This document discusses the process of transcription from DNA to RNA. It begins with an overview of transcription in prokaryotes and eukaryotes. In prokaryotes, RNA polymerase binds to promoter sequences and transcribes DNA into RNA. Eukaryotes have three RNA polymerases that recognize different promoters. The document then covers the stages of transcription including initiation, elongation, and termination. It describes the requirements for transcription including the DNA template, RNA polymerase, and ribonucleotide substrates. Differences between DNA and RNA as well as between prokaryotic and eukaryotic transcription are also summarized.

1. How Cells
Read the
Genome:
From
DNA to
Protein

2. Transcription
• Open DNA at promoter
• Make RNA
– 5’-> 3’
– transcription bubble
• Moves along gene
– Prevent DNA knotting
• DNA topo-isomerases

3. Differences between DNA and RNA
RNA DNA
1. Mainly seen in cytoplasm Mostly inside nucleus
2. Usually 100-5000 bases Millions of base pairs
3. Generally single stranded Double stranded
4. Sugar is ribose Sugar is deoxyribose
5. Purines: Adenine, guanine
Pyrimidines : cytosine, uracil
Adenine, guanine
Cytosine, thymine
6. Guanine content is not equal to
cytosine and adenine is not equal to
uracil
Guanine is equal to cytosine and
adenine id equal to thymine
7. Easily destroyed by alkali Alkali resistant

4. Principal Types of RNAs Produced in Cells

5. Introduction
Definition:
• Transcription is a process in which ribonucleic acid (RNA) is synthesized
from DNA.
Site:
• In prokaryotic cells: ill-defined nuclear zone called the nucleoid whereas
In eukaryotic cells : well defined nucleus (transcription of nuclear DNA) or
mitochondria (transcription of mitochondrial DNA).
Template and Coding Strands:
• In transcription, one of the two strands of DNA serves as a template (non-
coding strand or antisense strand) and produces working copies of RNA
molecules.
• The other DNA strand which does not participate in transcription is
referred to as coding strand or sense strand or non-template strand.
(Coding strand commonly used since with the exception of T for U,
primary mRNA contains codons

6. Transcription in Prokaryotes
• Polymerization catalyzed by
RNA polymerase
– Can initiate synthesis
– Uses NTPs
– Requires a template
– Unwinds and rewinds DNA
• 4 stages
– Recognition and binding
– Initiation
– Elongation
– Termination and release

7. Transcription is selective
• The entire molecule of DNA is not expressed in
transcription.
• Transcription can take place at any time but only
certain selected regions of the DNA are copied. This
is like taking Xerox copy of particular page of the
book.
• So, the genetic information in DNA is transcribed
(copied) to the messenger RNA (mRNA).

8. SIMILARITY AND DIFFERENTIATION BETWEEN
REPLICATION AND TRANSCRIPTION
Similarity:
1. They involve the general steps initiation, elongation and termination.
2. Synthesis occurs in the 5’ → 3’ direction.
3. Follows Watson-Crick base pairing rules.
Differentiation:
1. Ribonucleotides are used in RNA synthesis rather than
deoxyribonucleotides.
2. Uracil replaces thymine as the complementary base pair for adenine in RNA
synthesis.
3. A primer is not required in RNA synthesis.
4. Only a small portion of the genome is transcribed into RNA, whereas the
entire genome must be copied during DNA replication.
5. RNA polymerase lacks proofreading function during RNA transcription.
6. A single strand of DNA acts as a template for synthesis of particular RNA
molecules.

9. BASIC REQUIREMENTS FOR RNA SYNTHESIS:
1. DNA template
• A single strand of DNA acts as a template to direct the formation of
complementary RNA transcript.
• The strand that is transcribed to RNA molecule is referred to as the template
strand of the DNA.
• The other strand is referred to as the coding strand of the gene.
2. Substrate
• The substrates for RNA synthesis are the four ribonucleotide triphosphates:
I. rATP
II. rGTP
III. rCTP
IV. rUTP
3. Enzyme
• DNA dependent RNA polymerase, called RNA polymerase (RNAP), is
responsible for the synthesis of RNA, 5’→3’ direction, using DNA template.

