Download as PDF, PPTX
Uploaded byIntegrated DNA Technologies
New RNA tools for optimized CRISPR/Cas9 genome editing
The document discusses advancements in CRISPR/Cas9 genome editing, focusing on solutions for delivering Cas9 and sgRNA, optimizing editing efficiency, and improving methods to reduce off-target effects. It highlights various experimental results and methods for synthesizing gBlocks gene fragments for sgRNA expression, examining the performance of different RNA configurations. Key findings indicate that the use of two-part RNA oligos enhances editing efficacy and reduces immunogenic responses compared to in vitro transcribed sgRNAs.
More Related Content
Similar to New RNA tools for optimized CRISPR/Cas9 genome editing
New RNA tools for optimized CRISPR/Cas9 genome editing
- 1. Ashley Jacobi, ResearchScientist Integrated DNA Technologies New RNA tools for optimized CRISPR/Cas9 genome editing October 7th , 2015 1
- 2. Implementing CRISPR/Cas9 geneediting 2
- 3. Options for theCRISPR gRNA 3
- 4. Repair of double-strandedbreaks—HR vs. NHEJ 4
- 5. • S. pyogenesCas9 is a large protein, 1368 aa = 4104 bp • Plasmid containing Cas9: 7–10 kb • Transfection of a large plasmid results in variable and low transfection efficiency, making large quantitative comparison studies difficult Delivery of a Cas9 + sgRNA expressionplasmid is difficult 5 Delivering large Cas9 expression plasmid to cells can be difficult
- 6. Optimizing CRISPR gRNAusing HEK293-Cas9 cell line 6 Low, constant level of Cas9 presentin HEK293-Cas9 – Note the extremely high levels of Cas9 presentin just a small fraction (~10%) of transfected cells using plasmid. Can this contribute to OTEs? HEK293-‐Cas9 Cells Western blot—Cas9 primary antibody
- 7. T7EI mismatch detectionto assay gene disruption 1. Transfect HEK-Cas9 cells with the CRISPR gRNA – Alternatively deliver Cas9 as plasmid, mRNA or protein 2. Incubate 48 hours, then harvest genomic DNA 3. PCR amplify region around CRISPR site (400–1000 base amplicons) – Heat, cool to form heteroduplexes 4. Incubate with T7 Endonuclease I (T7EI, New England BioLabs) 5. Run on gel or Fragment Analyzer™ (Advanced Analytical) to visualize cleavage at heteroduplex mismatch sites 7
- 8. IDT CRISPR geneediting and mutation detection workflow 8 • The Fragment Analyzer™ (Advanced Analytical) provides reliable quantification of T7EI heteroduplex cleavage assay with 96-channel CE – High resolution analysis of fragments 10–40,000 bp – Rapid 1 hr run – 1/10th amount of DNA required to visualize Transfect 2-‐part RNA at 30 nM or gBlocks fragment at 3 nM into Cas9 expressing cells Extract gDNA after 48 hr with QuickExtract DNA Solution Heat gDNA extract at 65°C for 15 min followed by 95°C for 15 min Amplify gDNA with KAPA HiFi Polymerase and PCR assay targeting region of interest Add NEB buffer 2 to PCR, heat to 95°C and slowly cool to allow heteroduplex formation Digest heteroduplexes with 2 units of T7EI at 37°C for 1 hr Analyze digestion on Fragment Analyzer Electropherogramand peaktableof separated sample on FragmentAnalyzer 52% T7 cleavage
- 9. Options for theCRISPR gRNA 9
- 10. gBlocks® Gene Fragmentsfor CRISPR • Inexpensive gene synthesis product with rapid delivery – High quality double-stranded DNA fragments – 125–2000 bp in length – Sequence verified • CRISPR gBlocks® Gene Fragment = 364 bp sgRNA expression cassette – Comprised of a 265 bp U6 promoter that drives transcription of a 99 base sgRNA www.idtdna.com/CRISPR 10 AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAG AGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATT TCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTAT TTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNNGTTTTAG AGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT
