DNA barcoding uses a short, standardized gene sequence from a uniform region of mitochondrial or nuclear DNA to identify species. It has potential to identify the estimated 10 million eukaryotic species on Earth. The cytochrome c oxidase I (COI) gene region is commonly used for animals. DNA barcoding can identify specimens at all life stages, resolve taxonomic ambiguities, and enable development of electronic field guides. It involves tissue sampling, DNA extraction and amplification, sequencing, and comparing sequences to reference databases. Costs and time for the process are decreasing with new technologies. Global efforts aim to compile barcodes for all known eukaryotes.
DNA barcoding is a standardized approach to identifying plants and animals by minimal sequences of DNA, called DNA barcodes.
DNA barcode - short gene sequences taken from a standardized portion of the genome that is used to identify species
and this presentation gives much introducing about DNA barcodes developed for Prokaryotes and Eukaryotes.
Various barcoding genes which are evolutionary conserved.
techniques to develop a DNA bar-code and its future perspectives
Current technologies and future technologies of DNA barcoding. Applications regarding environment awareness. it also contains 2-3 case studies
DNA barcoding is a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical.
Use of DNA barcoding and its role in the plant species/varietal Identifica...Senthil Natesan
Plant DNA barcoding research is shifting beyond performance comparisons of different DNA regions towards practical applications. The main aim of DNA barcoding is to establish a shared community resource of DNA sequences that can be used for organismal identification and taxonomic clarification. This approach was successfully pioneered in animals using a portion of the cytochrome oxidase 1(CO1) mitochondrial gene. In plants, establishing a standardized DNA barcoding system has been more challenging. The studies on cucumis sp for the application of DNA barcode shows the possibility of discrimination at species level not the varietal level using the matK gene barcode. The phylogenetic tree constructed by using matK gene sequences clearly differentiated the species C. sativus and C. melo which will help for the future application in cucumis taxonomy and phylogeny studies
Molecular Marker and It's ApplicationsSuresh Antre
Molecular (DNA) markers are segments of DNA that can be detected through specific laboratory techniques. With the advent of marker-assisted selection (MAS), a new breeding tool is now available to make more accurate and useful selections in breeding populations.
DNA barcoding is a standardized approach to identifying plants and animals by minimal sequences of DNA, called DNA barcodes.
DNA barcode - short gene sequences taken from a standardized portion of the genome that is used to identify species
and this presentation gives much introducing about DNA barcodes developed for Prokaryotes and Eukaryotes.
Various barcoding genes which are evolutionary conserved.
techniques to develop a DNA bar-code and its future perspectives
Current technologies and future technologies of DNA barcoding. Applications regarding environment awareness. it also contains 2-3 case studies
DNA barcoding is a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical.
Use of DNA barcoding and its role in the plant species/varietal Identifica...Senthil Natesan
Plant DNA barcoding research is shifting beyond performance comparisons of different DNA regions towards practical applications. The main aim of DNA barcoding is to establish a shared community resource of DNA sequences that can be used for organismal identification and taxonomic clarification. This approach was successfully pioneered in animals using a portion of the cytochrome oxidase 1(CO1) mitochondrial gene. In plants, establishing a standardized DNA barcoding system has been more challenging. The studies on cucumis sp for the application of DNA barcode shows the possibility of discrimination at species level not the varietal level using the matK gene barcode. The phylogenetic tree constructed by using matK gene sequences clearly differentiated the species C. sativus and C. melo which will help for the future application in cucumis taxonomy and phylogeny studies
Molecular Marker and It's ApplicationsSuresh Antre
Molecular (DNA) markers are segments of DNA that can be detected through specific laboratory techniques. With the advent of marker-assisted selection (MAS), a new breeding tool is now available to make more accurate and useful selections in breeding populations.
DNA barcoding was first proposed by Paul Herbert in 2003.
Basic Principle
Dna Barcoding is based on premise that a short standardized sequence can distinguish individuals of a specie because genetic variation between specie exceeds that within specie.
