATT ATC ATA
L Leu Leucine TTA TTG CTT CTC CTA CTG
K Lys Lysine AAA AAG
M Met Methionine ATG
F Phe Phenylalanine TTT TTC
P Pro Proline CCT CCC CCA CCG
S Ser Serine TCT TCC TCA TCG AGT AGC
T Thr Threonine ACT ACC ACA ACG
W Trp Tryptophan TGG
Y Tyr Tyrosine TAT TAC
V Val Valine GTT GTC GTA GTG
• Because there are only 20 amino acids, but 64 possible codons, the same amino
acid is often encoded by a number of different codons, which usually differ in the
third base of the triplet.
•Because of this repetition the genetic code is said to be degenerate and codons
which produce the same amino acid are called synonymous codons.
22. Synonymous vs nonsynonymous substitutions
• Nondegenerate sites: are codon position where mutations always
result in amino acid substitutions.
(exp. TTT (Phenylalanyne, CTT (leucine), ATT (Isoleucine), and
GTT (Valine)).
• Twofold degenerate sites: are codon positions where 2 different
nucleotides result in the translation of the same aa, but the 2 others
code for a different aa.
(exp. GAT and GAC code for Aspartic acid (asp, D),
whereas GAA and GAG both code for Glutamic acid (glu, E)).
• Threefold degenerate site: are codon positions where changing 3
of the 4 nucleotides has no effect on the aa, while changing the
fourth possible nucleotide results in a different aa.
There is only 1 threefold degenerate site: the 3rd
position of an isoleucine codon.
ATT, ATC, or ATA all encode isoleucine, but ATG encodes methionine.
23. Standard genetic code
• Three amino acids: Arginine, Leucine and Serine are encoded by 6 different
codons:
R Arg Arginine CGT CGC CGA CGG AGA AGG
L Leu Leucine TTA TTG CTT CTC CTA CTG
S Ser Serine TCT TCC TCA TCG AGT AGC
• Five amino-acids are encoded by 4 codons which differ only in the third position.
These sites are called “fourfold degenerate” sites
A Ala Alanine GCT GCC GCA GCG
G Gly Glycine GGG GGA GGT GGC
P Pro Proline CCT CCC CCA CCG
T Thr Threonine ACT ACC ACA ACG
V Val Valine GTT GTC GTA GTG
• Fourfold degenerate sites: are codon positions where changing a
nucleotide in any of the 3 alternatives has no effect on the aa.
exp. GGT, GGC, GGA, GGG(Glycine);
CCT,CCC,CCA,CCG(Proline)
24. Standard genetic code
• Nine amino acids are encoded by a pair of codons which differ by a transition
substitution at the third position. These sites are called “twofold degenerate” sites.
• Isoleucine is encoded by three different codons
• Methionine and Triptophan are encoded by single codon
• Three stop codons: TAA, TAG and TGA
N Asn Asparagine AAT AAC
D Asp Aspartic acid GAT GAC
C Cys Cysteine TGT TGC
Q Gln Glutamine CAA CAG
E Glu Glutamic acid GAG GAA
H His Histidine CAT CAC
K Lys Lysine AAA AAG
F Phe Phenylalanine TTT TTC
Y Tyr Tyrosine TAT TAC
I Ile Isoleucine ATT ATC ATA
M Met Methionine ATG
W Trp Tryptophan TGG
Transition:
A/G; C/T
25. Nucleotide substitutions in protein coding genes can be divided into :
• synonymous (or silent) substitutions i.e. nucleotide substitutions
that do not result in amino acid changes.
• non synonymous substitutions i.e. nucleotide substitutions that
change amino acids.
• nonsense mutations, mutations that result in stop codons.
exp: Gly: any changes in 3rd position of codon results in Gly; any
changes in second position results in amino acid changes; and so is
the first position.
Standard Genetic
Code
GAG
G Gly Glycine GGG GGA GGT GGC
Glu AGC Serexp:
26. • Estimation of synonymous and nonsynonymous substitution rates
is important in understanding the dynamics of molecular sequence
evolution.
• As synonymous (silent) mutations are largely invisible to natural
selection, while nonsynonymous (amino-acid replacing) mutations
may be under strong selective pressure, comparison of the rates of
fixation of those two types of mutations provides a powerful tool for
understanding the mechanisms of DNA sequence evolution.