- 11. gBlocks® Gene Fragmentsas sgRNA (three methods) 1. Clone gBlocks Gene Fragments into an expression plasmid 2. Use gBlocks Gene Fragment as template for in vitro transcribed sgRNA (IVT sgRNA) 3. Directly transfect gBlocks Gene Fragment into cells without cloning 11 www.idtdna.com/CRISPR http://www.addgene.org/static/cms/files/hCRIS PR_gRNA_Synthesis.pdf gRNA backbone Current Protocols in Molecular Biology (2014), 31.1.1-31.1.17. >14,000 gBlocks® Gene Fragments manufactured for CRISPR
- 12. CRISPR gBlocks® GeneFragment in HPRT gene (HEK293 Cas9 cells) 12 38094 S 38095 S 38115 S 38129 S 38231 S 38239 S 38256 S 38338 S 38371 S 38448 S 38478 S 38509 S 38510 S 38574 S 38626 S + 23% 46% 21% 0% 31% 27% 3% 47% 0% 41% 14% 39% 4% 36%43% 2% Agarose gel Fragment Analyzer™ Note: sequence analysis shows 30% cleavage in T7EI assay = 60–70% total editing +
- 13. Validation of T7EIassay: % total editing compared to Sanger sequencing Sanger sequence analysis shows 30% cleavage in the T7EI assay = 60–70% actual change at DNA level (T7EI misses small changes like single base indels) 13 • Amplicons resulting in varying editing efficiencies viaT7EI were cloned and sequenced. T7EI cleavage (%)
- 14. CRISPR gBlocks® GeneFragments sgRNA perform well across many sites (3 genes; 301 sites) 14 0 10 20 30 40 50 60 70 80 90 100 % Cleavage via 2U T7EI 167 EMX1 Exon 3 (64% GC) 91%* 0 10 20 30 40 50 60 70 80 90 100 % Cleavage via 2U T7E1I 92 STAT3 Exon 5/6 (47% GC) 76%* 0 10 20 30 40 50 60 70 80 90 100 % Cleavage via 2U T7EI 42 HPRT Exon 7 (36% GC) 81%* sgRNAs expressed from gBlocks Gene Fragments work well without the need to cloneintoplasmids Directly transfect intoHEK-Cas9 cells at 3 nM Every PAM sitein 3 exons * Percentageof sgRNA designs with >20% editing efficiency by T7EI assay +
- 15. Options for theCRISPR gRNA 15
- 16. Options for theCRISPR gRNA 16 UUAUAUCCAACACUUCGUGGUUUUAGA-‐-‐GCUAG ||||||| |||| A ||||||| |||| A C-‐GGAAUAAAAUUGAACGAUA U| || A| || GUCCGUUAUCAACUUG |||| A |||| A AGCCACGGUGAAA G |||||| UCGGUGCUUU sgRNA: 99–123 bases (99mershown) 20 base “protospacer” guide, target specific • Near the length limit for chemical manufacturing • Expensive to chemically make long sgRNAs for many sites This form is used in our gBlocks® Gene Fragment sgRNA expression cassette UUAUAUCCAACACUUCGUGGUUUUAGA-‐-‐GCUAUGCUGUUUUG ||||||| |||||||||||||| C-‐GGAAUAAAAUUGAACGAUACGACAAAACUUACCAAGGUUG U| || A| || GUCCGUUAUCAACUUG |||| A |||| A AGCCACGGUGAAA G |||||| UCGGUGCUUUUUUU crRNA: 42 bases (target specific) tracrRNA: 89 bases (universal) • 42mer target specific (20 base target, 22 base constant) • 89mer universal tracrRNA—can be made in bulk, making them more affordable Can these be optimized and shortened to improve function and lower cost?
- 17. Optimized length of crRNA and tracrRNA crRNA: 42 bases (20+22) tracrRNA: 89 bases (universal) UUAUAUCCAACACUUCGUGGUUUUAGA-‐-‐GCUAUGCUGUUUUG ||||||| |||||||||||||| C-‐GGAAUAAAAUUGAACGAUACGACAAAACUUACCAAGGUUG U| || A| || GUCCGUUAUCAACUUG |||| A |||| A AGCCACGGUGAAA G |||||| UCGGUGCUUUUUUU Native sequence Shorter Shorter… Short
- 18. Both the crRNAand the tracrRNA can be truncated 18 1. Short/Short 2. Long/Short 3. Short/Long 4. Long/Long Worse Worse when too short Better
- 19. 19 0 10 20 30 40 50 60 70 80 90 100 89 nt tracrRNA74 nt tracrRNA 70 nt tracrRNA 67 nt tracrRNA 65 nt tracrRNA 63 nt tracrRNA T7EI cleavage (%) 42-‐nt crRNA 39-‐nt crRNA 36-‐nt crRNA 34-‐nt crRNA Length optimization of crRNA & tracrRNA HPRT 38285 gRNA (HEK293 Cas9 Cells) Optimal length for crRNA is 36 nt; optimal tracrRNA is 67 nt +