DNA SEQUENCING METHODS AND STRATEGIES FOR GENOME SEQUENCINGPuneet Kulyana
This presentation will give you a brief idea about the various DNA sequencing methods and various strategies used for genome sequencing and much more vital information related to gene expression and analysis
Introduction
History
Genetic mapping
DNA Markers
Physical mapping
Importance
Drawback
Conclusion
References
uses genetic techniques to construct maps showing the positions of genes and other sequence features on a genome.
Genetic techniques include cross-breeding experiments or, in the case of humans, the examination of family histories (pedigrees).
A genetic marker is a gene or DNA sequence with a known location on a chromosome that can be used to identify individuals or species. It can be described as a variation (which may arise due to mutation or alteration in the genomic loci) that can be observed. A genetic marker may be a short DNA sequence, such as a sequence surrounding a single base-pair change (single nucleotide polymorphism, SNP), or a long one, like minisatellites.
Transcriptomics is the study of RNA, single-stranded nucleic acid, which was not separated from the DNA world until the central dogma was formulated by Francis Crick in 1958, i.e., the idea that genetic information is transcribed from DNA to RNA and then translated from RNA into protein.
Techniques based on the principle of selectively amplifying a subset of restriction fragments from a complex mixture of DNA fragments obtained after digestion of genomic DNA with restriction endonucleases.
The technique of molecular biology like DNA isolation, RNA isolation, PCR, Western blot, RFLP, etc was developed with development in science. This presentation includes the method of DNA and RNA isolation and their Quantification techniques.
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...journal ijrtem
Abstract: The present study addresses this issue by examining the patterning of Cytochrome Oxidase I diversity in the stone fish Uranoscopus oligolepis the structurally diverse group of Family Uranoscopidae. The sequences were analyzed for their species identification using BOLD’s identification engine. The COI sequences of U. oligolepis from different geographical regions were extracted from NCBI for intra species variation analysis. All sequences were aligned using Clustal W. The sequences were trimmed using software and phylogenetic tree was constructed with bootstrap test. The results showed that the cytosine content was high (31%). The least molar concentration was observed in guanine (19.5%) and Adenine (19.6%). Thymine was the second predominant in molar concentration next to thymine which is followed by adenine. The G+C content was found to be 49.6% and A+T content was 50.4%. Leucine and Alanine content was high in the amino acid composition. From the study it is assumed that the mitochondrial gene COI can be the potential barcoding region to identify an organism up to the species level. Keywords: COI, intra species, Uranoscopus oligolepis, barcoding, phylogenetic
DNA barcoding was first proposed by Paul Herbert in 2003.
Basic Principle
Dna Barcoding is based on premise that a short standardized sequence can distinguish individuals of a specie because genetic variation between specie exceeds that within specie.
DNA SEQUENCING METHODS AND STRATEGIES FOR GENOME SEQUENCINGPuneet Kulyana
This presentation will give you a brief idea about the various DNA sequencing methods and various strategies used for genome sequencing and much more vital information related to gene expression and analysis
Introduction
History
Genetic mapping
DNA Markers
Physical mapping
Importance
Drawback
Conclusion
References
uses genetic techniques to construct maps showing the positions of genes and other sequence features on a genome.
Genetic techniques include cross-breeding experiments or, in the case of humans, the examination of family histories (pedigrees).
A genetic marker is a gene or DNA sequence with a known location on a chromosome that can be used to identify individuals or species. It can be described as a variation (which may arise due to mutation or alteration in the genomic loci) that can be observed. A genetic marker may be a short DNA sequence, such as a sequence surrounding a single base-pair change (single nucleotide polymorphism, SNP), or a long one, like minisatellites.
Transcriptomics is the study of RNA, single-stranded nucleic acid, which was not separated from the DNA world until the central dogma was formulated by Francis Crick in 1958, i.e., the idea that genetic information is transcribed from DNA to RNA and then translated from RNA into protein.
Techniques based on the principle of selectively amplifying a subset of restriction fragments from a complex mixture of DNA fragments obtained after digestion of genomic DNA with restriction endonucleases.
The technique of molecular biology like DNA isolation, RNA isolation, PCR, Western blot, RFLP, etc was developed with development in science. This presentation includes the method of DNA and RNA isolation and their Quantification techniques.
