Molecular tagging of genes involves identifying existing DNA or introducing new DNA to function as a tag or label for the gene of interest. There are four main strategies for gene tagging: marker-based tagging, transposon tagging, T-DNA tagging, and epitope tagging. Marker-based tagging uses molecular markers tightly linked to important traits to assist in plant breeding programs. Transposon tagging relies on transposons, which can move within the genome, to provide a DNA tag that can then be used to identify adjacent DNA sequences and genes.
Introduction
Transcriptome analysis
Goal of functional genomics
Why we need functional genomics
Technique
1. At DNA level
2.At RNA level
3. At protein level
4. loss of function
5. functional genomic and bioinformatics
Application
Latest research and reviews
Websites of functional genomics
Conclusions
Reference
Genetic manipulation of plant and animal cells have to be confirmed for further application. One such confirmatory method is the use of stains/dyes which produces fluorescence when the recombination is successful.
A new era of genomics for plant science research has opened due the complete genome sequencing projects of Arabidopsis thaliana and rice. The sequence information available in public database has highlighted the need to develop genome scale reverse genetic strategies for functional analysis (Till et al., 2003). As most of the phenotypes are obscure, the forward genetics can hardly meet the demand of a high throughput and large-scale survey of gene functions. Targeting Induced Local Lesions in Genome TILLING is a general reverse genetic technique that combines chemical mutagenesis with PCR based screening to identity point mutations in regions of interest (McCallum et al., 2000). This strategy works with a mismatch-specific endonuclease to detect induced or natural DNA polymorphisms in genes of interest. A newly developed general reverse genetic strategy helps to locate an allelic series of induced point mutations in genes of interest. It allows the rapid and inexpensive detection of induced point mutations in populations of physically or chemically mutagenized individuals. To create an induced population with the use of physical/chemical mutagens is the first prerequisite for TILLING approach. Most of the plant species are compatible with this technique due to their self-fertilized nature and the seeds produced by these plants can be stored for long periods of time (Borevitz et al., 2003). The seeds are treated with mutagens and raised to harvest M1 plants, which are consequently, self-fertilized to raise the M2 population. DNA extracted from M2 plants is used in mutational screening (Colbert et al., 2001). To avoid mixing of the same mutation only one M2 plant from each M1 is used for DNA extraction (Till et al., 2007). The M3 seeds produce by selfing the M2 progeny can be well preserved for long term storage. Ethyl methane sulfonate (EMS) has been extensively used as a chemical mutagen in TILLING studies in plants to generate mutant populations, although other mutagens can be effective. EMS produces transitional mutations (G/C, A/T) by alkylating G residues which pairs with T instead of the conservative base pairing with C (Nagy et al., 2003). It is a constructive approach for users to attempt a range of chemical mutagens to assess the lethality and sterility on germinal tissue before creating large mutant populations.
Introduction
Transcriptome analysis
Goal of functional genomics
Why we need functional genomics
Technique
1. At DNA level
2.At RNA level
3. At protein level
4. loss of function
5. functional genomic and bioinformatics
Application
Latest research and reviews
Websites of functional genomics
Conclusions
Reference
Genetic manipulation of plant and animal cells have to be confirmed for further application. One such confirmatory method is the use of stains/dyes which produces fluorescence when the recombination is successful.
A new era of genomics for plant science research has opened due the complete genome sequencing projects of Arabidopsis thaliana and rice. The sequence information available in public database has highlighted the need to develop genome scale reverse genetic strategies for functional analysis (Till et al., 2003). As most of the phenotypes are obscure, the forward genetics can hardly meet the demand of a high throughput and large-scale survey of gene functions. Targeting Induced Local Lesions in Genome TILLING is a general reverse genetic technique that combines chemical mutagenesis with PCR based screening to identity point mutations in regions of interest (McCallum et al., 2000). This strategy works with a mismatch-specific endonuclease to detect induced or natural DNA polymorphisms in genes of interest. A newly developed general reverse genetic strategy helps to locate an allelic series of induced point mutations in genes of interest. It allows the rapid and inexpensive detection of induced point mutations in populations of physically or chemically mutagenized individuals. To create an induced population with the use of physical/chemical mutagens is the first prerequisite for TILLING approach. Most of the plant species are compatible with this technique due to their self-fertilized nature and the seeds produced by these plants can be stored for long periods of time (Borevitz et al., 2003). The seeds are treated with mutagens and raised to harvest M1 plants, which are consequently, self-fertilized to raise the M2 population. DNA extracted from M2 plants is used in mutational screening (Colbert et al., 2001). To avoid mixing of the same mutation only one M2 plant from each M1 is used for DNA extraction (Till et al., 2007). The M3 seeds produce by selfing the M2 progeny can be well preserved for long term storage. Ethyl methane sulfonate (EMS) has been extensively used as a chemical mutagen in TILLING studies in plants to generate mutant populations, although other mutagens can be effective. EMS produces transitional mutations (G/C, A/T) by alkylating G residues which pairs with T instead of the conservative base pairing with C (Nagy et al., 2003). It is a constructive approach for users to attempt a range of chemical mutagens to assess the lethality and sterility on germinal tissue before creating large mutant populations.
A physical map of a chromosome or a genome that shows the physical locations of genes and other DNA sequences of interest. Physical maps are used to help scientists identify and isolate genes by positional cloning.
