Crispr/cas9 101
•Download as PPTX, PDF•
41 likes•42,415 views
This document provides an overview of CRISPR/Cas9 genome editing. It discusses the history and limitations of prior genome engineering techniques like recombinant DNA and zinc finger nucleases. It then explains how CRISPR/Cas9 works as a RNA-guided DNA endonuclease and how this allows it to efficiently and specifically edit genomes. The document outlines several applications of CRISPR/Cas9 like generating knockout animals and cell lines. It also notes some concerns about using the technique for human genome editing.
Recommended
More Related Content
What's hot
What's hot (20)
Viewers also liked
Viewers also liked (10)
Similar to Crispr/cas9 101
Similar to Crispr/cas9 101 (20)
More from Suk Namgoong
More from Suk Namgoong (19)
Recently uploaded
Recently uploaded (20)
Crispr/cas9 101
- 1. CRISPR/Cas9 Suk Namgoong Center for Animal Bioreactor & Xenotransplantation Chungbuk National University
- 2. Contents • History of Genome Engineering • CRISPR/Cas9 • Applications • Current Limitations and Future prospects
- 3. Recombinant DNA Technology : aka “Genetic Engineering” - Plasmid Vector - Restriction Endonuclease - DNA Ligase Foundation of Modern Molecular Biology & Biotechnology Paul Berg Herb Boyer Stanley Cohen - PCR - Sanger Sequencing Kary Mullis Fred Sanger - Transgenic Animal/Plants Rudolph Jaenisch
- 4. • Size of DNA can manipulates in vitro : ~ Max 150kb. More practically, less than 20kb • Recombinant DNA can manipulated is mostly episomal DNAs • Random Integration of foreign DNA Major Limitations of „Genetic Engineering v1.0‟
- 5. Restriction Endonuclease • Typical restriction endonuclease can recognize 6-8bp • RE with 6bp will cut, on average, every 46 or 4096bp, while 8bp cutter will recognize 48, or 65536bp • Therefore conventional RE is not suitable for genome level manipulation. • Human Genome : 3 billion bp. • For specific cleavage of human genome, at least specific recognition of more than 18bp would be required.
- 6. Genome Engineering “Genetic Engineering v2.0” • Homologous Recombination • Artificial Restriction Enzyme ZFN (Zinc-Finger Nuclease) TALEN (Transcription activator-like effector nuclease) • CRISPR/Cas9
- 7. - Yeast - E.coli (Lamda Red Recombinase System) - Mouse Embryonic Stem Cell (Knockout/KnockIn mouse) - Limitations • Feasible in only a few model organisms (ES Cell) • Time consuming • Efficiencies Homologous Recombination
- 8. ZFN & TALEN Artificial restriction enzyme consist of DNA recognition (Zinc Finger or TALE) Cleavage Domain (FokI Nuclease) Repeated Protein Modules (Zinc Figer or TALE) recognize DNA bases Dimerization of FokI nuclease domain induce cleavages of target DNA recognize long stretches of bases suitable for genome-level cleavages
- 9. Left ZFN 9 nt target Right ZFN 9 nt target Cleavage by Dimerization
- 10. • To recognize new target sequence, you should develop new zinc-finger DNA binding domain - Modular assembly from previously generated array - Selection using Phage Display/One Hybrid • Time consuming for the proper ZFP sets • Failure rate is very high • Off-target effects are very high
- 11. TALEN Transcription activator-like effector nuclease TAL effector : secreted protein by plant pathogenm Xanthomonas sp. Type III effector proteins which activate plant gene expression Repeated highly conserved 33-34 amino acid sequences (Except 33-34 amino acids)
- 12. Left TALEN 16-17nt target Right TALEN 16-17 nt target
- 14. Nonhomologus end joining (NHEJ) - Natural pathway to repair double-strand break of DNA - ZFN or TALEN induces double-stranded break of DNA then NHEJ joins broken ends, although its repair ability can be limited. ZF or TALE ZF or TALE FokI FokI DSB NHEJ Indel Cause Frameshift -> knockout
- 15. Homology Directed Repair (HDR) ZF or TALE ZF or TALE FokI FokI DSB Donor Template (Mutation, Insertion..) HDR ssDNA Oligo or Plasmid Precise Repair (Targeted Gene Integration, Site-specific Mutagenesis)
- 16. CRISPR/Cas9
- 17. Humble Beginning as Exotic Repeat Sequences in Bacterial Genome - Found as „exotic junk DNA‟ with unknown function Ishino et al., J.Bacteriol (1987) - Widespread presence in Archeae and Bacteria Jansen et al, Mol. Microbiol (2002) - Named as.. lustered egularly nterspaced hort alindromic epeat RISPR sociated protein (Cas) Family of genes associated with CRISPR - Sequence similarity between phage
- 18. CRISPR as bacterial immune system against bacteriophagy The research was carried at by researcher in DANISCO.Inc (acquired by DuPont at 2011) Science 2007
- 20. Practical questions in Yogurt Fermentation industry - Phage contamination : Most serious problem in fermentation industries - Phage-resistant strains would emerged after phage pandemics - Hypothesis
- 21. Insertion of „spacer‟ between CRISPR element after phage challenge
- 22. Phage genome has sequences corresponds to spacer
- 23. Involvement of cas genes in immunity against bacteriophage Horvath et al., Science 2007
- 25. Biochem J. Jul 15, 2013; 453(Pt 2): 155–166.
