Microsatellite are powerful DNA markers for quantifying genetic variations within & between populations of a species, also called as STR, SSR, VNTR. Tandemly repeated DNA sequences with the repeat/size of 1 – 6 bases repeated several times
A physical map of a chromosome or a genome that shows the physical locations of genes and other DNA sequences of interest. Physical maps are used to help scientists identify and isolate genes by positional cloning.
According to the ICSM (Intergovernmental Committee on Surveying and Mapping), there are five different types of maps: General Reference, Topographical, Thematic, Navigation Charts and Cadastral Maps and Plans.
A physical map of a chromosome or a genome that shows the physical locations of genes and other DNA sequences of interest. Physical maps are used to help scientists identify and isolate genes by positional cloning.
According to the ICSM (Intergovernmental Committee on Surveying and Mapping), there are five different types of maps: General Reference, Topographical, Thematic, Navigation Charts and Cadastral Maps and Plans.
A genetic marker is a gene or DNA sequence with a known location on a chromosome that can be used to identify individuals or species. It can be described as a variation (which may arise due to mutation or alteration in the genomic loci) that can be observed. A genetic marker may be a short DNA sequence, such as a sequence surrounding a single base-pair change (single nucleotide polymorphism, SNP), or a long one, like minisatellites.
Genotyping by Sequencing is a robust,fast and cheap approach for high throughput marker discovery.It has applications in crop improvement programs by enhancing identification of superior genotypes.
RAPD markers are decamer DNA fragments.
RAPD is a type of PCR reaction.
as the name suggest it is a fast method when compared to the traditional PCR medthod.
Molecular Marker and It's ApplicationsSuresh Antre
Molecular (DNA) markers are segments of DNA that can be detected through specific laboratory techniques. With the advent of marker-assisted selection (MAS), a new breeding tool is now available to make more accurate and useful selections in breeding populations.
Transcriptomics is the study of RNA, single-stranded nucleic acid, which was not separated from the DNA world until the central dogma was formulated by Francis Crick in 1958, i.e., the idea that genetic information is transcribed from DNA to RNA and then translated from RNA into protein.
STS stands for sequence tagged site which is short DNA sequence, generally between 100 and 500 bp in length, that is easily recognizable and occurs only once in the chromosome or genome being studied.
SNP (Single Nucleotide Polymorphic), SNP mapping, SNP profile, SNP types, SNP analysis by gel electropherosis and by mass spectrometry, SNP effects, single strand conformation polymorphism, SNP advantages and disadvantages and application of SNP profile in drug choice
A genetic marker is a gene or DNA sequence with a known location on a chromosome that can be used to identify individuals or species. It can be described as a variation (which may arise due to mutation or alteration in the genomic loci) that can be observed. A genetic marker may be a short DNA sequence, such as a sequence surrounding a single base-pair change (single nucleotide polymorphism, SNP), or a long one, like minisatellites.
Genotyping by Sequencing is a robust,fast and cheap approach for high throughput marker discovery.It has applications in crop improvement programs by enhancing identification of superior genotypes.
RAPD markers are decamer DNA fragments.
RAPD is a type of PCR reaction.
as the name suggest it is a fast method when compared to the traditional PCR medthod.
Molecular Marker and It's ApplicationsSuresh Antre
Molecular (DNA) markers are segments of DNA that can be detected through specific laboratory techniques. With the advent of marker-assisted selection (MAS), a new breeding tool is now available to make more accurate and useful selections in breeding populations.
Transcriptomics is the study of RNA, single-stranded nucleic acid, which was not separated from the DNA world until the central dogma was formulated by Francis Crick in 1958, i.e., the idea that genetic information is transcribed from DNA to RNA and then translated from RNA into protein.
STS stands for sequence tagged site which is short DNA sequence, generally between 100 and 500 bp in length, that is easily recognizable and occurs only once in the chromosome or genome being studied.