According to the ICSM (Intergovernmental Committee on Surveying and Mapping), there are five different types of maps: General Reference, Topographical, Thematic, Navigation Charts and Cadastral Maps and Plans.
This presentation is about chloroplast transformation, the importance of chloroplast transformation on nucleus transformation and strategies for making marker-free transplastomic plant
Genomics and its application in crop improvementKhemlata20
meaning ,definition of genome ,genomics ,tools of genomics ,what is genome sequencing ,methods of genome sequencingand genome mapping ,advantage of genomics over traditional breeding program, examples of some crops whose genome has been sequenced, important points about genomics, work in the field of genomics ,applications of genomics .classification of genomics .different Omics in genomics like Proteomics ,Transcriptomics ,Metabolomics ,Need of genome sequencing
A physical map of a chromosome or a genome that shows the physical locations of genes and other DNA sequences of interest. Physical maps are used to help scientists identify and isolate genes by positional cloning.
According to the ICSM (Intergovernmental Committee on Surveying and Mapping), there are five different types of maps: General Reference, Topographical, Thematic, Navigation Charts and Cadastral Maps and Plans.
This presentation is about chloroplast transformation, the importance of chloroplast transformation on nucleus transformation and strategies for making marker-free transplastomic plant
Genomics and its application in crop improvementKhemlata20
meaning ,definition of genome ,genomics ,tools of genomics ,what is genome sequencing ,methods of genome sequencingand genome mapping ,advantage of genomics over traditional breeding program, examples of some crops whose genome has been sequenced, important points about genomics, work in the field of genomics ,applications of genomics .classification of genomics .different Omics in genomics like Proteomics ,Transcriptomics ,Metabolomics ,Need of genome sequencing
This presentation provides an overview of What is a transposon,different types of transposons, their mechanism of action, examples for each type of transposons, changes caused due to insertion of transposon into the target gene and applications of Transposons. They are controlling factors in gene expression. Jumping genes is a special area of interest in Genetic research.
Role of molecular marker play a significant supplementary role in enhancing yield along with conventional plant breeding methods. the result obtain through molecular method are more accurate and at genotypic level. It had wider applications in field of plant breeding, biotechnology, physiology, pathology, entamology, etc. The mapping information obtained from these markers had created a revolution in the sequencing sector and open many pathways for developments, innovations and research.
Molecular markers for measuring genetic diversity Zohaib HUSSAIN
Molecular markers for measuring genetic diversity
Introduction:
The molecular basis of the essential biological phenomena in plants is crucial for the effective conservation, management, and efficient utilization of plant genetic resources (PGR).
Determining genetic diversity can be based on morphological, biochemical, and molecular types of information. However, molecular markers have advantages over other kinds, where they show genetic differences on a more detailed level without interferences from environmental factors, and where they involve techniques that provide fast results detailing genetic diversity
Comparison of different methods
Morphological characterization does not require expensive technology but large tracts of land are often required for these experiments, making it possibly more expensive than molecular assessment. These traits are often susceptible to phenotypic plasticity; conversely, this allows assessment of diversity in the presence of environmental variation.
Biochemical analysis is based on the separation of proteins into specific banding patterns. It is a fast method which requires only small amounts of biological material. However, only a limited number of enzymes are available and thus, the resolution of diversity is limited.
Molecular analyses comprise a large variety of DNA molecular markers, which can be employed for analysis of variation. Different markers have different genetic qualities (they can be dominant or co-dominant, can amplify anonymous or characterized loci, can contain expressed or non-expressed sequences, etc.).
Genetic marker
The concept of genetic markers is not a new one; in the nineteenth century, Gregor Mendel employed phenotype-based genetic markers in his experiments. Later, phenotype-based genetic markers for Drosophila melanogaster led to the founding of the theory of genetic linkage. A genetic marker is an easily identifiable piece of genetic material, usually DNA that can be used in the laboratory to tell apart cells, individuals, populations, or species. The use of genetic markers begins with extracting proteins or chemicals (for biochemical markers) or DNA (for molecular markers) from tissues of the plant (for example, seeds, foliage, pollen, sometimes woody tissues).
Molecular markers In genetics, a molecular marker (identified as genetic marker) is a fragment of DNA that is associated with a certain location within the genome. Molecular markers which detect variation at the DNA level such as nucleotide changes: deletion, duplication, inversion and/or insertion. Markers can exhibit two modes of inheritance, i.e. dominant/recessive or co-dominant. If the genetic pattern of homozygotes can be distinguished from that of heterozygotes, then a marker is said to be co-dominant. Generally co-dominant markers are more informative than the
this is a presentation on molecular markers that include what is molecular marker, it's types, biochemical markets (alloenzyme), it's classification, data analysis and it's applications
Taxonomy is the branch of science concerned with the classification of organisms. A taxonomic designation is more than just a name. Ideally, it reflects evolutionary history and the relationship between organisms. Traditionally, taxonomic classification has relied upon morphological features and physiological characteristics. However, for bacterial taxonomy, phenotypic approaches have proven insufficient. Unrelated bacteria can exhibit identical traits, closely related bacteria can have divergent features, and methods for accurate identification may be too cumbersome for routine use. In contrast, molecular taxonomy approaches use data derived from hereditary material and provide a robust view of genetic relatedness. Advances in technology have been accompanied by improvements in the cost, speed, and availability of molecular methods. Here, we provide a brief history of approaches to prokaryotic classification and describe how molecular taxonomy is redefining our understanding of bacterial evolution and the tree of life.