- 20. 0 10 20 30 40 50 60 70 80 90 100 HPRT 38094 S HPRT 38231 S HPRT 38371 S HPRT 38509 S HPRT 38574 S HPRT 38087 AS HPRT 38133 AS HPRT 38285 AS HPRT 38287 AS HPRT 38358 AS HPRT 38636 AS HPRT 38673 AS T7EI cleavage (%) CRISPR gRNA Comparison—12 gRNAs Targeting HPRT (HEK293-‐Cas9 Cells) 2-‐part RNA (36/67) Native RNA (42/89) In vitro transcribed sgRNA sgRNA Expression Plasmid (2.7 kb) gBlocks Gene Fragments sgRNA Optimized 2-part CRISPR RNAs are superior to other gRNAs 20 HEK-‐Cas9 cells 2-‐part RNA (30 nM) IVT RNA (30 nM) Plasmid (100 ng) gBlocks Fragment (3 nM) + or or or
- 21. Highly purified oligosare necessary for longer tracrRNAs 21 HEK-‐Cas9 cells 2-‐part RNA, 30 nM Desalt crRNA Desalt vs. HPLC tracrRNA 1. Shortened crRNA:tracrRNA performs better than native form 2. 67mer tracrRNA functions well as desalted, shows slight improvement as HPLC 3. Native 89mer tracrRNA requires highly purified synthesis 0 10 20 30 40 50 60 70 80 HPRT 38094 S HPRT 38231 S HPRT 38371 S HPRT 38509 S HPRT 38574 S HPRT 38087 AS HPRT 38133 AS HPRT 38285 AS HPRT 38287 AS HPRT 38358 AS HPRT 38636 AS HPRT 38673 AS T7EI cleavage (%) HPLC vs. Desalted RNA Oligos – HPRT 12 sites (HEK293 Cas9 cells) short crRNA (36nt) : short tracrRNA desalt (67nt) short crRNA (36nt) : short tracrRNA HPLC (67nt) long crRNA (42nt) : long tracrRNA desalt (89nt) long crRNA (42nt) : long tracrRNA HPLC (89nt) +
- 22. 2-part RNA oligoswill be available from IDT this month! • crRNA – 36 nt custom desalted RNA oligo – Ability to order in 96-well plate format – 2 or 10 nmol • tracrRNA – 67 nt HPLC purified RNA oligo – Modified for nuclease stability – 5, 20, or 100 nmol 22
- 23. Be sure tocheck QC data on long synthetic RNAs 23 IDT tracrRNA Vendor “X” tracrRNA ESI-‐MS
- 24. 2-part RNA systemfunctions well across many sites 24All PAM sites in 6 exons, 553 sites (HEK293 Cas9 Cells) * ** * * * * Percentageof sgRNA designs with >20% editing efficiency by T7EI assay +
- 25. Summary of 2-partRNA functional performance in HEK-Cas9 cells 553 guide sites in 6 exons from 4 human genes 25 Target amplicon Number ofsites % >15% T7 cleavage % >20% T7 cleavage HPRT exon 7 (36% GC) 42 40/42 = 95% 40/42 = 95% HPRT exon 1 (62% GC) 164 135/164 = 82% 123/164 = 75% EMX1 exon 3 (64% GC) 167 151/167 = 90% 143/167 = 86% EMX1 exon 5/6 (40% GC) 59 56/59 = 95% 53/59 = 90% STAT3 exon 5/6 (47% GC) 92 86/92 = 93% 86/92 = 93% DICER exon 8 (38% GC) 29 28/29 = 97% 28/29 = 97% Total 553 496/553 = 90% 473/553 = 86% +
- 26. Comparison of gBlocks®Gene Fragments sgRNAs vs. 2-part RNA 26 + or * * * * * *
- 27. CRISPR on-target mutationprofiles for varying RNA Triggers 27 • Sanger sequencing of amplicons from one target site in HPRT as varying RNA triggers
- 28. Although use ofshorter 17mer guides has been reported toreduce off- target effects, 17mer guides can result in far worse on-target results. Other design features to consider — shorter protospacer? 28 0 10 20 30 40 50 60 70 80 90 100 HPRT 38094 S HPRT 38231 S HPRT 38371 S HPRT 38509 S HPRT 38574 S HPRT 38087 AS HPRT 38133 AS HPRT 38285 AS HPRT 38287 AS HPRT 38358 AS HPRT 38636 AS HPRT 38673 AS T7EI cleavage (%) Guide RNA length study—20 vs. 19 vs. 18 vs. 17 nt (HEK293 Cas9 Cells) 20 nt 19 nt 18 nt 17 nt +
- 29. • Transfection ofin vitro transcribed sgRNAs sometimes resulted in large scale cell death. Comparison of in vitro transcribed sgRNAs to 2-part RNAs 29 MEGAshortscript T7 IVT Kit (Ambion) HiScribe T7 High Yield IVT Kit (NEB)
- 30. Activity of 2-partRNAs vs. in vitro transcribed sgRNAs 30 0 10 20 30 40 50 60 70 80 90 100 HPRT 38094 S HPRT 38231 S HPRT 38371 S HPRT 38509 S HPRT 38574 S HPRT 38087 AS HPRT 38133 AS HPRT 38285 AS HPRT 38287 AS HPRT 38358 AS HPRT 38636 AS HPRT 38673 AS T7EI cleavage (%) 2-‐part RNA vs. IVT sgRNA—HPRT 12 sites (HEK293 Cas9 Cells) 2 part RNA IVT sgRNA -‐ + or