SNP (Single Nucleotide Polymorphic), SNP mapping, SNP profile, SNP types, SNP analysis by gel electropherosis and by mass spectrometry, SNP effects, single strand conformation polymorphism, SNP advantages and disadvantages and application of SNP profile in drug choice
PCR is a polymerase chain reaction in which target DNA gets amplified. There are various modifications to PCR reaction to increase sensitivity and specificity such as touchdown PCR, Real time PCR, Hot start PCR, RT-PCR, Colony PCR and asymmetric PCR.
An honest effort to present molecular marker in easiest way both informative and conceptual. Hybridization based (non-PCR) and PCR based markers are discussed to the point with suitable diagram.
I had done a two week internship in May 2014 at a laboratory in Strand Life Sciences Pvt. Ltd. The report summarises my work and my learning during the two week period. I have also included in my report the DNA sequence of a patient that I had analysed to check for mutations.
The yak is one of the most enduring symbols of the high Himalayas. Whether you visit Tibet, Bhutan, India or Nepal, you will inevitably find tourist places with yaks for picture clicking and ride.
As the largest animal on the Tibetan plateau and its surrounding regions, the yak is a “flagship species”, and indicates the health of the ecosystem within which it lives.
DNA sequence analysis of a uniform target gene like the mitochondrial cytochrome oxidase subunit I (COI) to enable species identification has been referred to as “DNA Barcoding”, by analogy with the Universal Product Code (UPC) system barcodes used to identify manufactured goods.
DNA barcoding has the potential to be a practical method for identification of the estimated 10 million species of eukaryotic life on earth.
Access and Benefit sharing from Genetic ResourcesKaran Veer Singh
Millions of people depend on biological (genetic) resources and traditional knowledge for their livelihoods. While the concept of an access and benefit sharing (ABS) regime is new, access to biological resources and transfer of associated traditional knowledge is centuries old.
Indian act on IPRs, CBD, Copyright Act, 1957
The Patents Act, 1970
The Geographical Indications of Goods (Registration and Protection) Act, 1999
The Trade Marks Act, 1999
The Designs Act, 2000
The Semiconductor Integrated Circuits Layout-Design Act, 2000
Protection of Plant Varieties and Farmers' Rights Act, 2001
Biological Diversity Act, 2002
Genome annotation, NGS sequence data, decoding sequence information, The genome contains all the biological information required to build and maintain any given living organism.
The quality of data is very important for various downstream analyses, such as sequence assembly, single nucleotide polymorphisms identification this ppt show parameters for
NGS Data quality check and Dataformat of top sequencing machine
RNA Sequence data analysis,Transcriptome sequencing, Sequencing steady state RNA in a sample is known as RNA-Seq. It is free of limitations such as prior knowledge about the organism is not required.
RNA-Seq is useful to unravel inaccessible complexities of transcriptomics such as finding novel transcripts and isoforms.
Data set produced is large and complex; interpretation is not straight forward.
Palestine last event orientationfvgnh .pptxRaedMohamed3
An EFL lesson about the current events in Palestine. It is intended to be for intermediate students who wish to increase their listening skills through a short lesson in power point.
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdfTechSoup
In this webinar you will learn how your organization can access TechSoup's wide variety of product discount and donation programs. From hardware to software, we'll give you a tour of the tools available to help your nonprofit with productivity, collaboration, financial management, donor tracking, security, and more.
