Genome editing with the CRISPR-Cas9 system has become one of the major tools in modern biotechnology. This slide share discusses the fundamentals in a simple, easy to understand format.

1. GENOME EDITING II
Exploiting the CRISPR/CAS system.

2. Introduction
Genome editing technologies are constantly being upgraded to
achieve greater levels of precision and accuracy. The Clustered
Regularly Interspaced Short Palindromic Repeats (CRISPR)/CAS
system is based on the innate immune systems extant in
Prokaryotes and Archaea.
This system has now been analyzed and the key components
have been engineered to carry out genome editing.
The system in based on an enzyme (CAS) which has been
mutated to nick a single strand of DNA and introduce mutations
which disrupt the open reading frame of a specific gene.
The key elements are a crRNA, tracrRNA and the Cas9 Nuclease.

3. tracrRNAcrRNA
Target DNA
Cas9
Schematic representation: the tracrRNA binds to Cas9 and the
crRNA binds to the tracrRNA. This complex then binds to DNA at the
target site where Cas9 performs its function.

4. Objectives
1. Introduce the concept of innate immunity in
microbes.
2. Introduce the concept of the CAS enzyme.
3. Reinforce the concept of genome editing using
the CRISPR/CAS system by designing a genome
editing experiment for gene deletion in plants.

5. Learning Outcomes
Upon completion of this module the participants
should demonstrate the ability to:
1. Describe the role of the CRISPR/CAS system in
innate immunity.
2. Describe the process of engineering of the CAS
enzyme for application as a genome editing
tool.
3. Design an experiment to engineer the genome
using the CRISPR/CAS system.

6. THE PRINCIPLE
This section will introduce you to the CRISPR/CAS system.

7. How does the bacterialimmunefunction?
• Step 1: A foreign DNA molecule invades a bacterial cell, it is
digested by the enzyme CAS I.
• Step 2: Fragments of the foreign DNA are inserted within
CRISPR sites within the genome via recombination.
• Step 3: When the bacterial cell is invaded by a similar DNA
molecules, it responds by transcribing the CRISPR array.
• Step 4: The RNA transcript is processed by restriction at the
CRISPR spacer elements.
• Step 5: The individual RNA fragments are termed as crRNA.
They combine with tracrRNA by base pairing.
• Step 6: The crRNA-tracrRNA complex binds to Cas 9.
• Step 7: This complex binds to the invading DNA and restricts
the DNA adjacent to a Protospacer Adjacent Motif (PAM).

8. Step 1: Invasionand digestionby CAS I
Foreign DNA is digested by restriction endonuclease CAS I which
is present in the cytosol. This results in short fragments of the
invading DNA.

9. Step 2: Recombination(Insertion)
• The foreign DNA fragments recombine with the host genome
at the sites within the CRISPR array. A series of motifs of
foreign DNA provide evidence of periodic invasion by foreign
DNA. These can consist of DNA fragments from Phage DNA or
Plasmid DNA.

10. Step 3: Activationby invadingDNA
When foreign DNA is introduced into the bacterial cell during a
subsequent invasion, the bacterium responds by transcribing
the CRISPR elements. This is performed by the enzyme CAS II.
CAS
II

11. Step 4: Processingof RNAtranscriptsby CasII
The RNA fragments are processed by the restriction
endonuclease CAS III which cleaves individual RNA fragments at
the CRISPR sites. This results in individual crRNA transcripts.
CAS III

12. Step 5: Binding of crRNAto tracrRNA
The crRNA (red) which represents invasive DNA binds to
tracrRNA (blue) via simple base pairing. This tracrRNA is a
component of the host immune system and will only bind to the
Cas9 enzyme which is specific to the host.

13. Step 6: Targeted bindingto Cas9
Both the strands bind to the Cas9 endonuclease. This is made
possible by the tracrRNA which contains a specific motif that is
recognized by Cas9.

14. Step 7: Targeted Bindingto DNA
The Cas9-cRNA complex then binds to the invasive DNA at a site
containing a Protospacer Adjacent Motif (PAM). This site
differentiates self from non-self. Cas9 will only digest DNA which
contains the PAM site.
PAM site

15. Step 8: Targeted Degradationof DNA
How does the homing Endonuclease CAS9 differentiate self
DNA (genomic) from non-self (invasive) DNA?
Cas9 scans DNA for a specific sequence which is denoted
as a PROTOSPACER ADJACENT MOTIF or PAM. It will only
cleave the DNA at a site adjacent to the PAM motif. In
order for the invasive DNA to be cleaved it must contain a
PAM motif at the 5’ end of the target DNA sequence.