10. RNA Polymerase
• Prokaryotes have single RNA
polymerase (RNAP) that
transcribes all three RNAs, i.e.
mRNA, rRNA and tRNA.
• RNA polymerase requires Mg2+ as
well as Zn2+ for its activity
• 5 subunits, 449 kd (~1/2 size of
DNA pol III)
• Core enzyme
– 2  subunits---hold enzyme
together
– --- links nucleotides together
– ’---binds templates
• ---recognition
• Holoenzyme= Core + sigma

11. ‘holoenzyme’
β β’α2
KD ~ 10-9 M
β β’α2 +
‘core’
}
Can begin transcription
on promoters and can
elongate
}
Can elongate but cannot
begin transcription at
promoters
σ factor is required for bacterial RNA polymerase to
initiate transcription on promoters
The discovery of initiation factors
σ
σ

12. Template and Coding Strands
5’–TCAGCTCGCTGCTAATGGCC–3’
3’–AGTCGAGCGACGATTACCGG–5’
5’–UCAGCUCGCUGCUAAUGGCC–3’
Sense (+) strand
DNA coding strand
Non-template strand
DNA template strand
antisense (-) strand
RNA transcript
transcription

13. STAGES OF TRANSCRIPTION
• The RNA synthesis involves:
1. Recognition
2. Initiation
3. Elongation
4. Termination

14. Recognition
• Template strand
• Coding strand
• Promoters
– Binding sites for RNA pol on template strand
– ~40 bp of specific sequences with a specific order and distance
between them.
• Core promoter elements for E. coli
– -10 box (Pribnow box)
– -35 box
• Numbers refer to distance from transcription start site

15. Typical Prokaryote Promoter
• Pribnow box located at –10 (6-7bp)
• -35 sequence ~(6bp)
• Consensus sequences: Strongest promoters
match consensus
– Up mutation: mutation that makes promoter
more like consensus
– Down Mutation: virtually any mutation that
alters a match with the consensus
Consensus sequences

16. Initiation of RNA chains
 Binding of RNA polymerase holoenzyme to a
promoter region in DNA ( promoter region).
 Localized unwinding of about 10 nucleotide pairs of
the two strands of DNA by RNA polymerase to
provide a single-stranded template.
 Formation of phosphodiester bonds between the
first few ribonucleotides in the nascent RNA chain.
 A purine ribonucleotide (GTP or ATP) is usually the
first to be polymerized into the RNA molecule.

17. A Typical E. coli Promoter
© John Wiley & Sons, Inc.
..,-2,-1,+1,+2,..

18. Elongation
• By the time 10 nucleotide have been
added, Sigma factor is released.
• Re- and Un-winding activities results in
supercoils. The problem of supercoils
is overcome by topoisomerases.
• -- RNA polymerase walk (literally) on
the DNA 5’ to 3’.
• -- RNA polymerase utilizes
ribonucleotide triphosphates (ATP,
GTP, CTP and UTP) for growing RNA
chain.
• RNA polymerase binds both DNA
template and growing RNA chain.

19. Termination Signals in E. coli
• Rho-dependent terminators—require a
protein factor ()
• Rho-independent terminators—do not require


20. Rho-independent terminators—do not require 
intrinsic termination)

21. • RNA transcription
stops
• --when the newly
synthesized RNA
molecule forms a G-C-
rich hairpin loop followed
by a run of As.
• --Create a mechanical
stress
• --Pulls the poly-U
transcript out of the
active site of the RNA
polymerase.
• --A-U has very weak
interaction