Role of Marker Assisted Selection in Plant Resistance RandeepChoudhary2
Topic Role of Marker Assisted Selection in Plant Resistance is described in detail including some case studies.
Types of markers used in genetic engineering and biotechnology are described in detail.
Marker assisted selection is a process whereby a marker (morphological, biochemical or one
based on DNA/RNA variation) is used for indirect selection of a genetic determinant of a trait
of interest. Since the first reported linkage of an agronomically important trait (a quantitative
trait locus affecting seed weight) to a simply controlled gene (seed colour) in common bean by
Sax (1923), it has taken more than 60 years for genetic markers to become a qualified tool for
plant breeding programs. In rice, the Xieyou 218 hybrid was the first to be developed through
MAS to select individuals carrying a bacterial blight-resistant gene. Marker-assisted selection
(MAS) can be applied at the seedling stage, with high precision and reductions in cost. Genetic
mapping of major genes and quantitative traits loci (QTLs) for agricultural traits is increasing
the integration of biotechnology with the conventional breeding process. Traits related to
disease resistance to pathogens and to the quality of some crop products are offering some
important examples of a possible routinary application of MAS. For more complex traits, like
yield and abiotic stress tolerance, a number of constraints have severe limitations on an efficient
utilization of MAS in plant breeding. However, the economic and biological constraints such
as a low return of investment in small-grain cereal breeding, lack of diagnostic markers, and
the prevalence of QTL-background effects hinder the broad implementation of MAS but over
the past 2 decades, a number of R-genes conferring resistance to a diverse range of pathogens
have been mapped in many crops using molecular markers.
Comparative sequence studies of the repeat elements in diverse insect species can provide useful information on how to make use of them for developing abundant markers that can be used in those species;
$ At the moment, a total of 8 species are in genome assembly stages and another 35 are in progress for genome sequencing;
$ Different molecular marker systems in the field of entomology are expected to provide new directions to study insect genomes in an unprecedented way in the years to come
Process whereby a marker is used for indirect selection of a genetic determinant or determinants of a trait of interest (i.e. productivity, disease resistance, abiotic stress tolerance, and/or quality).
Trait of interest is selected not based on the trait itself but on a marker linked to it.
The assumption is that linked allele associates with the gene and/or quantitative trait locus (QTL) of interest. MAS can be useful for traits that are difficult to measure, exhibit low heritability, and/or are expressed late in development.
Pre-Requisites: Two pre-requisites for marker assisted selection are: (i) a tight linkage between molecular marker and gene of interest, and (ii) high heritability of the gene of interest.
Markers Used: The most commonly used molecular markers include amplified fragment length polymorphisms (AFLP), restriction fragment length polymorphisms (RFLP), random amplified polymorphic DNA (RAPD), simple sequence repeats (SSR) or micro satellites, single nucleotide polymorphisms (SNP), etc. The use of molecular markers differs from species to species also.
What is Genome,Genome mapping,types of Genome mapping,linkage or genetic mapping,Physical mapping,Somatic cell hybridization
Radiation hybridization ,Fish( =fluorescence in - situ hybridization),Types of probes for FISH,applications,Molecular markers,Rflp(= Restriction fragment length polymorphism),RFLPs may have the following Applications;Advantages of rflp,disAdvantages of rflp, Rapd(=Random amplification of polymorphic DNA),Process of rapd, Difference between rflp &rapd
Presentation1..gymno..non specific markers n microsatellites..by Nikita Patha...NIKITAPATHANIA
NON-SPECIFIC MARKERS-“A cloned random DNA fragment whose function or specific features are not known e.g. AFLP, RAPD, IRAP, SSR etc.
These marker type generally measure apparently neutral DNA variations.
They are generally the PCR based molecular markers.
Determining genetic diversity can be based on morphological, biochemical, and molecular types of information.
However, molecular markers have advantages over other kinds, where they show genetic differences on a more detailed level without interferences from environmental factors, and where they involve techniques that provide fast results detailing genetic diversity.
MOLECULAR MARKERS - In genetics, a molecular marker (identified as genetic marker) is a fragment of DNA that is associated with a certain location within the genome.
MICROSATELLITES : Microsatellites are tandem repeats(TRs) of 1–6 bp and are also known as simple sequence repeats (SSRs). Microsatellites are TRs of base pairs that are widely spread throughout the genome. Microsatellites are located in the coding and non coding regions.
Microsatellite markers are codominant, abundant, and multiallelic and play an important role in the study of molecular population genetics, positional cloning, QTL mapping, disease identification, pathogenesis, and evolutionary studies, etc .
Major molecular markers based on assessment of variability generated by microsatellites sequences are:
STMSs (Sequence Tagged Microsatellite Site), SSLPs (Simple Sequence Length Polymorphism), SNPs (Single Nucleotide Polymorphisms), SCARs (Sequence Characterized Amplified Region) and CAPS (Cleaved Amplified Polymorphic Sequences).
SINGLE COPY NUCLEAR GENE MARKER – Has one physical location in the genome and can have orthologs in different species.
Comprise of a unique sequence that code for proteins and undergo transcription.
Seed plants probably comprise 260,000 to 310,000 extant species. Current seed plants consist of angiosperms and gymnosperms, the latter of which are further sub divided into Cycadidae, Ginkgoidae, Gnetidae, and Pinidae .