Instructions for Submissions thorugh G- Classroom.pptxJheel Barad
This presentation provides a briefing on how to upload submissions and documents in Google Classroom. It was prepared as part of an orientation for new Sainik School in-service teacher trainees. As a training officer, my goal is to ensure that you are comfortable and proficient with this essential tool for managing assignments and fostering student engagement.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
2. Powerful DNA markers for quantifying genetic
variations within & between populations of a
species
Also called as STR, SSR, VNTR
Tandemly repeated DNA sequences with the
repeat/size of 1 – 6 bases repeated several
times
Highly polymorphic; can be analysed with the
help of PCR
Individual alleles at a locus differ in number
of tandem repeats of unit sequence owing to
gain of loss of one or more repeats and they
can be differentiated by electrophoresis
according to their size
3. Short Tandem Repeats (STRs)Short Tandem Repeats (STRs)
the repeat region is variable between samples while the
flanking regions where PCR primers bind are constant
7 repeats
8 repeats
AATG
Homozygote = both alleles are the same length
Heterozygote = alleles differ and can be resolved
from one another
5. Based on number of base pairs
1) Mono (e.g. CCCCCCCC or AAAAAA)
2) Di (e.g. CACACACACA)
3) Tri (e.g. CCA CCA CCA CCA)
4) Tetra (e.g. GATA GATA GATA GATA GATA GATA GATA)
Minisatellites: - (9 – 65 base pairs repeated from 2
to several hundred times)
CGCCATTGTAGCCAATCCGGGTGCGATTGCAT CGCCATTGT
AGCCAATCCGGGTGCGATTGCAT CGCCATTGTAGCCAATCCGGG
TGCGATTGCAT CGCCATTGTAGCCAATCCGGGTGCGATTGCAT
CGCCATTGTAGCCAATCCGGGTGCGATTGCAT
6. Microsatellites – PropertiesMicrosatellites – Properties
Co-dominant
Inherit in Mendelian Fashion
Polymorphic loci with allele number as high as 14 – 15
per locus
Mostly reported from non-coding region, hence can be
independent of selection
Flanking region is highly conserved in related species
Can be obtained from small amounts of tissues [STR
analysis can be done on less than one billionth of a
gram (a nanogram) of DNA (as in a single flake of
dandruff)]
PAGE separation; silver staining/automated genotyping
Abundant in the eukaryote genome (~103
to 105
loci
dispersed at 7 to 10100
kilobase pair (kb) intervals)
7.
8.
9. Microsatellites and Human DiseasesMicrosatellites and Human Diseases
Allele size variations in microsatellite loci in close
proximity (showing linkage disequilibrium) to the following
genes within the Human Major Histocompatibility Complex
(MHC) region
• IDDM (Insulin Dependent Diabetes Mellitus)
• Multiple Sclerosis (MS)
• Narcolepsy
• Uveitis
have been reported to cause genetic disorders; hence these
genetic disorders can be detected by screening the allele
sizes of the microsatellite loci (Type I markers) that are in
close proximity to these genes (Goldstein & Schlotterer,
2001)
10.
11. Some uses of DNA ProfilingSome uses of DNA Profiling
• Forensic work on crime scenesForensic work on crime scenes
• Parentage testingParentage testing
• Victim identification in mass disastersVictim identification in mass disasters
• Animal identification-Animal identification- e.g.e.g. racehorsesracehorses
• Conservation biology and population geneticConservation biology and population genetic
studiesstudies
• Bone marrow transplant monitoring - to checkBone marrow transplant monitoring - to check
that the transplanted marrow is still presentthat the transplanted marrow is still present
• Determination of maternal cell contaminationDetermination of maternal cell contamination
in chorionic villus sampling (used toin chorionic villus sampling (used to
investigate the possibility that a fetus has ainvestigate the possibility that a fetus has a
severe inherited disease)- is the tissue samplesevere inherited disease)- is the tissue sample
really fetal?really fetal?
12. Parentage Testing – Why?Parentage Testing – Why?
• Parentage - e.g. disputes over
who is the father of a child & is
thus responsible for child
support
• Determining whether twins are
identical or fraternal
• Immigration - establishing that
individuals are the true
children/parents/siblings in
cases of family reunification
13. Problems:Problems:
♣ Prior information of the genome is essential as
the primers are highly specific
♣ Stutter bands
♣ High sample size
♣ Mutation in primer binding sites and the region
between primers and repeats can create
problems (null alleles and wrong genotyping)
♣ Homoplasy
14. Protocol:Protocol:
• Extraction of DNA
• Primer designing – DNA/genomic libraries
•cross-priming
• PCR Amplification
• Manual Visualization of Microsatellites – PAGE
& Silver staining and genotyping or Automated
genotyping using fluorescent dyes
• Analysis of data & Interpretation of results
15. GUIDELINES FOR PCR PRIMER DESIGN
Sequence Specificity:
Complimentary to flanking regions of DNA
to be amplified
Primer Length:
Complex enough that there is no likelihood of
finding sequence other than target
Probability of 16 base sequence in a genome is 416
(Once in 4 billion)
Minimum length: 17
Ideal length range : 17-30 nucleotides
16. Primer orientation
• If both the forward and reverse primer sequences are
designed from the sequence data of coding strand of
the DNA (but not for microsatellites), then keep in
mind that the reverse primer has to match the
sequence of the non- coding strand.