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...journal ijrtem
Abstract: The present study addresses this issue by examining the patterning of Cytochrome Oxidase I diversity in the stone fish Uranoscopus oligolepis the structurally diverse group of Family Uranoscopidae. The sequences were analyzed for their species identification using BOLD’s identification engine. The COI sequences of U. oligolepis from different geographical regions were extracted from NCBI for intra species variation analysis. All sequences were aligned using Clustal W. The sequences were trimmed using software and phylogenetic tree was constructed with bootstrap test. The results showed that the cytosine content was high (31%). The least molar concentration was observed in guanine (19.5%) and Adenine (19.6%). Thymine was the second predominant in molar concentration next to thymine which is followed by adenine. The G+C content was found to be 49.6% and A+T content was 50.4%. Leucine and Alanine content was high in the amino acid composition. From the study it is assumed that the mitochondrial gene COI can be the potential barcoding region to identify an organism up to the species level. Keywords: COI, intra species, Uranoscopus oligolepis, barcoding, phylogenetic
DNA Fingerprinting for Taxonomy and Phylogeny.pptxsharanabasapppa
Deoxyribonucleic acid, a self-replicating material which is present in all living organisms as the main constituent of chromosomes.
DNA is made up of molecules called nucleotides. Each nucleotide contains a phosphate group, a sugar group and a nitrogen base.
The four types of nitrogen bases are adenine (A), thymine (T), guanine (G) and cytosine (C). The order of these bases is what determinesDNA's instructions, or genetic code.
A gene knockout is a genetic technique in which one of an organism's genes is made inoperative ("knocked out" of the organism). However, gene knockout can also refer to the gene that is knocked out or the organism that carries the gene knockout. Knockout organisms or simply knockouts are used to study gene function, usually by investigating the effect of gene loss. Researchers draw inferences from the difference between the knockout organism and normal individuals.
whole genome analysis
history
needs
steps involved
human genome data
NGS
pyrosequencing
illumina
SOLiD
Ion torrent
PacBio
applications
problems
benefits
The yak is one of the most enduring symbols of the high Himalayas. Whether you visit Tibet, Bhutan, India or Nepal, you will inevitably find tourist places with yaks for picture clicking and ride.
As the largest animal on the Tibetan plateau and its surrounding regions, the yak is a “flagship species”, and indicates the health of the ecosystem within which it lives.
Microsatellite are powerful DNA markers for quantifying genetic variations within & between populations of a species, also called as STR, SSR, VNTR. Tandemly repeated DNA sequences with the repeat/size of 1 – 6 bases repeated several times
Access and Benefit sharing from Genetic ResourcesKaran Veer Singh
Millions of people depend on biological (genetic) resources and traditional knowledge for their livelihoods. While the concept of an access and benefit sharing (ABS) regime is new, access to biological resources and transfer of associated traditional knowledge is centuries old.
Indian act on IPRs, CBD, Copyright Act, 1957
The Patents Act, 1970
The Geographical Indications of Goods (Registration and Protection) Act, 1999
The Trade Marks Act, 1999
The Designs Act, 2000
The Semiconductor Integrated Circuits Layout-Design Act, 2000
Protection of Plant Varieties and Farmers' Rights Act, 2001
Biological Diversity Act, 2002
Genome annotation, NGS sequence data, decoding sequence information, The genome contains all the biological information required to build and maintain any given living organism.
The quality of data is very important for various downstream analyses, such as sequence assembly, single nucleotide polymorphisms identification this ppt show parameters for
NGS Data quality check and Dataformat of top sequencing machine
RNA Sequence data analysis,Transcriptome sequencing, Sequencing steady state RNA in a sample is known as RNA-Seq. It is free of limitations such as prior knowledge about the organism is not required.
RNA-Seq is useful to unravel inaccessible complexities of transcriptomics such as finding novel transcripts and isoforms.
Data set produced is large and complex; interpretation is not straight forward.