In contrast to angiosperms, for which several genomic, transcriptomic and phylogenetic resources are available, there are few, if any, molecular markers that allow broad comparisons among gymnosperm species.
With few gymnosperm genomes available, recently obtained transcriptomes in gymnosperms are a great addition to identifying single-copy gene families as molecular markers for phylogenomic analysis in seed plants.
Taking advantage of an increasing number of available genomes and transcriptomes, there is identification of single-copy genes in a broad collection of seed plants and used these to infer phylogenetic relationships between major seed plant taxa.
All studied seed plants shared 1,469 single-copy genes, which are generally involved in functions like DNA metabolism, cell cycle, and photosynthesis.
Genomic In-Situ Hybridization (GISH)-Principles, Methods and Applications in ...Banoth Madhu
Banoth Madhu: Genomic In-Situ Hybridization (GISH)-Principles, Methods and Applications in Crop Plants. It is a cytogenetic technique that allows the detection and localization of specific nucleic acid sequences on morphologically preserved chromosomes using genomic DNA of donor specie as probe. It is a cytogenetic technique that allows the detection and localization of specific nucleic acid sequences on morphologically preserved chromosomes using genomic DNA of donor specie as probe
Slide 1: Title Slide
Extrachromosomal Inheritance
Slide 2: Introduction to Extrachromosomal Inheritance
Definition: Extrachromosomal inheritance refers to the transmission of genetic material that is not found within the nucleus.
Key Components: Involves genes located in mitochondria, chloroplasts, and plasmids.
Slide 3: Mitochondrial Inheritance
Mitochondria: Organelles responsible for energy production.
Mitochondrial DNA (mtDNA): Circular DNA molecule found in mitochondria.
Inheritance Pattern: Maternally inherited, meaning it is passed from mothers to all their offspring.
Diseases: Examples include Leber’s hereditary optic neuropathy (LHON) and mitochondrial myopathy.
Slide 4: Chloroplast Inheritance
Chloroplasts: Organelles responsible for photosynthesis in plants.
Chloroplast DNA (cpDNA): Circular DNA molecule found in chloroplasts.
Inheritance Pattern: Often maternally inherited in most plants, but can vary in some species.
Examples: Variegation in plants, where leaf color patterns are determined by chloroplast DNA.
Slide 5: Plasmid Inheritance
Plasmids: Small, circular DNA molecules found in bacteria and some eukaryotes.
Features: Can carry antibiotic resistance genes and can be transferred between cells through processes like conjugation.
Significance: Important in biotechnology for gene cloning and genetic engineering.
Slide 6: Mechanisms of Extrachromosomal Inheritance
Non-Mendelian Patterns: Do not follow Mendel’s laws of inheritance.
Cytoplasmic Segregation: During cell division, organelles like mitochondria and chloroplasts are randomly distributed to daughter cells.
Heteroplasmy: Presence of more than one type of organellar genome within a cell, leading to variation in expression.
Slide 7: Examples of Extrachromosomal Inheritance
Four O’clock Plant (Mirabilis jalapa): Shows variegated leaves due to different cpDNA in leaf cells.
Petite Mutants in Yeast: Result from mutations in mitochondrial DNA affecting respiration.
Slide 8: Importance of Extrachromosomal Inheritance
Evolution: Provides insight into the evolution of eukaryotic cells.
Medicine: Understanding mitochondrial inheritance helps in diagnosing and treating mitochondrial diseases.
Agriculture: Chloroplast inheritance can be used in plant breeding and genetic modification.
Slide 9: Recent Research and Advances
Gene Editing: Techniques like CRISPR-Cas9 are being used to edit mitochondrial and chloroplast DNA.
Therapies: Development of mitochondrial replacement therapy (MRT) for preventing mitochondrial diseases.
Slide 10: Conclusion
Summary: Extrachromosomal inheritance involves the transmission of genetic material outside the nucleus and plays a crucial role in genetics, medicine, and biotechnology.
Future Directions: Continued research and technological advancements hold promise for new treatments and applications.
Slide 11: Questions and Discussion
Invite Audience: Open the floor for any questions or further discussion on the topic.
Professional air quality monitoring systems provide immediate, on-site data for analysis, compliance, and decision-making.
Monitor common gases, weather parameters, particulates.
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Sérgio Sacani
We characterize the earliest galaxy population in the JADES Origins Field (JOF), the deepest
imaging field observed with JWST. We make use of the ancillary Hubble optical images (5 filters
spanning 0.4−0.9µm) and novel JWST images with 14 filters spanning 0.8−5µm, including 7 mediumband filters, and reaching total exposure times of up to 46 hours per filter. We combine all our data
at > 2.3µm to construct an ultradeep image, reaching as deep as ≈ 31.4 AB mag in the stack and
30.3-31.0 AB mag (5σ, r = 0.1” circular aperture) in individual filters. We measure photometric
redshifts and use robust selection criteria to identify a sample of eight galaxy candidates at redshifts
z = 11.5 − 15. These objects show compact half-light radii of R1/2 ∼ 50 − 200pc, stellar masses of
M⋆ ∼ 107−108M⊙, and star-formation rates of SFR ∼ 0.1−1 M⊙ yr−1
. Our search finds no candidates
at 15 < z < 20, placing upper limits at these redshifts. We develop a forward modeling approach to
infer the properties of the evolving luminosity function without binning in redshift or luminosity that
marginalizes over the photometric redshift uncertainty of our candidate galaxies and incorporates the
impact of non-detections. We find a z = 12 luminosity function in good agreement with prior results,
and that the luminosity function normalization and UV luminosity density decline by a factor of ∼ 2.5
from z = 12 to z = 14. We discuss the possible implications of our results in the context of theoretical
models for evolution of the dark matter halo mass function.