5’---ATGGCTTAAGCGGGTATTGCTTAGAA ----3’
3’-- CGAATCTT ----5’
3’---TACCGAATTCGCCCATAACGAATCTT ----5’
5’---ATGGCTTAAG----- 3’
17. GUIDELINES FOR PCR PRIMER DESIGN
Base Composition:
• G≡C pair has 3 hydrogen bonds - Stronger
pairing - Need more heat than A=T pairs
for separation
• Ideal GC content : 35-60%
• Difference in GC content of 2 primers not
more than 5%
• More GC content leads to poor
denaturation even at 95o
C
18. GUIDELINES FOR PCR PRIMER DESIGN
Melting Temperature (Tm values)
Both primers should have similar Tm values.
Tm values of both primers be within 1- 4o
C and
Tm values should be in the range of 40-60o
C
19. GUIDELINES FOR PCR PRIMER DESIGN AND USE
Calculation of Annealing temperature :
* When using a primer the first time use an
annealing temperature 5o
C below melting
temperature (Tm ).
20. Guidelines for PCR Primer design and useGuidelines for PCR Primer design and use
Calculation of Annealing temperature :
• A simple formula for estimating the Tm .
Tm = 2o
C x (number of A & T residues) +
4o
C x (number of G & C residues).
Note: Applicable for primers of 15-25 bases
Example:
TGGCTTACGAATCGC 4 x (9) + 2 x (7) –5 = 45°C
Note: Optimal annealing temperature may differ from calculated values.
21. Specifications on complimentaritySpecifications on complimentarity
between sequences of primer pairsbetween sequences of primer pairs
Avoid complimentarity between the
primer pairs
Avoid complimentarity of two or three
bases at the 3’ ends of primer pairs to
reduce primer-dimer formation.
Primer dimer formation
5’ ATGCCTAGC5’ ATGCCTAGCTTCCGGATTTCCGGAT 3’3’
3’3’
AAGGCCTAAAGGCCTACATTTAGCCTAGT 5’CATTTAGCCTAGT 5’
22. Specifications on complimentaritySpecifications on complimentarity
between sequences of primer pairsbetween sequences of primer pairs
Avoid mismatches between the 3’ end of
the primer and the target-template
sequence.
Avoid complimentary sequences within a
primer.
23. Specifications on complimentaritySpecifications on complimentarity
between sequences of primer pairsbetween sequences of primer pairs
Avoid runs of 3 or more Gs &Cs at the 3’
end.
Avoid a 3’ end T. (Primers with a T at
the 3’ end have a greater tolerance for
mismatches).
Have GC-rich 3’ ends ( “GC clamp”) :
G≡Cs have 3 hydrogen bonds and bind more
strongly than A and T. Several G or C at the 3’
end (elongation end) of primer will make that
end more stable and can increase PCR yield .
25. Guidelines for degenerate - primer designGuidelines for degenerate - primer design
Primer sequence:Primer sequence:
Avoid degeneracy in the last 3 nucleotide at the 3’
end.
To increase primer-template binding efficiency, reduce
degeneracy by allowing some mismatches between the
primer and template, especially towards the 5’ end (but not
the 3’ end).
26. Guidelines for degenerate - primer designGuidelines for degenerate - primer design
Primer sequence:
Try to design primers with less than 4 fold degeneracy at
any given position.
Begin PCR with a primer concentration of 0.2 µM.
In case of poor PCR efficiency, increase primer concentr-
ation in increments of 0.25 µM until satisfactorily result
is obtained.
27. Concentration :Concentration :
*Spectrophotometric conversion of primers:
A260 unit ~ 20-30µg/ml. Use 0.1-0.5 µM of each
primer in PCR. For most applications, 0.2 µM is
sufficient.