16. THE COMPONENTS

17. The Components of the System
1. The enzyme CAS 9.
2. The tracrRNA.
3. The crRNA.
4. The Protospacer Adjacent Motif.

18. The EnzymeCAS 9: Activesites
The Cas9 nuclease has two functional domains: RuvC and HNH,
each cutting a different DNA strand. When both of these
domains are active, the Cas9 causes double strand breaks (DSBs)
in the genomic DNA.
RuvC
HNH
tracrRNA binding

19. VersionI: CAS 9 (-RuvC)
Mutation of the RuvC domain results in a CAS 9 enzyme which
will only cleave one strand of the DNA.
HNH
tracrRNA binding

20. VersionII:CAS 9 (-HNH)
Mutation of the HNH domain results in a CAS 9 enzyme which
will only cleave one strand of the DNA.
RuvC
tracrRNA binding

21. VersionIII:DeadCAS 9 (dcas 9)
Mutating both the domains (RuvC) and (HNH) results in an
Endonuclease which retains the ability to bind to DNA but has
lost the ability to restrict DNA. This is called dead CAS.
tracrRNA binding

22. VersionIII:DeadCAS 9 (dcas 9)
Dead CAS9 can be applied to block the expression of specific
genes by binding to the specific regions of the genome. This
specificity is determined by the guide or gRNA sequence.
Dead Cas9

23. tracrRNA
The tracrRNA is a component of the host immune system. Each
species has a unique tracrRNA which will only bind to the host
specific Cas9. This means that a that a tracrRNA will remain
inactive until it encounters it matching Cas9.

24. crRNA
The crRNA consists of two domains. The first domain located at
the 3’ end combines with the 5’ terminal region of tracrRNA by
Watson-Crick base pairing. The second domain which is located
at the 5’ end is target specific and can be engineered to base
pair with the target DNA region.

25. Protospacer Adjacent Motif
The Cas9-tracrRNA-crRNA complex will only bind and cleave a
region of the DNA which is adjacent to a Protospacer Adjacent
Motif or PAM. This motif recognition sequence is unique to each
Cas9 enzyme.

26. PAM Sequences
For Cas9 to successfully bind to DNA, the target sequence in the
genomic DNA must be complementary to the gRNA sequence
and must be immediately followed by the correct protospacer
adjacent motif or PAM sequence. The PAM sequence is present
in the DNA target sequence but not in the crRNA sequence. Any
DNA sequence with the correct target sequence followed by the
PAM sequence will be bound by Cas9.

27. Compatibility
The PAM sequence varies by the species of the bacteria
from which the Cas9 was derived. The most widely used
Type II CRISPR system is derived from S. pyogenes and the
PAM sequence is NGG located on the immediate 3’ end of
the gRNA recognition sequence. The PAM sequences of
other Type II CRISPR systems from different bacterial
species are listed in the Table on the next slide. It is
important to note that the components (gRNA, Cas9)
derived from different bacteria will not function together.
Example: S. pyogenes (SP) derived gRNA will not function
with a N. meningitidis (NM) derived Cas9.
(Note: gRNA refers to the crRNA-tracrRNA complex)

28. PAM Sequences
Species PAM Sequence
Streptococcus pyogenes (SP) NGG
Neisseria meningitidis (NM) NNNNGATT
Streptococcus thermophilus (ST) NNAGAA
Treponemadenticola (TD) NAAAAC

29. NHEJ and HDR
The binding of the gRNA/Cas9 complex localizes the Cas9 to the
genomic target sequence so that the wild-type Cas9 can cut
both strands of DNA causing a Double Strand Break (DSB). Cas9
will cut 3-4 nucleotides upstream of the PAM sequence. A DSB
can be repaired through one of two general repair pathways:
(1) the Non-Homologous End Joining (NHEJ) DNA repair pathway
(2) the Homology Directed Repair (HDR) pathway.
The NHEJ repair pathway often results in inserts/deletions
(InDels) at the DSB site that can lead to frameshifts and/or
premature stop codons, effectively disrupting the open reading
frame (ORF) of the targeted gene

30. Non Homologous End Joining
Image source: ADDGENE Crispr/CAS system

31. Homology Directed Repair
The HDR pathway requires the presence of a repair template, which is
used to fix the DSB. HDR faithfully copies the sequence of the repair
template to the cut target sequence. Specific nucleotide changes can be
introduced into a targeted gene by the use of HDR with a repair template.