22. Rho-dependent terminators—require 
extrinsic termination)
• Rho-dependent terminators (non-intrinsic) —require a
protein factor () and rut site
• Rut proteins bind specific RNA sequences (>>Cs and
<<<Gs)
• ρ factor, binds to the growing RNA (and not to RNA
polymerase) or weakly to DNA
• In the bound state it acts as ATPase and terminates
transcription and releases RNA.
• Also responsible for the dissociation of RNA
polymerase from DNA
Rho utilization (rut)

23. Quick review
• RNA synthesis occurs in three stages: (1) initiation,
(2) elongation, and (3) termination.
• RNA polymerases—the enzymes that catalyze
transcription—are complex multimeric proteins.
• The covalent extension of RNA chains occurs within
locally unwound segments of DNA.
• Chain elongation stops when RNA polymerase
encounters a transcription-termination signal.
• Transcription, translocation, and degradation of
mRNA molecules often occur simultaneously in
prokaryotes.

25. Transcription in eukaryotes
Introduction:
• More complicated process than transcription in prokaryotes.
• Three different polymerases.
• Each polymerase recognizes a distinct promoter.
• Involves separate polymerase for the synthesis of rRNA, tRNA
and mRNA.
• Eukaryotic RNA polymerase (RNAP) does not include a
removable sigma (σ) factor instead, a number of accessory
proteins identify promoters and recruit RNAP to the
transcription start site.

26. Eukaryotic RNA Polymerase
RNA Pol. Location Products Alpha-
Amanitin
Promoter
I Nucleolus Large rRNAs
(28S, 18S,
5.8S)
Insensitive Bipartite
promoter
II Nucleus Pre-mRNA,
some snRNAs
Highly
sensitive
Upstream
III Nucleus tRNA, small
rRNA (5S),
snRNA
Intermediate
sensitivity
Internal
promoter and
terminator

27. Promoter sites
• A sequence of DNA bases identical to pribnow box of prokaryotes
is identified.
• This sequence (TATAAA), known as Hogenes box (or TATA box), is
located on the left about 25 nucleotides away (upstream) from the
starting site of mRNA synthesis.
• Also exists another site of recognition known as CAAT box
(GGCCAATCT); between 70 and 80 nucleotides upstream from the
start of transcription.
• One of these two sites helps RNA polymerase II to recognize the
requisite sequence on DNA for transcription.

28. Enhancers
• Regulate gene expression.
• Can increase gene expression by about 100 fold.
• Depending upon whether they increase or decrease
the initiation rate of transcription, they are called
enhancers or repressors.
• It is believed that the chromatin forms a loop that
allows the promoter and enhancer to be close
together in space to facilitate transcription.

29. PROCESS TRANSCRIPTION
• The process of transcription by RNAP II can be
described in terms of following phases.
1. Assembly
2. Initiation
3. Elongation
4. Termination

30. ASSEMBLY
• The TATA box is the major assembly point for the
proteins of the preinitiation complexes of RNAP-
II.
• The DNA is unwound at the initiator sequence
(Inr) and the transcription start site is present
within or very near this sequence.

31. Initiation of transcription in eukaryotes
• First, the TATA box is recognized by TBP (TATA binding protein).
• Instead of the sigma factor, SL1 factor ensures that RNAP locates the start
point.
• In humans about 105 transcription initiation sites are available.
• The sequential assembly of TATA binding protein (TBP) bound to TFII A and
transcription factors, TFII B, TFII F plus RNAP II, TFII E and TFII H results in a
closed complex.
• Within the complex the DNA is unwound at the initiator (Inr) region by the
helicase activity of TFII H and TFII F, creating an open complex.
• The carboxyl terminal domain (CTD) of the largest subunit of RNAPII is
phosphorylated by TFII H, and the RNAP II then escapes the promoter and
begins transcription.

33. Elongation of transcription in eukaryotes
• Elongation is accompanied by the release of
many transcription factors and is also enhanced
by elongation factors.
• The function of all elongation factors is to
suppress the pausing or arrest of transcription by
the RNAPII-TFIIF complex.