• For example, variable nonsynonymous/synonymous rate ratios
among lineages may indicate adaptative evolution or relaxed
selective constraints along certain lineages.
• Likewise, models of variable nonsynonymous/synonymous rate
ratios among sites may provide important insights into functional
constraints at different amino acid sites and may be used to detect
sites under positive selection.
Nonsynonymous/synonymous substitutions
27. Codon
usage
• If nucleotide substitution occurs at random at each nucleotide site,
every nucleotide site is expected to have one of the 4 nucleotides, A,
T, C and G, with equal probability.
• Therefore, if there is no selection and no mutation bias, one would
expect that the codons encoding the same amino acid are on average
in equal frequencies in protein coding regions of DNA.
• In practice, the frequencies of different codons for the same amino
acid are usually different, and some codons are used more often than
others. This codon usage bias is often observed.
• Codon usage bias is controlled by both mutation pressure and
purifying selection.
• There are 64 (43
) possible codons that code for 20 amino acids
(and stop signals).
28. • For a pair of homologous codons presenting only one nucleotide
difference, the number of synonymous and nonsynonymous
substitutions may be obtained by simple counting of silent versus
non silent amino acid changes;
• For a pair of codons presenting more than one nucleotide
difference, distinction between synonymous and nonsynonymous
substitutions is not easy to calculate and statistical estimation
methods are needed;
• For example, when there are 3 nucleotide differences between
codons, there are 6 different possible pathways between these
codons. In each path there are 3 mutational steps.
• More generally there can be many possible pathways between
codons that differ at all three positions sites; each pathway has its
own probability.
Estimating synonymous and nonsynonymous differences
29. • Observed nucleotide differences between 2 homologous sequences
are classified into 4 categories: synonymous transitions, synonymous
transversions, nonsynonymous transitions and nonsynonymous
transversions.
• When the 2 compared codons differ at one position, the
classification is obvious.
• When they differ at 2 or 3 positions, there will be 2 of 6
parsimonious pathways along which one codon could change into the
other, and all of them should be considered.
Estimating synonymous and nonsynonymous differences
• Since different pathways may involve different numbers of
synonymous and nonsynonymous changes, they should be weighted
differently.
30. SEQ.1 GAA GTT TTT
SEQ.2 GAC GTC GTA
Glu Val Phe
Asp Val Val
•Codon 1: GAA --> GAC ;1 nuc. diff., 1 nonsynonymous difference;
•Codon 2: GTT --> GTC ;1 nuc. diff., 1 synonymous difference;
•Codon 3: counting is less straightforward:
TTT(F:Phe)
GTT(V:Val)
TTA(L:Leu)
GTA(V:Val)
1
2
Path 1 : implies 1
non-synonymous
and 1 synonymous
substitutions;
Path 2 : implies 2
non synonymous
substitutions;
Example: 2 homologous sequences
31. Evolutionary Distance estimation between 2 sequences
The simplest problem is the estimation of the number of
synonymous (dS) and nonsynonymous (dN) substitutions per site
between 2 sequences:
• the number of synonymous (S) and nonsynonymous (N) sites in the
sequences are counted;
• the number of synonymous and nonsynonymous differences
between the 2 sequences are counted;
• a correction for multiple substitutions at the same site is applied to
calculate the numbers of synonymous (dS) and nonsynonymous
(dN) substitutions per site between the 2 sequences.
==> many estimation Methods
32. Evolutionary Distance estimation
In general the genetic code affords fewer opportunities for
nonsynonymous changes than for synonymous changes.
rate of synonymous >> rate of nonsynonymous substitutions.
Furthermore, the likelihood of either type of mutation is highly dependent on
amino acid composition.
For example: a protein containing a large number of leucines will contain many
more opportunities for synonymous change than will a protein with a high
number of lysines.
L Leu Leucine TTA TTG CTT CTC CTA CTG
4forld degeneratesite
2fold degenerate site
Several possible substitutions that will not change the aa Leucine
K Lys Lysine AAA AAG
Only one possible mutation at 3rd position that will not change Lysine
33. Evolutionary Distance estimation
• Fundamental for the study of protein evolution and useful for
constructing phylogenetic trees and estimation of divergence time.
34. QuickTime™ et un décompresseur TIFF (non compressé) sont requis pour visionner cette image.
• Ziheng Yang & Rasmus Nielsen (2000)
Estimating synonymous and nonsynonymous substitution rates under
realistic evolutionary models. Mol Biol Evol. 17:32-43.