- 26. Biochem J. Jul 15, 2013; 453(Pt 2): 155–166.
- 27. Cas9 : RNA-directed Endonuclease In contrast with other CRISPR system, Cas9 is the only component in Inference complex in Type II CRISPR system
- 28. Cas9 as RNA-dependent Programmable DNA Endonuclease Plasmid DNA +Complementary crRNA+ tracrRNA dsDNA Cleavage Cas9
- 29. Cas9 = Reprogrammable RNA-Dependent Restriction Enzyme
- 30. Cas9-sgRNA-DNA complex structure RuvC RuvCHNH PI 1 1386 Rec Nureki et al., Cell 2014
- 32. CRISPR/Cas9 as Genome Editing Tools Church et al., Jan 2013 Zhang et al, Jan 2013 Humanized Cas9 Trans-crRNA
- 33. Cong et al., Science 2013
- 34. Knock-out mouse modified multiple locus with single step Rudolph Jaenisch Déjà vu?
- 35. August 2013 Cell
- 36. One-Step Generation of Knock Out / Knock-In Mouse Traditional Knock Out/In Mouse Generations using ES Cell Targeting Vector Construction/ ES Cell Knockout and selection 3 Months Injection of ES Cell into Blastocyst Generation Chimeric Mouse 2 Months At least 6-12 Months is required to generate Founder Mice CRISPR/Cas9 Systems Design and Generation of sgRNA andCc Less than a week (1 day except oligo synthesis) Injection in Zygote And Transfer to surrogates Mother 1 weeks Germline transmission and backgross Selection of Founder ~ 4 Month (If you are lucky…) Founder Mouse Less than 3 weeks Multiple gene : individual crossing…
- 37. 80-90% of Mouse has mutated alleles 60-70% of Mouse has Double Knocked when two sgRNAs are introduced
- 38. Knock-in Generations Generation of floxed mouse in single step • Injections of cas9+sgRNA+ssODN(Single- strand oligo donor nucleotide) • Homology Dependent Repair
- 39. ~10% ~20% ~20%
- 40. Advantage of CRISPR/Cas9 over TALEN or ZFN (1) TALEN or ZFN Artificial protein gene recognizing the target sequences are required X 2 Synthesis of TALE gene is not trivial due to repeated nature of TALE
- 41. Sometime very complicated construction scheme is required.. Sakuma, Sci Rep. 2013
- 43. Validation of Constructed TALEN/ZFN is essential Kim et al., Nature Method (2011)
- 44. http://www.toolgen.com/html/kor/technology/surrogate_reporter.php Enrichments using surrogate reporter system
- 45. In CRISPR/Cas9 system… All you need to synthesize this part Cas9 is common protein component regardless the nature of recognition site - Very affordable - Fast - High-throughput friendly
- 46. Advantage of CRISPR/Cas9 over TALEN or ZFN (2) - TALEN or ZFN : Artificial Restriciton Enzyme consisted with.. DNA binding domain + Nonspecific DNA cleavage domains Dimerization of FokI cleavage domain is essential for DNA cleavages If binding affinity of one of ZFN/TALEN pair is less than other, cleavage efficiency is lo - Not as optimal compared with bona-fide endonuclease?
- 47. Cas9 is bona fide RNA-dependent DNA endonuclease by itself - Higher catalytic efficiency - Evolved to cleave Phage DNA after injection ASAP.