34. Termination of transcription in eukaryotes
• Once the RNA transcript is completed,
transcription is terminated RNAPII is
dephosphorylated and recycled, ready to
initiate another transcript.
• The primary mRNA transcript produced by RNA
polymerase II in eukaryotes is often referred to
as heterogeneous nuclear RNA (hnRNA).
• This is then processed to produce mRNA
needed for protein synthesis.

36. POST-TRANSCRIPTIONAL MODIFICATIONS
• The RNAs produced during
transcription are called
primary transcripts.
• They undergo many
alterations – terminal base
additions, base modifications,
splicing etc., which are
collectively referred to as post-
transcriptional modifications.
• This process is required to
convert the RNAs into the
active forms.
• A group of enzymes, namely
ribonucleases, are responsible
for the processing of tRNAs
and rRNAs of both prokaryotes
and eukaryotes.
SIGNIFICANCE OF POST-
TRANSCRIPTIONAL
MODIFICATION
• Post transcriptional
modification of RNA is
required for
1. Increased stability of RNA
and
2. Regulation of gene
expression
3. To convert RNAs into active
forms

37. PROCESSING OF mRNA
• Post-transcriptional modifications of mRNA occur in the nucleus.
• Precursor form of mRNA is called as heterogeneous nuclear RNA (hnRNA).
• Processing of mRNA from hnRNA includes:
1. 5’ Capping
• The 5’ end of mRNA is capped with 7-methylguanosine by an unusual
5’→ 5’ triphosphate linkage.
• S-Adenosyl methionine is the donor of methyl group.
• This cap is required for increased stability of mRNA due to protection
against digestion of ribonucleosome by exonuclease.
2. Poly-A tail
• Tailing is addition of 20-250 residues of adenylate (poly-A tail) at the 3’
end.
• The reaction is catalyzed by polyadenylate polymerase.
• It is added to stabilize mRNA.
3. Removal of extra RNA at 3’ end
• There are extra-nucleotides at 3’ end of mRNA in the primary transcript.
• These extra-nucleotides are cleaved by ribonuclease at 3’ end.

38. 4. Splicing
• Introns are the intervening nucleotide sequences in mRNA which do not code for
proteins.
• Exons of mRNA possesses genetic code and are responsible for protein synthesis.
• The removal of introns is promoted by small nuclear ribonucleoprotein particles (snRNA).
• The spliceosome is used to represent the snRNP association with hnRNA at the exon-
intron junction.
• The processing of hnRNA molecules becomes a site for the regulation of gene expression.
• The mature RNA then enters the cytosol to perform to perform its function (translation).
Faulty splicing may result in diseases.
• A good example is one type of β-thalassemia.
• β-thalassemia is a genetic disease characterized by impaired synthesis of β-globin protein.
• This leads to impaired production of hemoglobin and anemia.
• The β globin gene has three exons and two introns.
• The introns contain a G-T sequence that is essential for the correct splicing of the RNA and
the formation of normal mature β globin mRNA.
• In β-thalassemia, the G-T sequence is mutated to A-T sequence resulting in defective RNA
splicing.
• The defective β globin mRNA cannot be utilized for translation.

40. PROCESSING OF PRECURSOR tRNA
• The four different events of post-transcriptional processing of pre-tRNA
molecules are
1. Removal of extra RNA
• These are extra nucleotides at 5’ end and 3’ end of tRNA in the primary
transcript. These extra nucleotides are cleaved by ribonuclease P at the 5’
end and ribonuclease D homologue in eukaryotes at 3’ end.
2. Removal of Introns from Anticodon Site
• Some pre tRNA molecules may have a short introns at the anticodon site.
• These are removed by splicing but mechanisms are different from pre mRNA
splicing.
3. Addition of CCA sequence
• The sequence CCA is added to the 3’ end of all the t RNAs.
• The free OH group present at the 3’ end is required for the formation of amino
acyl t RNA during protein synthesis.
4. Modifications of Bases
• Several nucleotides in pre t RNA molecules undergo modification.
• These include formation of unusual bases such as pseudo-uridine,
dihydrouracil, thymine and methylated bases.