Estimating synonymous and nonsynonymous substitution rates
35. Purifying selection:
Most of the time selection eliminates deleterious mutations, keeping
the protein as it is.
Positive selection:
In few instances we find that dN (also denoted Ka) is much greater
than dS (also denoted Ks) (i.e. dN/dS >> 1 (Ka/Ks >>1 )). This is strong
evidence that selection has acted to change the protein.
Positive selection was tested for by comparing the number of nonsynonymous substitutions per
nonsynonymous site (dN) to the number of synonymous substitutions per synonymous site (dS). Because
these numbers are normalized to the number of sites, if selection were neutral (i.e., as for a
pseudogene) the dN/dS ratio would be equal to 1. An unequivocal sign of positive selection is a dN/dS
ratio significantly exceeding 1, indicating a functional benefit to diversify the amino acid sequence.
dN/dS < 0.25 indicates purifying selection;
dN/dS = 1 suggests neutral evolution;
dN/dS >> 1 indicates positive selection.
36. Negative (purifying) selection eliminates disadvantageous
mutations i.e. inhibits protein evolution.
(explains why dN < dS in most protein coding regions)
Positive selection is very important for evolution of new functions
especially for duplicated genes.
(must occur early after duplication otherwise null mutations and
will be fixed producing pseudogenes).
• dN/dS (or Ka/Ks) measures selection pressure
37. Mutational saturation
Mutational saturation in DNA and protein sequences
occurs when sites have undergone multiple mutations
causing sequence dissimilarity (the observed differences)
to no longer accurately reflect the “true” evolutionary
distance i.e. the number of substitutions that have
actually occurred since the divergence of two sequences.
Correct estimation of the evolutionary distance is crucial.
Generally: sequences where dS > 2 are excluded to avoid
the saturation effect of nucleotide substitution.
39. Relative Rate Test
1 2 3
A
For determining the relative rate of
substitution in species 1 and 2, we need and
outgroup (species 3).
The point in time when 1 and 2 diverged is
marked A (common ancestor of 1 and 2).
The number of substitutions between any two species is assumed to
be the sum of the number of substitutions along the branches of the
tree connecting them:
d13=dA1+dA3
d23=dA2+dA3
d12=dA1+dA2
d13, d23 and d12 are measures of the differences
between 1 and 3, 2 and 3 and 1 and 2 respectively.
dA1=(d12+d13-d23)/2
dA2=(d12+d23-d13)/2
dA1 and dA2 should be the
same (A common ancestor
of 1 and 2).
•
40. Evolution of functionally important regions over time. Immediately after a speciation event, the two copies of the
genomic region are 100% identical (see graph on left). Over time, regions under little or no selective pressure,
such as introns, are saturated with mutations, whereas regions under negative selection, such as most exons,
retain a higher percent identity (see graph on right). Many sequences involved in regulating gene expression
also maintain a higher percent identity than do sequences with no function.
COMPARATIVE GENOMICS
Webb Miller, ú Kateryna D. Makova, ú Anton Nekrutenko, and ú Ross C. Hardisonú
Annual Review of Genomics and Human Genetics
Vol. 5: 15-56 (2004)
41. Yang & Nielsen,
Esimating Synonymous and Nonsynonymous Substitution Rates Under
Realistic Evolutionary Models
Mol. Biol. Evol. 2000, 17:32-43
=>Other estimation Models
Reference
42. Evolutionary Distance estimation between 2 sequences
• Under certain conditions, however, nonsynonymous substitution may be
accelerated by positive Darwinian selection. It is therefore interesting to examine
the number of synonymous differences per synonymous site and the number of
nonsynonymous differences per nonsynonymous site.
p-distance:
• ps = Sd/S proportion of synonymous differences ;
var(ps) = ps(1-ps)/S.
• pn = Nd/N proportion of non synonymous differences;
var(pn) = pn(1-pn)/S.
Sd and Nd are respectively the total number of synonymous and non
synonymous differences calculated over all codons. S and N are the
numbers of synonymous and nonsynonymous substitutions.
S+N=n total number of nucleotides and N >> S.
43. Substitutions between protein sequences
p = nd/n
V(p)=p(1-p)/n
nd and n are the number of amino acid differences and the total number of
amino acids compared.
However, refining estimates of the number of substitutions that have occurred
between the amino acid sequences of 2 or more proteins is generally more
difficult than the equivalent task for coding sequences (see paths above).