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...Scintica Instrumentation
Intravital microscopy (IVM) is a powerful tool utilized to study cellular behavior over time and space in vivo. Much of our understanding of cell biology has been accomplished using various in vitro and ex vivo methods; however, these studies do not necessarily reflect the natural dynamics of biological processes. Unlike traditional cell culture or fixed tissue imaging, IVM allows for the ultra-fast high-resolution imaging of cellular processes over time and space and were studied in its natural environment. Real-time visualization of biological processes in the context of an intact organism helps maintain physiological relevance and provide insights into the progression of disease, response to treatments or developmental processes.
In this webinar we give an overview of advanced applications of the IVM system in preclinical research. IVIM technology is a provider of all-in-one intravital microscopy systems and solutions optimized for in vivo imaging of live animal models at sub-micron resolution. The system’s unique features and user-friendly software enables researchers to probe fast dynamic biological processes such as immune cell tracking, cell-cell interaction as well as vascularization and tumor metastasis with exceptional detail. This webinar will also give an overview of IVM being utilized in drug development, offering a view into the intricate interaction between drugs/nanoparticles and tissues in vivo and allows for the evaluation of therapeutic intervention in a variety of tissues and organs. This interdisciplinary collaboration continues to drive the advancements of novel therapeutic strategies.
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Sérgio Sacani
Since volcanic activity was first discovered on Io from Voyager images in 1979, changes
on Io’s surface have been monitored from both spacecraft and ground-based telescopes.
Here, we present the highest spatial resolution images of Io ever obtained from a groundbased telescope. These images, acquired by the SHARK-VIS instrument on the Large
Binocular Telescope, show evidence of a major resurfacing event on Io’s trailing hemisphere. When compared to the most recent spacecraft images, the SHARK-VIS images
show that a plume deposit from a powerful eruption at Pillan Patera has covered part
of the long-lived Pele plume deposit. Although this type of resurfacing event may be common on Io, few have been detected due to the rarity of spacecraft visits and the previously low spatial resolution available from Earth-based telescopes. The SHARK-VIS instrument ushers in a new era of high resolution imaging of Io’s surface using adaptive
optics at visible wavelengths.
Richard's aventures in two entangled wonderlandsRichard Gill
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
Seminar of U.V. Spectroscopy by SAMIR PANDASAMIR PANDA
Spectroscopy is a branch of science dealing the study of interaction of electromagnetic radiation with matter.
Ultraviolet-visible spectroscopy refers to absorption spectroscopy or reflect spectroscopy in the UV-VIS spectral region.
Ultraviolet-visible spectroscopy is an analytical method that can measure the amount of light received by the analyte.
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...University of Maribor
Slides from:
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Track: Artificial Intelligence
https://www.etran.rs/2024/en/home-english/
Richard's entangled aventures in wonderlandRichard Gill
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
1. Molecular tagging of genes- an
overview
Submitted to: Submitted by:
Dr. V.K. Chaudhary Kirti
(Department of Molecular Ph.D (MBB)
Biology and Biotechnology) 2012BS26D
Advances in crop improvement (MBB 604)
2. Gene tagging
Gene tagging refers to the identification of existing DNA or the
introduction of new DNA that can function as a tag or label for the
gene of interest.
Gene tagging is a most common method used today for selection
against different biotic and abiotic stress resistances studies in crop
plants.
There are four different strategies used for gene tagging.
3. Types of gene tagging
Marker based gene tagging
Transposon tagging
T-DNA tagging
Epitope tagging
4. Marker based gene tagging
A Molecular marker is a DNA sequence which is readily detected and whose
inheritance can be easily monitored.
The effectiveness of molecular markers depends on their ability to identify
variation in the DNA of a population, known as marker polymorphism
Molecular markers are detected as differences in DNA fragment size, which arise
from differences in DNA sequence.
Molecular markers are widely used in marker-assisted breeding for tagging of
an important trait or traits in a breeding program.
5. Types of DNA Marker can be differentiated based on molecular technique used to
develop the marker
- Hybridization (eg, RFLP)
- PCR (eg, SSR)
- Sequencing (eg, ESTs)
The genome size of most plant species ranges between 108 to 1010 base pairs, so even a
small proportion of variation in DNA can yield a large number of potential markers
(Paterson et al., 1991).
Desirable properties for a good molecular marker
High Polymorphic
Co-dominant inheritance
Easy, fast and cheap to detect
High resolution with large number of samples
Nondestructive assay
Random distribution throughout the genome
Assay can be automated
6. Polymorphism
-Parent 1 : one band
-Parent 2 : a smaller band
-Offspring 1 : heterozygote = both bands
-Offspring 2 : homozygote
Polymorphism
Parent 1 : one band
-Parent 2 : no band
-Offspring 1 : homozygote parent 1
P 2P 1 O 2O 1
Gel configuration
Co-dominant marker
P 2
Gel configuration
P 1 O 1 O 2
Dominant marker
7. .