- 31. In vitro transcribedsgRNAs trigger immune response, 2-part RNA oligos do not (HEK-Cas9 cells) 31 • IFITM1, RIGI, and OAS2 had similarly high induction when treated with in vitro transcribed sgRNA (triphosphate removed) • No inductions were detected when treated with 2-part RNA oligos + or
- 32. • Reverse transfectioninto96-well plate • 100 ng plasmid, 0.3 µL TransIT X2 • Images taken 48 hr after transfection Back to the Cas9 delivery problem… 32
- 33. IDT Cas9 ExpressionPlasmid—minimal vector • Minimal vector (7.3 kb) – Origin of replication – Ampicillin resistance – No selection marker • Deliver Cas9 expression plasmid, followed by delivery of 2-part RNA • Improvements in editing, other plasmid associated problems remain 33
- 34. • Simple, fast,and robust delivery – Complex gRNA & Cas9 protein – Deliver directly to cells using lipofection or electroporation • Cas9 RNP = preferred method – Protection of RNA—reduced risk of degradation – Higher editing compared to plasmid delivery – No DNA present—no integration events – Tight control of Cas9 (on/off, nothing present in the cell that can make more) – Reduced risk of mosaicism in animal embryo studies 34 Delivery of CRISPR gRNA + Cas9 protein as ribonucleoprotein complex (RNP) +
- 35. 2 part gRNAdelivered into HEK-Cas9 cells and RNP delivered into normal HEK cells result in identical editing efficiency 35 0 10 20 30 40 50 60 70 80 90 100 HPRT 38094 S HPRT 38231 S HPRT 38371 S HPRT 38509 S HPRT 38574 S HPRT 38087 AS HPRT 38133 AS HPRT 38285 AS HPRT 38287 AS HPRT 38358 AS HPRT 38636 AS HPRT 38673 AS T7EI cleavage (%) HPRT 12 Sites -‐2 part RNA (30 nM) into HEK293-‐Cas9 Cells –0.75 µL RNAiMAX 2 part RNA + Cas9 protein into HEK293 Cells 10 nM gRNA, 10 nM Cas9 protein –1.2 µL RNAiMAX HEK293-‐Cas9 Cells HEK293 cells + Ribonucleoprotein Complex +or
- 36. 2 part +Cas9 protein RNP Delivery is efficient in many cell lines 36 0 10 20 30 40 50 60 70 80 90 100 Mm F9 gRNA-‐1 Mm F9 gRNA-‐2 Mm F9 gRNA-‐3 Mm F9 gRNA-‐4 Mm F9 gRNA-‐5 Mm F9 gRNA-‐6 Mm F9 gRNA-‐7 Mm F9 gRNA-‐8 Mm F9 gRNA-‐9 Mm F9 gRNA-‐10 T7EI cleavage (%) Mm Factor IX gRNA Screen – AML12 Cells Cas9 RNP—10nM gRNA, 10nM Cas9 protein, 1.25µL RNAiMAX 9/10 sites high % gene editing +
- 37. Conclusions 1. Synthetic RNAoligos mimicking the natural 2-part CRISPR system (crRNA:tracrRNA complex) function well in mammalian cells, both when Cas9 is expressed in the target cell and when pre-complexed with Cas9 protein as a ribonucleoprotein. 2. “Optimized” shortened crRNA:tracrRNA complex shows improved editing activity. 3. In vitro transcribed sgRNAs have a risk for immune activation. 4. The 2-part system & gBlocks® Gene Fragments both give a high positive hit rate in gene walks. This suggests that site selection algorithms may not be needed for many applications, as long as multiple sites are tested. 37
- 38. Coming soon: NewCRISPR products from IDT! 38 CRISPR product type CRISPR crRNA 2 and 10 nmol CRISPR crRNA plates 2 nmol CRISPR tracrRNA 5, 20, and 100 nmol Control kits Human, mouse, and rat CRISPR crRNA HPRT positive control Human, mouse, and rat CRISPR crRNA negative controls 3 sequence options HPRT PCR primer mix Human, mouse, and rat Cas9 expression plasmid
- 39. “Best tech support ever, @idtdna!” Questions? TALKTO A PERSON. Lauren SakowskiOur experts are availablefor consultation. “The people at @idtdna are awesome. A+ for customer service.” Nikolai Braun Contact us by web chat, email, or phone. Find local contact details at: www.idtdna.com Or email: applicationsupport@idtdna.com
- 40. This image cannotcurrently be displayed. THANK YOU! We will email you the webinar recording and slides next week.