One solution is to weight each amino acid substitution differently by using
empirical data from a variety of different protein comparisons to generate a
matrix as the PAM matrix for example.
44. Number of synonymous (ds) and non synonymous (dn)
substitutions per site
1) Jukes and Cantor, “one-parameter method” denoted “1-p” :
This model assumes that the rate of nucleotide substitution is the
same for all pairs of the four nucleotides A, T, C and G (generally not
true!).
d = -(3/4)*Ln(1-(4/3)*p) where p is either ps or pn.
2) Kimura's 2-parameter, denoted “2-p” :
The rate of transitional nucleotide substitution is often higher than
that of transversional substitution.
d = -(1/2)*Ln(1 -2*P -Q) -(1/4)*Log(1 -2*Q)
P is the proportion of transitional differences,
Q is the proportion of transversional differences
P and Q are respectively calculated over synonymous and non
synonymous differences.
45. Jukes-Cantor model :
A T C G
A - l l l
T l - l l
C l l - l
G l l l - l is the rate of substitution.
Tajima-Nei model :
A T C G
A − β g d
T α − g d
C α β - d
G α β g - α, β, g and d are the rates of substitution.
Kimura 2-parameters model :
A T C G
A − β β α
T β − α β
C β α − β α and β are the rates of transitional
G α β β − and transvertional substitutions
Tamura model :
A T C G
A - (1-q)β qβ qα
T (1-q)β - qα qβ α and β are the rates of transitional
C (1-q)β (1-q)α - qβ and transvertional substitutions
G (1-q)α (1-q)β qβ - and q is the G+C content.
Hasegawa et al. model :
A T C G
A - gTβ gCβ gGα
T gAβ - gCα gGβ α and β are the rates of transitional
C gAβ gTα - gGβ and transvertional substitutions
G gAα gTβ gCβ - and gi the nucleotide frequencies
(i=A,T,C,G).
Tamura-Nei model :
A T C G
A - gTβ gCβ gGα1 α1 and α2 are the rates of transitional substitutions
T gAβ - gCα2 gGβ between purines and between pyrimidines;
C gAβ gTα2 - gGβ β is the rate of transvertional substitutions;
G gAα1 gTβ gCβ - and gi the nucleotide frequencies (i=A,T,C,G).
Other distance
models
46. • Example: yn00 in PAML.
• Protein sequences in a family
and corresponding DNA sequences
47. 1. Alignment of a family protein sequences using clustalW
2. Alignment of corresponding DNA sequences using as template their
corresponding amino acid alignment obtained in step 1
3. Format the DNA alignment in yn00 format
4. Perform yn00 program (PAML package) on the obtained DNA alignment
5. Clean the yn00 output to get YN (Yang & Nielsen) estimates in a file.
Estimations with large standard errors were eliminated
6. From YN estimates extract gene pairs with w = dN/dS >= 3 and gene pairs with
w<= 0.3, respectively.
7. Genes with w>=3 are considered as candidate genes on which positive
selection may operate. Whereas genes with w<=0.3 are candidates for purifying
(negative) selection
Procedure
48. S. cerevisiae: dS versus dN
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
4.5
5.0
5.5
6.0
6.5
7.0
7.5
dN
m std n min Max
dN 0.90 0.6 5085 0.0 4.98
dS 2.96 1.3 5085 0.0 6.84
w=dN/dS 0.34 0.32 5085 0.0 4.45
w=dN/dS >=3 3.6 0.57 10 3.0 4.45
• Most of the genes
are under purifying
selection
• Only few genes
might be under
positive selection
50. A new concept: codons
volatility
(Plotkin et al. 2004. nature 428. p.942-945).
• New method recently introduced, the utility of which is still
under debate;
• has interresting consequences on the study of codon variability;
51. Detecting
Selection• If a protein coding region of a nucleotide sequence has undergone
an excess number of amino-acid substitutions, then the region will
on average contain an overabundance of “volatile” codons,
compared with the genome as a whole.
Plotkin et al. Nature 428; 942-945
• Using the concept of codon volatility, we can scan an entire
genome to find genes that show significantly more, or less, pressure
for amino-acid substitutions than the genome as a whole.
• If a gene contains many residues under pressure for aa
replacements, then the resulting codons in that gene will on
average exhibit elevated volatility.
• If a gene is under purifying selection not to change its aa, then the
resulting sequence will on average exhibit lower volatility.