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Normal Labour/ Stages of Labour/ Mechanism of LabourWasim Ak
Normal labor is also termed spontaneous labor, defined as the natural physiological process through which the fetus, placenta, and membranes are expelled from the uterus through the birth canal at term (37 to 42 weeks
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
The French Revolution, which began in 1789, was a period of radical social and political upheaval in France. It marked the decline of absolute monarchies, the rise of secular and democratic republics, and the eventual rise of Napoleon Bonaparte. This revolutionary period is crucial in understanding the transition from feudalism to modernity in Europe.
For more information, visit-www.vavaclasses.com
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Francesca Gottschalk - How can education support child empowerment.pptxEduSkills OECD
Francesca Gottschalk from the OECD’s Centre for Educational Research and Innovation presents at the Ask an Expert Webinar: How can education support child empowerment?
2. DNA BarcodingDNA Barcoding
DNA sequence analysis of a uniform target gene like
the mitochondrial cytochrome oxidase subunit I (COI)
to enable species identification has been referred to as
“DNA Barcoding”, by analogy with the Universal
Product Code (UPC) system barcodes used to identify
manufactured goods.
DNA barcoding has the potential to be a practical
method for identification of the estimated 10 million
species of eukaryotic life on earth.
Expected to work at all stages of life, resolve
taxonomic ambiguities, unmasks look-alikes and opens
the way for an electronic handheld field guide, ‘the life
barcoder’.
3. • An appropriate target gene like COI is conserved enough to
be amplified with broad range of primers and divergent
enough to allow discrimination of closely allied species and
it shows comparatively less sequence divergence within a
species compared to the fast evolving genes of mtDNA.
• Alternate target genes are needed for cnidarians ( Hard corals
and some jelly fishes) and plants as these groups show too
little mitochondrial sequence diversity.
• mtDNA of fungi contains introns that can complicate DNA
amplification. Fungi are usually defined based on
morphology rather than on genetic isolating mechanisms.
Thus, the boundaries between named species may not always
correspond with the boundaries of the gene pool. In addition
fungi display a wide range of reproductive strategies,
including sexual, asexual and parasexual (a form of reproduction
in which recombination of genes from different individuals occurs without
meiosis and fertilization) reproduction. Furthermore, hyphal
anastomoses between different strains and morphospecies
make the application of a conventional species definition
especially difficult.
• Global effort, recently initiated to compile DNA barcodes of
all known eukaryotes along with collection of voucher
specimens with authoritative taxonomic identification.
5. An Internal ID System for All Animals
Typical Animal Cell
Mitochondrion
DNA
mtDNA
Cytochrome b
The Mitochondrial Genome
D-Loop
H-strand
COIII
L-strand
ND6
ND2
COII
Small ribosomal RNA
COI
Cytb
Target
Region
DNA Barcoding – A target region
6. • DNA “Barcode”
• 4 states
• 655 positions
• Universal Product Code
• 10 state
• 11 positions
DNA-based identification system:
DNA Barcoding – The idea
15. Primer Name Sequence (5’ – 3’)
18SrRNA forward AACCTGGTTGATCCTGCCAGT
18SrRNA reverse TGATCCTTCTGCAGGTTCACCTAC
Barcoding Electives – other genes
16. Producing Barcode Data: 2006Producing Barcode Data: 2006
ABI 3100 capillary
automated sequencer
• Hundreds of samples per day
• costing several dollars per sample
17. Producing Barcode Data: 2008Producing Barcode Data: 2008
Faster, more portable: Hundreds of samples per hour
Integrated DNA microchips Table-top microfluidic systems
18. Producing Barcode Data: 2010?
Hand-held BarcoderHand-held Barcoder
Barcode data anywhere, instantly
Data in seconds to
minutes
Pennies per sample
Link to reference
database
A taxonomic GPS
Usable by non-
specialists
19. A Field Guide for the Third Millennium
Consortium site:
www.cbol.org
Rock U site with Barcode Blog
http://phe.rockefeller.edu/
barcod/
Guelph site:
www.barcodinglife.org
21. First International Training on “DNA Barcoding ofFirst International Training on “DNA Barcoding of
Marine Life” organized at NBFGR, Lucknow, IndiaMarine Life” organized at NBFGR, Lucknow, India