32. ENGINEERING THE SYSTEM

33. Engineering CRISPR /CAS
The Clustered Regularly Interspaced Short Palindromic
Repeats (CRISPR) Type II system is currently the most
commonly used RNA-Guided Endonuclease technology for
genome engineering. The enzyme CAS9 and the tracrRNA
are not found in most eukaryotes and model organisms. In
order to leverage the CRISPR/CAS system, the enzyme
CAS9 must be co-expressed in host cells along with the
compatible tracrRNA and engineered crRNA. Genetic
engineering of the system requires the development of a
guide RNA (gRNA) which is essentially a hybrid of the
tracrRNA and crRNA.

34. Principle
Gene
Expressing
Cas9
Gene that
transcribes
the gRNA
Cloning site for
introduction of the
target specific RNA
The engineered CRISPR /CAS system consists of a plasmid which expressed
the gene for the enzyme Cas9 and the compatible gRNA which is a fusion of
the tracrRNA and site specific RNA. The plasmid is transfected into the target
cells.

35. Engineering the crRNA
5’ – ATCGTCTAGGATTCTGGATCTGTAATGTAAGGCTGTAGCCCTGA – 3’
The Target DNA sequence with the PAM motif indicated in green.
5’ –TAAGACCTAGACATTAC-3’
The engineered crRNA sequence which has
been designed to be site specific.

36. Engineering gRNA
5’ – ATCGTCTAGGATTCTGGATCTGTAATGTAAGGCTGTAGCCCTGA – 3’
The Target DNA sequence with the PAM motif indicated in green.
5’ –TAAGACCTAGACATTAC-
The engineered gRNA sequence comrpises
the crRNA and tracrRNA
CATGCTGATACGTAAGAATAG
This is the
tracrRNA
domain
specific to
Cas9

37. Experimental Design
Step 1: Identify the target gene.
Step 2: Determine if the target gene has an adjacent PAM.
Step 3: Amplify the target gene using PCR.
Step 4: Ligate the gene onto the CRISPR/CAS plasmid vector.
Step 5: Transform the vector into cell lines.
Step 6: Validate gene deletion using PCR.

38. Step 1: Identify the target gene
5’TTGATCTGATGTAGTTGATTGTAGTTGTCTGATACTGACTGATCAGTA
CTTGATCGTTATTGCCGCCGCATGTCATGGACTTAAGCTT – 3’

39. Step 2: Identify the PAM
5’TTGATCTGATGTAGTTGATTGTAGTTGTCTGATACTGACTGATCAGTA
CTTGATCGTTATTGCCGGCCGCATGTCATGGACTTAAGCTT – 3’

40. Step 3: Amplify the target gene usingPCR
5’TTGATCTGATGTAGTTGATTGTAGTTGTCTGATACTGACTGATCAGTA
CTTGATCGTTATTGCCGGCCGCATGTCATGGACTTAAGCTT – 3’
The primers have to be designed so as to flank the region directly
adjacent to the PAM. The PAM should not be included within the
region being amplified.

41. Step4:Ligatethegeneontotheplasmidvector
The CRISPR/CAS vectors are plasmids which are designed to
express the enzyme Cas9 and the target gRNA transcript in the
host cell. The promoter must be host specific.
This gene will express the Cas9
enzyme. The promoter (green)
is host specific.
This gene will transcribe
the gRNA.

42. Step 5: Transform into plant cells.

43. Getting around GMO.
The expression of Cas9 is transient. This has legal implications as
far as Genetically Modified Organisms are concerned. Current
GMO legislation targets organisms which have been genetically
modified to carry traits which confer a fitness advantage.
Gene deletions made using the CRISPR/CAS system will be
undetectable as the transient expression of the enzyme Cas9
and the associated gRNA will not be detectable after successive
cell divisions.
This has changed the GMO landscape as genetic modifications
will be undetectable using conventional diagnostic methods.

44. Alternative Applications of Cas9
• Purified Cas9 protein and in vitro transcribed sgRNA can be
microinjected into fertilized zygotes for rapid generation of
transgenic animal models.
• Cas9 coupled to fluorescent reporters facilitates live
imaging of DNA loci for illuminating the dynamics of
genome architecture.
• Catalytically dead Cas9 (dCas9) can be converted into a
general DNA-binding domain and fused to functional
effectors such as transcriptional activators or epigenetic
enzymes. The modularity of targeting and flexible choice
of functional domains enable rapid expansion of the
Cas9 toolbox.

45. APPENDIX

46. A brief history of Genome Editing.