41. PROCESSING OF PRE-RIBOSOMAL RNA
1. 45 S Precursor RNA
• Most of the eukaryote have more than 100 copies of rRNA genes because of
the requirement for large number of ribosomes (containing rRNA) for
protein synthesis.
• The genes of these three RNA are thus clustered together and tandemly
repeated with spacer sequences in between them.
• The cleavage of the 45 S rRNA results in the release of 18S, 5.8 S and 28 S
RNAs.
• Methylation of bases occurs before cleavage.
2. 5S RNA
• The 5S RNA is also present in multiple copies.
• 5s rRNA migrate to the nucleolus and does not undergo any processing.

43. INHIBITORS OF TRANSCRIPTION
• The synthesis of RNA is inhibited by certain antibiotics and toxins.
1. Rifampicin
• Rifampicin and streptovaricin bind with β subunit of the polymerase to block the
initiation of transcription.
• It is an antibiotic widely used for the treatment of tuberculosis and leprosy.
2. Actinomycin D
• This is also known as dactinomycin.
• It forms a complex with double stranded DNA and prevents the movement of core enzyme
and as a result inhibits the process of chain elongation.
• This was the first antibiotic used for the treatment of tumors.
3. Streptoglydigin
• It binds with the β subunit of prokaryotic polymerase and thus inhibits the elongation.
4. Heparin
• It is a polyanion that binds to the β’ subunit and inhibits transcription.
5. α-amanitin
• It is a toxin produced by mushroom, Amanita phalloides.
• Amanitin strongly inhibits RNA polymerase II, inhibiting specifically the biosynthesis of
mRNA.
6. Daunomycin
• It is an anthracyclin glycoside.
• The anthracyclin ring of daunomycin intercalates with double stranded DNA.
• It is used in the treatment of cancer.

44. REVERSE TRANSCRIPTION
DEFINITION
• Reverse transcription is the formation of DNA from RNA.
• The enzyme responsible for the reverse transcription is called
reverse transcriptase.
• It is a RNA dependent DNA polymerase.
REVERSE TRANSCRIPTION PROCESS
• In reverse transcription, the RNA is used to synthesize a new strand of
DNA by viral encoded reverse transcriptase (also called RNA dependent
DNA polymerase).
• The RNA component from the RNA-DNA hybrid is then hydrolyzed by a
specific RNA hydrolyzing enzyme, RNAase H.
• The DNA strand remained after the hydrolysis of RNA, is used as a
template to generate double stranded DNA.

47. SIGNIFICANCE
1. Tumor viruses, proto-oncogenes and oncogenes and development of
cancer
• A number of viruses contain genome containing an RNA molecule instead of
DNA.
• Examples are retroviruses such as HIV.
• The copy of DNA from viral DNA may be incorporated to host DNA.
• Thus, a new virus proteins are produced which can alter cellular function
including the malignant transformation of the cell (tumor production).
• Examples are protooncongenes and oncogenes derived from retroviruses.
2. Reverse transcription in genetic recombination through transposition
• Transposition refers to jumping of mobile DNA sequences (also called transposable
elements or transposons) from one place in the genome to another place in the
genome.
• One of the mechanisms of transposition involves transposable elements jumping
through the formation of RNA intermediates.
• Transposable elements replicate and move to other genomic sites by transcription
to RNA and subsequent reverse transcription of the RNA into a double stranded
DNA.

48. 3. Telomere replication
• The presence of telomere at the end of chromosome allows replication of DNA
to its full length.
• Impairment of telomere replication leads to loss of genetic information and
contributes to aging process.
• Reactivation of telomerase activity results in cell proliferation (cancer).
4. Uses of reverse transcriptase in molecular biotechnology
• Reverse transcriptase derived from RNA tumor viruses is used to synthesize
complementary DNA (cDNA) copies of mRNA templates.
• cDNA is used for cloning or reverse transcription-polymerase chain reaction.