Restriction Fragment Length Polymorphism
RFLP (The first type of DNA markers that were used for genetic mapping were RFLPs
(Botstein et al., 1980)
co-dominant
marker
Disadvantages
– Time
consuming
– Expensive
– Use of
radioactive
probes
RFLP
8. The term microsatellites was coined by Litt and Lutty (1989).
Regions of genome where a short (1-6 base) motif is repeated many times (can be
repeated 10 to 100 times).
If the nucleotide sequences in the flanking regions of microsatellites are known, specific
primers can be designed to amplify the microsatellite by PCR.
Simple Sequence Repeats (SSR): Microsatellites
Sequence Primer
ACTGTCGACACACACACACACGCTAGCT (AC)7
TGACAGCTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACGCTAGCT (AC)8
TGACAGCTGTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACACACGCTAGCT (AC)10
TGACAGCTGTGTGTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACACACACACGCTAGCT (AC)12
TGACAGCTGTGTGTGTGTGTGTGTGTGTGTGCGATCGA
9. AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGGP1
AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCGP2
P1 P2
SSR polymorphisms
Gel configuration
These microsatellite repeat sequences are usually polymorphic in different lines
because of variations in the number of repeat units.
These are used as co-dominant genetic markers.
They have high genomic abundance.
SSR offer the additional advantage that they do not involve the use of
restriction endonucleases, thus avoid the problems associated with partial
digestions.
Evenly distributed throughout the genome.
Interpretation of result is simple.
Easily automated, allowing multiplexing.
Good analytical resolution and high
reproducibility.
Require very little and not necessarily high
quality DNA.
Costly primer developing.
10. These markers are based on variation of single nucleotide between two or more
genotypes or individuals.
They are more abundant polymorphic marker with 2-3 polymorphic sites
every kilobase (Cooper et al., 1985).
In plants, SNPs are very abundant- in wheat 1 SNP per 20 bp and in maize 1 SNP
per 70 bp in certain regions of their genotype.
DNA strand 1 differs from DNA strand 2 at
a single base-pair location (a C/T
polymorphism).
Single Nucleotide Polymorphisms (SNPs)
.
Hybridization using fluorescent dyescostly
labour oriented
11. Expressed Sequence Tags (ESTS)
ESTs are small pieces of DNA usually 200-500 nucleotide long.
Their location on the chromosome and sequence are known
ESTs are created from cDNA, a single strand of DNA that has been copied
from an mRNA molecule i.e. it consist only of exon.
- the method is fast
- doesnot require
radioactive material
- sequence information
is required
12. Molecular tagging of genes for biotic stress resistance
Biotic Stress is stress that occurs as a result of damage done to plants by
other living organisms, such as bacteria, viruses, fungi, parasites, beneficial
and harmful insects, weeds, and cultivated or native plants.
To combat resistance to biotic stresses different molecular techniques are
used these days. Restriction fragment length polymorphism (RFLP) have
been used for the molecular tagging of various agronomic traits in different
crop species.
13. Journal of Plant Pathology (2010), 92 (2), 495-501
Marker-assisted breeding for resistance to bacterial leaf blight in
popular cultivar and parental lines of hybrid rice
M.L. Shanti, V.V. Shenoy, G. Lalitha Devi, V. Mohan Kumar, P. Premalatha, G. Naveen Kumar, H.E.
Shashidhar, U.B. Zehr and W.H. Freeman
Bacterial blight (BB) elicited by Xanthomonas oryzae pv. oryzae (Xoo) is one of the
most devastating diseases across the tropics and semi-tropics.
Molecular markers are becoming essential components in breeding programs involving
gene pyramiding.
Using marker-assisted selection in a backcross-breeding program, four bacterial blight
resistant genes namely Xa4, xa5, xa13 and Xa21 have been introgressed into the
hybrid rice parental lines KMR3, PRR78, IR58025B, Pusa 6B and the popular Mahsuri.
IRBB60, a near isogenic line carrying the four resistant genes Xa4, xa5, xa13 and Xa21
served as the donor for all the crosses attempted.
14. DNA isolation for PCR analysis of the parents and backcross progenies was carried out. Three
sequence-tagged-site (STS) markers Npb 181, RG 136 and pTA 248, tightly linked to Xa4,
xa13 and Xa21 and one simple sequence repeat (SSR) marker RM 122 tightly linked to xa5
was used to confirm the presence of each gene and the different combinations.
Screening for BB resistance. The pyramided lines in the backgrounds of Mahsuri, KMR3 and
PRR78 were evaluated for their reaction to BB under glasshouse conditions.
Marker-assisted selection for BB resistant genes :Nine F1 plants from each of the
crosses between Mahsuri/IRBB60 , KMR3/IRBB60, PRR78/IRBB60, IR58025B/IRBB60,
Pusa 6B/IRBB60 were tested for their heterozygosity for the R gene linked markers and were
backcrossed using the female parent.
The resulting BC1 F1 lines were first checked for presence of the Xa21 resistance allele.
All plants carrying the resistant allele were checked for the presence of the xa5 allele in
heterozygous condition.
Plants containing resistant alleles for both genes were further screened for the Xa4 gene
using Npb 181.
Finally, the triple positives were screened for the presence of xa13 allele.
15.
16. .
Phenotyping of these target plants was done at the field level and only those
showing the maximum similarity to the recurrent parent and showing high
yield were selected.