52. Codons volatility
• The codon CGA encoding arginine (R), has 8 potential ancestor codons (i.e.
non stop codon) that differ from CGA by one substitution.
• Volatility of a codon is defined as the proportion of nonsynonymous codons
over the total neighbour sense codons obtained by a single substitution.
• The volatility of CGA = 4/8.
• The volatility of AGA also encodes an arginine = 6/8.
1
2 3
4
5
6
7
8
1
2
3
4
5
67
8
Plotkin et al. 2004.
Nature 428. p.942-
945
53. Codons
volatility
• 22 codons have at least one synonymous with a different volatility;
•Volatility of a codon c:
v(c) = 1/n {D[aacid(c) - aacid(c∑ i)];i=1,n};
n is the number of neighbors (other than non-stop codons) that
can mutate by a single substitution.
D is the Hamming distance = 0 if the 2 aa are identical;
=1 otherwise.
• Volatility of a gene G:
v(G) = {v(c∑ k);k=1,l}; l is the number of codons in the gene G.
54. Codons volatility
• Volatility is used to quantify the probability that the most recent
substitution of a site caused an amino-acid change.
• Each gene’s observed volatility is compared with a bootstrap
distribution of alternative synonymous sequences, drawn
according to the background codon usage in the genome,
and its significance statistically assessed.
• Randomization procedure controls for the gene’s length and
amino-acid composition.
• The volatility of a gene G is defined as the sum of the volatility
of its codons.
55. Codons volatility
Volatility p-value of G:
• The observed v(G) is compared with a bootstrap distribution of
106
synonymous versions of the gene G.
• In each randomization sample, a nucleotide sequence G’ is
constructed so that it has the same translation as G but whose
codons are drawn randomly according to the relative frequencies
of synonymous codons in the whole genome.
• p-value for G = proportion of randomized samples;
so that v(G’) > v(G).
• 1-p is a p-value that tests whether a gene is significantly less
volatile than the genome as a whole.
56. Detecting
Selection
• A p-value near zero indicates significantly elevated volatility,
whereas a p-value near one indicates significantly depressed
volatility.
• The probability that a site’s most recent substitution caused a
non-synonymous change is:
- greater for a site under positive selection;
- smaller for a site under negative (purifying) selection.
• http://www.cgr.harvard.edu/volatility
57. 1) Paul M. Sharp
Gene "volatility" is Most Unlikely to Reveal Adaptation
MBE Advance Access published on December 22, 2004.
doi:10.1093/molbev/msi073
2) Tal Dagan and Dan Graur
The Comparative Method Rules! Codon Volatility Cannot Detect Positive Darwinian Selection Using a Single Genome Sequence
MBE Advance Access published on November 3, 2004.
doi:10.1093/molbev/msi033
3) Robert Friedman and Austin L. Hughes
Codon Volatility as an Indicator of Positive Selection: Data from Eukaryotic Genome Comparisons
MBE Advance Access originally published on November 3, 2004. This version published November 8, 2004.
doi:10.1093/molbev/msi038
4) Hahn MW, Mezey JG, Begun DJ, Gillespie JH, Kern AD, Langley CH, Moyle LC.
Evolutionary genomics: Codon bias and selection on single genomes.
Nature. 2005 Jan 20;433(7023):E5-6.
5) Nielsen R, Hubisz MJ.
Evolutionary genomics: Detecting selection needs comparative data.
Nature. 2005 Jan 20;433(7023):E6.
6) Chen Y, Emerson JJ, Martin TM
Evolutionary genomics: Codon volatility does not detect selection.
Nature. 2005 Jan 20;433(7023):E6-7.
7) Zhang J, 2005.
On the evolution of codon volatility
Genetics 169: 495-501.
8) Plotkin JB, Dushoff J, Fraser HB.
Evolutionary genomics: Codon volatility does not detect selection (reply).
Nature. 2005 Jan 20;433(7023):E7-8.
9) Plotkin JB, Dushoff J, Desai MM and Fraser HB
Synonymous codon and selection on proteins
-> Volatility is not adequate for
predicting selection;
-> Extreme volatility classes have
interesting properties, in terms of aa
composition or codon bias;
-> Volatility may be another measure
of codon bias;
-> Authors : some genes are under
more positive, or less negative,
selection than others.