Storage :Storage :
Lyophilized primers should be dissolved in a
small volume of distilled water or TE to make a
concentrated stock solution.
Prepare small aliquots of working solutions
containing 10pmol / µl to avoid repeated thawing
and freezing. Store all primer solution at –20o
C.
Primer quality can be checked on a denaturing
polyacrylamide gel: a single band should be seen.
28. Guidelines for determining number of PCR cycles.Guidelines for determining number of PCR cycles.
Amount of starting material Single
copy
targets
Number
of PCR
cycles
1-kb DNA
fragment
E.coli DNA Human DNA
0.01-0.11 fg 0.05-0.56 pg 36-360 pg 10-100 40-45
0.11-1.1 fg 0.56-5.56 pg 0.36-3.6 ng 100-1000 35-40
1.1-55 fg 5.56-278 pg 3.6-179 ng 1 x 103
-
5x104
30-35
<55 fg <278 pg <179 ng <5 x104
25-35
29. Softwares available on Internet for designing of primersSoftwares available on Internet for designing of primers
• http://www.genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi
• http://www.hgmp.mrc.ac.uk/
• http://biobase.dk/index.html
• http://bcf.drl.arizona.edu/gcg.html
• http://www.blocks.fhcrc.org/
• http://bioinformatics.weizman.ac.il/blocks/index.html
• http://alces.med.umn.edu/webprimers.html
• http://www.willamstone.com/
• http://doprimer.interactiva.de/
• http://dot.imgen.bcm.tmc.edu:9331/seq_util/seq_util.html
Commercially available computer softwares:
Primer 3; Primer Designer 1.0; Scientific software, 1990; Oligo,
(Rychlikand Rhodes, 1989) can be used for designing.
30.
31. MicrosatellitesMicrosatellites PCR reaction Mixture &PCR reaction Mixture &
ConcentrationConcentration
Volume perVolume per
reactionreaction
Double distilled waterDouble distilled water 18.018.0µµLL
AssayAssay buffer (10X; Genei, Bangalore, India)buffer (10X; Genei, Bangalore, India)
(100mM Tris, 500mM KCl, 0.1% gelatin, pH9)(100mM Tris, 500mM KCl, 0.1% gelatin, pH9)
(final conc. 1X)(final conc. 1X)
2.52.5µµLL
dNTPs (Genei, Bangalore, India) (200 mM)dNTPs (Genei, Bangalore, India) (200 mM) 2.02.0µµLL
Primer (forward & reverse working solution)Primer (forward & reverse working solution)
(total conc. ~ 10.0 pmoles in 25(total conc. ~ 10.0 pmoles in 25µµl of master mix)l of master mix)
0.50.5µµLL
MgClMgCl22 (1.5mM )(1.5mM ) 0.50.5 µµll
TaqTaq polymerase (Genei, Bangalore, India)polymerase (Genei, Bangalore, India)
(3Units/(3Units/ µµll))
0.50.5µµLL
Template DNA (25ng)Template DNA (25ng) 1.01.0µµLL
Total volumeTotal volume 25.025.0µµLL
34. Acrylamide (19:1 acrylamide
and bisacrylamide)
: 5mL
Double distilled water : 2mL
5 x TBE : 2mL
10% Ammonium persulphate : 70µL
TEMED : 3.5µL
10% non- denaturing Polyacrylamide gel10% non- denaturing Polyacrylamide gel
electrophoresis (PAGE) to separate the PCRelectrophoresis (PAGE) to separate the PCR
productsproducts
35. M 1 2 3 4 5 6 7 8 9 10 11 –ve M
Single Locus MicrosatellitesSingle Locus Microsatellites
(PAGE & Silver staining;(PAGE & Silver staining;
There are five alleles at this locus)There are five alleles at this locus)
M: Standard molecular weight marker (M: Standard molecular weight marker (pBRpBR322 DNA/322 DNA/MspMspI digest).I digest).