- 48. Higher efficiency than TALEN Church et al., 2013 Science
- 49. Cell Stem Cell, 2013
- 50. The real secret for popularity of CRISPR/Cas9 system
- 51. Case Studies Buzzword about Cas9 became really loud, so we decided to join CRISPR bandwagon… http://www.addgene.org
- 52. In January 2014, we got cas9 constructs from addgene.. $65 per clone
- 53. In vitro transcriptions of Cas9 Design and Generation of sgRNAs - Order two DNA oligos.. -Annealing and amplification using PCR -In vitro transcription using T7 RNA Polymerase For the preparations of all of material, it tooks 2-3 Days..
- 54. Exon1OCT-4 Exon2 Exon3 Exon4 Exon5 TCCTAAAGCAGAAGAGGATCACCCTGGGATATAC Knockout of Porcine Oct4 Injections in Porcine Zygotes (Parthernotes) J.W. Kwon
- 56. DNA Oct4 Merge Cas9 (100ng) Cas9/ sgRNA (10ng/ul) Cas9/ sgRNA (100ng/ul) Immunostaining of Oct4 in Cas9/sgRNA Knockdown of l Oct4 in porcine blastocyst
- 57. Application of CRISPR/Cas9 • Knockout/Knock-in Animal Generation • Gene Knockout in Cultured Cell Line • Gene Activation / Repression by dCas9 • Therapeutic Application? • Others..
- 58. Generation of Animal Model in Lighting Speed - Knockout/Knock-in generation Mouse : at least 6~12 months - Using CRISPR/Cas9.. You can get a founder in 2 Months with ~90% of efficiency - Introduction of Disease Model Mutations Variants discovered from GWAS / WGS projects Validation in animal model would be possible
- 59. Knockout/KnockIn in „Other‟ Animals - Knockout/Knock-in generation Mouse : Established procedures even before ZFN/TALEN/CRISPR - But in other animal? Lack of embryonic stem cell and suitable genome level targeting technology Even in Rat, embryonic stem cell was - Targeted genetic modification in domestic animal
- 60. With Little Helps from CRISPR/Cas9.. Rat August 2013Zebrafish January 2013 Xenopus October 2013 Pig January 2014 Rabbit January 2014 Rice fish April 2014 Silkworm December 2013 Drosophila September 2013
- 61. Virtually genomes of all living organisms can be modified by CRISPR/Cas9 as “Programmable DNA endonculease” AnimalPlant Fungi Bacteria Mouse Rat Xenopus Drosophila Pig Zebrafish Rabbit Goat Arabidopsis Rice Tobacco Wheat Orange
- 65. Genome Engineering in Primate is feasible
- 66. Sus scorfa : Important model organism for Xenotransplantation Knockout of immune responsive related genes is necessary Alternative Source of Human Organs : Xenotransplantation? - porcine α1,3-galactosyltransferase (GGTA1) - CMP-Neu5Ac hydroxylase Expression of various human immune organizer in Pigs
- 67. Primary fetal fibroblast Genetic Modification Nuclear Transfer Slow Inefficient Transgenesis Gene targeting by Homologous recombination/ AAV vector ZFN/TALEN (i.e. Cloning) Low efficiency Laborious Abnormal development Transfer Nuclues of Genetically Modified cell to Unfertillized / enuclated oocyte Traditional Way of Genetic Modifications in Pig
- 68. CRISPR/Cas9 Offers Much Faster Way.. sgRNA + Donor DNA MicroInjections Embryo Transfer
- 70. Positive selection of gene knockout for resistance to the BRAF protein kinase inhibitor Shalem et al., Science 2014
- 71. Negative Screening Lander et al., Science 2014
- 72. dCas9-mediated Endogenous Gene Activations Cell Res. 2013 Double Mutant of Cas9 Inactive for cleavage Tandem Transactivation Domain Position of sgRNA
- 73. dCas9-mediated Gene expression interference Lim et al., Cell 2013
- 74. Therapeutic Potential of CRISPR/Cas9 CCR5 HIV receptor targeting by ZFN http://www.sangamo.com/pipeline/sb-728.html
- 75. Editas genomics was found late 2013 Zhang + Church + Doudna http://www.editas.com
- 76. Mutation Corrections Cataract (백내장) in Model Organism Wu et al., Cell Stem Cell, 2013 Repair of Dominant Negative Heterozygote Using WT allele Repair of Dominant Negative Heterozygote Using oligonucleotide