This was continued up to the BC3F1 generation. BC3F2 that were screened
using the R gene linked markers to identify plants that were homozygous for
different R genes or their combinations.
Disease resistance The gene pyramids in the backgrounds of Mahsuri,
KMR3 and PRR78 showed a very high degree of resistance as compared to
their parents to all the Xoo isolates inoculated.
There were varying degrees of resistance to each of the isolates, but no isolate
could break the resistance of any of the four-gene pyramids.
17. The defining property of transposable elements (jumping genes) is their
mobility; i.e. they are genetic elements that can move from one position to
another in the genome.
Transposon tagging is a gene cloning strategy that relies on the transposon to
provide a DNA “tag” with a known sequence .
The transposon sequence is used to identify DNA sequences adjacent to the
transposable element.
Some transposable elements move in a replicative manner, whereas others are
nonreplicative, i.e. they move without making a copy of themselves.
Transposons describe the DNA which can be cut away from one site and paste
to other place within the genome (cut and paste mechanism).
Transposon Tagging
18. Retrotransposon make themselves a copy and then paste to other position
within the genome.
The moving of retrotransposons involves RNA but not in transposons.
The maize transposable element Activator (Ac) first identified by McClintock
(1948) is a kind of transposon widely used for creating MGE (mobile genetic
element) insertions.
Ac element can insert themselves into genes. The mutations caused are unstable
because the Ac element can be excised from the inserted gene by the transposase
which is coded by Ac element itself.
Dissociation (Ds) element is usually stable because they are incapable of
excising itself from the inserted gene unless with the help of Ac element.
Researchers combine these two mobile elements and named it as the Ac/Ds
system to generate mutant populations.
.
.
19. TEs occur in families of
related sequences, defined by
their ability to interact
genetically. Within any one
family, individual elements
occur in two forms:
“Autonomous” element-
structurally conserved element
capable of promoting its own
excision.
“Non-autonomous”
elements- structurally
heterogeneous group of
elements unable to promote
their own excision.
Non-autonomous elements
from one family can be trans-
activated only by the
autonomous member of the
same family.
20. Examples of such families of plant TEs include Activator-Dissociation
(Ac/Ds) from maize.
Other examples of Ac-Ds system includes Arabidopsis thalliana and carrot,
potato, tomato, petunia, soybean, etc.
This strategy incorporates the transgene of interest into a Ds element, and
introduces the construct either into plants that already contain an Ac-
transposase gene, or co-transforms this construct with an Ac-
transposase gene into the plant species of interest.
The reddish streaks on these corn grains are caused by transposons
21. The individual Ds parental lines and Ac
parental lines are created by
transformation of Ac element and Ds
element independently into the host
organism.
Then the two parental lines are crossed
to induce the translocations of the Ds
element in the next generation.
By crossing Ac parent line and Ds parent
line, Ds element is activated- Ds
element transfer from one position to
another position within the genome which
will create random disruption of gene
functions in the following generations.
22. Some transposition events inactivate
genes, since the coding potential or
expression of a gene is disrupted by
insertion of the transposable element.
A classic example is the r allele of the
gene encoding a starch branching
enzyme in peas is nonfunctional due to
the insertion of a transposable element.
This allele causes the wrinkled pea
phenotype in homozygotes originally
studied by Mendel.
In other cases, transposition can
activate nearby genes by bringing an
enhancer of transcription (within the
transposable element) close enough to a
gene to stimulate its expression.
In other cases, no obvious phenotype
results from the transposition.Schematic of a transposon-tagged
mutation.
23. Transposon tagging is of two types :
(a) directed tagging
(b) non-directed tagging
Directed Tagging :
Directed transposon tagging recovers
mutations at a specific locus of interest.
Directed tagging identifies transposon-
induced alleles by crossing transposon-
active plants with a reference allele of the
mutation.
The mutable alleles are separated from the
reference allele by crossing the F1 to a
standard line (hybrid, inbred, or tester).
To identify a co-segregating transposon,
the mutable allele is backcrossed into the
standard line, and the backcrossed
progeny are self-pollinated.
24. Non-directed Tagging :
Directed tagging is limited to mutants
that are non-essential for a plant to
complete its life cycle. This approach
requires a homozygous mutant tester and
detects tagged alleles via a mutant
phenotype in the F1.
If a mutant is lethal or infertile, a
heterozygous tester could be generated.
Tagged-alleles would be recovered at half
the frequency due to the segregation of
the mutation in the tester.
However, most mutants would be lost in
the first generation after the directed
tagging crosses.
25. .
Many lethal or infertile mutants have been cloned by transposon tagging. The
tagged alleles of these mutants are identified from non-directed tagging.
For non-directed tagging, transposon-active stocks are generally crossed to a
standard line and the resulting progeny are self-pollinated.
The self-pollinated families are screened for recessive mutants and segregating
populations are generated by backcrossing into the standard line.
Segregating populations of the mutable alleles are then screened by DNA gel
blot or with PCR methods to identify transposon insertions that co-segregate
with the mutable phenotype.
Although both schematics show the transposon parent as a pollen parent,
transposon mutagenesis can be completed with either a male or a female
transposon parent.
26. T-DNA tagging
T-DNA of Agrobacterium, generally used as a vector in genetic
transformation, could also be considered as a insertional mutagen (Koncz et
al., 1989) and with its sequence characterized T-DNA could also be used as a
tag (Koncz et al., 1990).