1 -11: Different individuals -ve : Negative control1 -11: Different individuals -ve : Negative control
45. FBI’s CODIS DNA DatabaseFBI’s CODIS DNA Database
Combined DNA Index System
• Launched October 1998
• Used for linking serial crimes and
unsolved cases with repeat offenders
• Links all 50 states
• Requires >4 RFLP markers and/or 13
core STR markers
As of June, 2004
• Total profiles = 1,857,093
• Total forensic profiles = 85,477
• Total convicted offender = 1,771,616
46. Population database
• Look up how often each allele occurs at the locus
in a population (the “allele” frequency)
47. STRs - Points to be taken care of:
During setting up of PCR
• All the components should be always on ice.
• To avoid contamination, area for PCR set up and gel
running area should be separate.
• Pipetting should be done precisely.
Visualisation of PCR products
• Avoid mixing of different PCR products while loading to the
gel.
• Always load standard DNA molecular weight marker in one
lane of the gel for determination of molecular weight.
• Standardise the running for every new fragment so that all
alleles are resoluted.
48. GenotypingGenotyping
Individuals with single bands constitute homozygotes while
heterozygotes have double bands. On this basis, each
individual is genotyped as homozygote/heterozygote with
allele designation. The alleles are designated on the basis of
their molecular weights.
Example: An individual showing (i) one band of 100 bp is
genotyped as 100100, and (ii) two bands of molecular
weight 100 and 120 bp is genotyped as 100120.
49. Analysis of Data
The allelic frequencies of multiple collections from same
river/population during different years were tested for
significant homogeneity(G-test). The genotype data for the
same river/population exhibiting homogeneity were
pooled& the combined data sets to be used for further
analysis.
Genetic Variability:
• Number & Percentage of polymorphic loci
• Observed & effective number of alleles
• Linkage disequilibrium
• Allele frequency
• Heterozygosity – observed & expected
• Private alleles
• Hardy-Weinberg expectation & to test Type I error – Bonferroni correction (in
an indefinitely large randomly mating population, the allelic/gene
frequencies (i.e. proportion of different alleles of a gene) remain unchanged
generation after generation in the absence of mutation, migration,
selection & genetic drift.); ( p + q)2 = 1.
50. Genetic differentiation/HeterogeneityGenetic differentiation/Heterogeneity
o Co-efficient of genetic differentiation (FST)
(FST is the index of genetic differentiation that describes
how much variation in allele frequencies is present
between the local populations. It is a measure of
population differentiation and ranges from 0 where all the
population have the same allele frequencies at all the loci
to 1.0,where all the populations are fixed for different
alleles at all loci)
o Genetic Distance & Similarity Index
o Dendrogram (UPGMA)
o Softwares used: GENEPOP, GENETIX,
POPGENE, WINBOOT
o Interpretation of Results
51. Allele frequencies of multiple
collections of the same river to test for
significant genetic homogeneity
using Exact test or G test; found
homogenous (P>0.001), pooled all the
samples of different collections of same
river into one population
Test for linkage disequilibrium (pair-
wise loci); select all the loci that are in
LE (P>0.05); and discard that are in LDE
Null alleles (only for microsatellite-
using MICRO-CHECKER); if not
significant (p<0.05) select those loci for
further analysis
Genetic variability: % polymorphic
loci; obs & effective # of alleles; private
alleles; obs and exp heterozygosity (for
microsatellites and allozymes); average
gene diversity (H) (only for RAPDs)
HWE : (only for microsatellites and
allozymes) FIS(W&C) in Genepop – If
FIS +ve – deficiency of heterozygote
& if FIS -ve – excess of heterozygote;
in both cases, deviation from HWE
(ideal 0.0000)
Genetic differentiation: Wright’s
FST (pair-wise & overall); and RST
(only for microsatellite - allele size)
overall GST (only for RAPDs)
Genetic distance & Similarity
Index (pair-wise populations)
UPGMA Dendrogram
AMOVA (only for allozymes &
microsatellites – hierarchical analysis
of genetic variation)
BOTTLENECK (only for allozymes -
IAM & microsatellites - TPM)
DATA ANALYSIS – STEPS INVOLVED
Sampling; Detection of polymorphic markers;
Multiple collections from the same river; Data analysis