58. Codon Volatility (simple substitution model):
Codons and volatility under simple substitution modelCodons and volatility under simple substitution model
63. QuickTime™ et un décompresseur TIFF (non compressé) sont requis pour visionner cette image.
64. Qui ckT ime™ et un décompresseur T IFF (non compressé) sont requi s pour vi sionner cette i mage.
65. References:
• Ziheng Yang and Rasmus Nielsen (2000)
Estimating synonymous and nonsynonymous substitution rates under realistic
evolutionary models.
Mol Biol Evol. 17:32-43.
• Yang Z. and Bielawski J.P. (2000)
Statistical methods for detecting molecular adaptation
Trends Ecol Evol. 15:496-503.
• Phylogenetic Analysis by Maximum Likelihood (PAML)
http://abacus.gene.ucl.ac.uk/software/paml.html
• Plotkin JB, Dushoff J, Fraser HB (2004)
Detecting selection using a single genome sequence of M. tuberculosis and P.
falciparum. Nature 428:942-5.
• Molecular Evolution; A phylogenetic Approach
Page, RDM and Holmes, EC (Blackwell Science, 2004)
• Sharp, PM & Li WH (1987). NAR 15:p.1281-1295.
66. References
• MEGA: http://www.megasoftware.net/
• PAML: http://abacus.gene.ucl.ac.uk/software/paml.html
• Fundamental concepts of Bioinformatics.
Dan E. Krane and Michael L. Raymer
• Genomes 2 edition. T.A. Brown
• Phylogeny programs :
http://evolution.genetics.washington.edu/phylip/sftware.html
Books:
• Molecular Evolution; A phylogenetic Approach
Page, RDM and Holmes, EC
Blackwell Science
Editor's Notes
Three major forces are at work in modifying the genetic information in any genome:
-Expansion (gene duplication)
-Deletion (gene loss)
-Exchange (HGT)
Figure 3. Concerted Evolution
Different gene conversion events homogenize minimally diverged duplicate genes in each daughter species (A and B), with the result that while paralogues are highly similar, orthologues diverge over time.
The vast majority of genes in every genome are selectively constrained, in that most nucleotide changes that alter the fitness of the organism are deleterious. How do we know this? Comparisons between genomes clearly demonstrate that coding sequences diverge at slower rates than non-coding regions, largely due to a deficit of mutations at positions where a base change would cause an amino-acid change. Gene duplication provides opportunities to explore this forbidden evolutionary space more widely by generating duplicates of a gene that can ‘wander’ more freely, on condition that between them they continue to supply the original function.
Note:
In the evolutionary sens homology corresponds to characters directly acquired from their common ancestry.
If the character was acquired independtly (afeter eolution), they are not homologous but homoplasious.
Mutation is a fundamental process without which evolution would not occur.
Knowledge about mutation rates is therefore key to evolutionary and population genetics, but also to several other areas. For instance, proper evolutionary dating founded on molecular clocks requires knowledge of the mutation rate. Moreover, as the double-edged sword effect of mutation is to cause genetic disease, understanding the rate of mutation is important in medical genetics. Furthermore, if we are to infer selection from patterns of divergence, an important aspect of comparative and functional genomics, then we need realistic null models of neutral variation (i.e. knowledge of mutation patterns). Finally, knowledge about mutation rates can shed light on issues relating to the mechanistic basis of germline mutation – there is, for instance, an ongoing debate concerning the relative importance of replication errors as a source of mutation.
Note:
Multiple substitutions can greatly obscure the actual evolutionary history of a pair of sequences.
The last 3 kinds of multiple substitution have potentially more serious consequences. In each case the two descendant sequences are identical, yet in no case is that similarity inherited directly from he ancestral sequence.
Similarity that is inherited from the ancestor is homologous similarity, whereas indepently acquired similarity if homoplasious similarity.
The occurence of homoplasy can obscure the actual number of evolutionary events: in each of the 3 last cases, the 2 descendant sequences are identical, even though between 2 and 3 substitutions have occured.
A substitutions that exchange a purine for another purine, or a pyrimidine for another pyrimidine are called transitions, and in some genes are more common than the remaining substitutions purine -&gt; pyrimidine or pyrimidine -&gt; purine (transversion).
Codon usage bias = unequal codon frequencies in a gene
This is to show who useful are estimations of mutational bias.
Choisir une famille
Advantage: alignment is valid at the codon level.
Most genes are under purifying selection
Only few genes might be subject to positive selection.
This is a general results.