Insertion of foreign DNA can alter the expression of neighbouring gene,
resulting in gain or loss of function which produces a screenable phenotype
the sequence of the tag provided a landmark allowing its isolation along with the
mutated gene
Many integrate within transcriptional units so that promoters, enhancers,
exons and introns can be tagged.
27. The integrated T-DNA is genetically stable and however from time to time,
regions within the T-DNA can become methylated and the resultant
reduction in gene expression can result in phenotypic instability.
DNA transferred to the plant genome is precisely defined by the border
sequences. The genes encoded by the T-DNA can be replaced without
interfering with the transfer process.
Why T-DNA?
1. Active transposons do not exist in every species including Arabidopsis.
2. Agrobacterium-mediated transformation is simpler.
3. More likely to generate simpler full-length integration as compared to
other methods.
4. T-DNA insertion mainly occurs in transcriptionally active area of the
genome.
5. The mutated locus gets tagged.
28. TYPES OF T-DNA TAGGING
(a) Promoter tagging
(b) Activation tagging
Earlier , T-DNA used as a tag involved linking a promoter less
marker gene to the border of the T-DNA and selecting for
transgenics.
A concern with this type tagging is that only gene fusions
expressed at the time of selection may be recovered and that T-
DNA insertions can occur at high copy (Koncz et al., 1989, 1992).
A. Promoter Tagging :
29. Promoter tagging work has focused on preliminary selection for
transformants being based on constitutive expression of a marker gene
followed by screening for expression of a promoter-less marker gene to
identify events where a promoter has been tagged.
Other promoter-less marker genes have been adopted that are easier
to screen for activity of tagged promoters such as β-glucuronidase
(GUS) and luciferase (LUX).
B. Activation Tagging :
Activation tagging is a gain-of-function method that generates transgenic
plants by T-DNA vectors with tetrameric cauliflower mosaic virus (CaMV) 35S
enhancers which can lead to an enhancement expression of adjacent genes.
Differently from the action of the complete CaMV 35S promoter, CaMV 35S
enhancers can activate both the upstream and downstream gene transcription.
30. Activation tagging technique was firstly developed by Walden and colleagues .
Since then, several large scale activation tagging mutant resources have been
generated and activation tagging method was widely used to isolate new
genes.
As an early example, the activation-tagging technique was used in tissue
culture to identify cytokinin-independent mutants in Arabidopsis and CKI1
gene whose overexpression can bypass the requirement for cytokinin in the
regeneration of shoots was identified.
Activation tagging has identified a number of genes fundamental to plant
development, metabolism and disease resistance in Arabidopsis.
A further limitation to the present generation of T-DNA activation tagging
vectors is the tissue specificity of the CaMV 35S enhancer sequence
(Benfey and Chua 1989). For example, while this enhancer is active in leaves
it has poor activity in roots.
31. Utilization of T-DNA Tagging Lines in Rice
Jakyung Yi and Gynheung An
J. Plant Biol. (2013) 56:85-90
Rice is a good model plant for cereal research because of its small genome size and
well established procedures for stable transformation (An et al.,1988).
The insertion mutants generated by T-DNA has been the most commonly used.
By sequencing PCR-amplified fragments near the inserted elements, researchers have
been able to construct various flanking sequence databases
(http://signal.salk.edu/cgi-bin/RiceGE).
Five binary vectors (pGA2144, pGA2707, pGA2715, pGA2717, and pGA2772) were
used for insertion mutagenesis.
32. All contain the hygromycin-resistance gene hph,
which was constructed using the α-tubulin
promoter with its first intron, the coding region
of hph, and the terminator from T7 or α-tubulin.
These vectors also carry the promoterless β-
glucuronidase (gus) with a synthetic intron.
This feature allows for a high frequency translational fusion between the tagged gene and gus
when the reporter gene is inserted within a gene in the same direction.
When a translation fusion occurs, expression patterns for the tagged gene can be easily
analyzed at the cellular level through simple GUS analysis.
In pGA2715 and pGA2772, multimerized transcriptional enhancers from the cauliflower
mosaic virus 35S promoter were placed next to the left border.
The enhancer can increase expression of nearby genes at the T-DNA insertion site. These
activation tagging vectors produce gain-of-function mutants that have several advantages over
knockout mutants.
33. Epitope tagging
An epitope (also called an antigenic determinant) is any
structure or sequence that is recognized by an antibody. A
single large molecule such as a protein may have many
epitopes.
35. Epitope tagging offers several advantages over other methods of analyzing and
purifying proteins:
Epitope tagging is much faster than the traditional method of producing a new
antibody to every protein studied. The same tag-specific antibody will recognize
the epitope tag in many different proteins.
Epitope tagging is much less costly and labor intensive than setting up and
maintaining antibody-producing facilities.
Adding a small (3–14 amino acid) epitope tag generally does not affect the
function of the tagged protein, allowing the study of the tagged protein’s role in
the cell.
Epitope tagging makes it possible to gather information about proteins that
would otherwise be too difficult to purify or too similar to other proteins to be
distinguished in vivo.
36. pLMI carries a fusion gene consisting of the c-
myc epitop tag and the DNA binding domain
(GC) of the wheat EmBP-1 gene (Guiltinan et
al., 1990).
Guiltinan MJ and McHenry L, Methods in cell biology, vol. 49