- 77. Functional Repair of CTFR by CRISPR/Cas9 in Intestinal Stem Cell Organoids of Cystic Fibrosis Patients Schwank et al., Cell Stem Cell 2013 Delta F508 : Most common CTFR mutation : resulting abnormal channel proteins
- 78. Genome Editing in Adult Mouse - Mouse model of hereditary tyrosinemia type I - Caused by mutation on fumarylacetoacetate hydrolase (Exon skipping)
- 80. Correction of Mutations in Zygote stages of Human? We have more knowledge and techniques on Human Embryo than Monkey‟s
- 81. Assisted Reproduction Technology is common In 2012, 176,275 ART Cycle (In vitro fertillization) were performed and 65,179 live born infants Over 1% of all infants born in the United States are conceived using ART ICSI (intracytoplasmic sperm injection) was involved in 30-40% of cases
- 82. Most infertility clinics have ability to carry out ICSI
- 84. Validation of off-site mutations by PGD-NGS? 8-Cell Embryo Karyotyping Preimplamantation Genetic Diagonosis (PGD) PCR-Seqencing Aneuploidy Mutation
- 85. Genome Sequencing from single oocyte is now possible Cell 2014
- 86. 1-Cell Embryo (Zygote) sgRNAs Cas9 Donor DNA Injection 3 Days PGD-NGS Genotyping (Fast turnaround required) 8-Cell Embryo Blastocyst with Desired Modification Without off-site mutaton Blastocyst witout Modification or With off-site mutaton Embryo Transfer Or Storage in liquid N2 Potential Workflow for ‘GMO’ human? 5 Days
- 87. Ethical Concerns - Regulations - Safety - Ethical concerns (GMO Human?) - 생명윤리및 안전에 관한 법률 Mad Scientist aka “Frankenstein builder” No relation with http://madscientist.wordpress.com
- 88. BGI invested significant resources on PGD screening http://www.genomics.cn/en/navigation/show_navigation?nid=5687
- 89. They are also trying to sequence a million people‟s genome For what?
- 91. “Rising of „designer babies‟ industry?” “성형외과 지고 성형산부인과 뜬다?” Welcome To the Brave New World. “Designer Baby” Patent issued to 23andMe.com US. 8,620,594 B2
- 92. Current Pitfall of CRISPR/Cas9 - Off-target effects -Cas9 recognition is mainly rely on ~15bp upstream of PAM
- 93. Although Off-target effect and toxicity of CRISPR is much lower than those of ZFN.. Fuji et al., NAR 2013
- 94. How to avoid off-target effects? - Optimization of Injection conditions (less cas9/sgRNA) - Bioinformatics : Find a sgRNA target for less off-targets “CRISPR Design” (http://crispr.mit.edu)
- 95. Double-Nicking System - Using Cas9 Nickase (Can cleave only single strand of DNA) Ran et al., Cell 2013 - Reduces off-target mutagnesis by 50-1,000 fold - Efficient indel / HDR as similar with wt Cas9 - More restriction in cleavage site
- 96. Sequence requirement of Cas9 Streptococcus pyrogenes Cas9 5’-NNNNNNNNNNNN-NGG-3’ Neisseria meningitidis Cas9 5’-NNNNNNNNNNN-NNNNGATT-3’ NmCas9 can gene distruptions In Human ES Cells Hou, Thomson JA PNAS 2013 Streptococcus thermophillus 5’-NNNNNNNNNNNNNN-NNAGAA-3’ Treponema denticola 5‟-NNNNNNNNNNNNNN-NAAAAC-3‟ Screening of novel Cas9? With different PAM specifity?
- 97. Engineering of Cas9 Now structure of Cas9-sgRNA is in our hands, it is time to engineer it - PAM Specificity? - Removal of nonessential part (spCas9 is too big in some vector system) - Efficient fusion with other functional domains (Epigenetics?)
- 98. Roles of other Cas proteins and possible applications We do not understand exact functional roles of all of Cas proteins Some of Cas proteins may enhance Genome engineering efficiency further
- 99. Delivery of Cas9/sgRNA More efficient delivery method would be crucial for in vivo application Viral vector? Plasmid? Ribonucleoprotein complex? Delivery without transfection agent?
- 101. “Secret Lab of a Mad Scientist” http://madscientist.wordpress.com “Frankenstein is not yet ready” 동물바이오 신약장기개발사업단 http://www.cabx.kr
- 102. Thanks for your attention!