The document provides information about Marwan Alhalabi, a professor of reproductive medicine and clinical director of an assisted reproduction center in Damascus, Syria. It then discusses the human genome project, including its goals to sequence human DNA and identify genes. It explains key concepts such as genes, genomes, DNA, RNA, transcription and translation. The rest of the document outlines various applications and ethical considerations of genomic research.
The study of nucleic acids began with the discovery of DNA, progressed to the study of genes and small fragments, and has now exploded to the field of genomics. Genomics is the study of entire genomes, including the complete set of genes, their nucleotide sequence and organization, and their interactions within a species and with other species. The advances in genomics have been made possible by DNA sequencing technology. [Source: https://opentextbc.ca/biology/chapter/10-3-genomics-and-proteomics/]
It is the DNA located in the mitochondria.Mitochondrial DNA (mtDNA or mDNA) is the DNA located in the mitochondria.
They are double stranded circular DNA molecule.
It is only 16 kb in length – contains 16,600 bp.
It is haploid in nature.
It codes for 37 genes.
13 genes provide instructions for making enzymes involved in oxidative phosphorylation.
It is a process that uses oxygen and simple sugars to create ATP, the cells main energy source.
The study of nucleic acids began with the discovery of DNA, progressed to the study of genes and small fragments, and has now exploded to the field of genomics. Genomics is the study of entire genomes, including the complete set of genes, their nucleotide sequence and organization, and their interactions within a species and with other species. The advances in genomics have been made possible by DNA sequencing technology. [Source: https://opentextbc.ca/biology/chapter/10-3-genomics-and-proteomics/]
It is the DNA located in the mitochondria.Mitochondrial DNA (mtDNA or mDNA) is the DNA located in the mitochondria.
They are double stranded circular DNA molecule.
It is only 16 kb in length – contains 16,600 bp.
It is haploid in nature.
It codes for 37 genes.
13 genes provide instructions for making enzymes involved in oxidative phosphorylation.
It is a process that uses oxygen and simple sugars to create ATP, the cells main energy source.
A detail ppt about Genome organization with focus on all levels of organization. Most recent research and findings about CT is also added in this ppt. Detail account of 30nm fiber and its ultra structure and types is also included.
The Human Genome Project (HGP) was an international scientific research project with the goal of determining the base pairs that make up human DNA, and of identifying and mapping all of the genes of the human genome from both a physical and a functional standpoint.
this is done by me and my team mates of Wayamba University Sri Lanka for our project.From now we decided to allow download this file.I would be greatful if you could send your comments..
And I'm willing to help you in similar works.I'm in final year of my degree(.BSc Biotechnology)..
pubudu_gokarella@yahoo.com
Epigenetics is the study, in the field of genetics, of cellular and physiological phenotypic trait variations that are caused by external or environmental factors that switch genes on and off and affect how cells read genes instead of being caused by changes in the DNA sequence. -Wikipedia
What is Genome,Genome mapping,types of Genome mapping,linkage or genetic mapping,Physical mapping,Somatic cell hybridization
Radiation hybridization ,Fish( =fluorescence in - situ hybridization),Types of probes for FISH,applications,Molecular markers,Rflp(= Restriction fragment length polymorphism),RFLPs may have the following Applications;Advantages of rflp,disAdvantages of rflp, Rapd(=Random amplification of polymorphic DNA),Process of rapd, Difference between rflp &rapd
Human Genome Project (HGP) was an international scientific research project with the goal of determining the base pairs that make up human DNA, and of identifying and mapping all of the genes of the human genome from both a physical and a functional
A detail ppt about Genome organization with focus on all levels of organization. Most recent research and findings about CT is also added in this ppt. Detail account of 30nm fiber and its ultra structure and types is also included.
The Human Genome Project (HGP) was an international scientific research project with the goal of determining the base pairs that make up human DNA, and of identifying and mapping all of the genes of the human genome from both a physical and a functional standpoint.
this is done by me and my team mates of Wayamba University Sri Lanka for our project.From now we decided to allow download this file.I would be greatful if you could send your comments..
And I'm willing to help you in similar works.I'm in final year of my degree(.BSc Biotechnology)..
pubudu_gokarella@yahoo.com
Epigenetics is the study, in the field of genetics, of cellular and physiological phenotypic trait variations that are caused by external or environmental factors that switch genes on and off and affect how cells read genes instead of being caused by changes in the DNA sequence. -Wikipedia
What is Genome,Genome mapping,types of Genome mapping,linkage or genetic mapping,Physical mapping,Somatic cell hybridization
Radiation hybridization ,Fish( =fluorescence in - situ hybridization),Types of probes for FISH,applications,Molecular markers,Rflp(= Restriction fragment length polymorphism),RFLPs may have the following Applications;Advantages of rflp,disAdvantages of rflp, Rapd(=Random amplification of polymorphic DNA),Process of rapd, Difference between rflp &rapd
Human Genome Project (HGP) was an international scientific research project with the goal of determining the base pairs that make up human DNA, and of identifying and mapping all of the genes of the human genome from both a physical and a functional
MT115 Precision Medicine: Integrating genomics to enable better patient outcomesDell EMC World
"The emergence of genomics and real-time screening is helping to transform the practice of medicine as we know it today. New technologies present improved ways to tackle health issues and what was once thought to be “untouchable” due to cost, timing or resources, is now achievable through genetic screenings and genome sequencing.
During this session, we will explore:
1. The benefits of incorporating a genomics strategy early in lifeline
2. The Precision Medicine Initiative – how does this help? Does this encourage more people to get genetic screenings?
3. What’s involved in a genetic screening
"
The original human genome was sequenced over 15 years with a multi billion dollar budget. This talk describes how Ruby and Rails are helping sequence the next 1000 genomes in the next 15 months.
HGP was conceived in 1984 & officially begun in earnest in October 1990.
HGP is a large multicentric, international collaborative venture, the main aim of which is to determine the nucleotide sequence of the entire human nuclear genome.
In 1997, United States established the National Human Genome Research Institute (NHGRI).
The HGP was an international research groups from six countries- USA, UK, France, Germany, Japan and China, & several laboratories and a large no. of scientists and technicians from various disciplines.
DNA fingerprint methods. • The locations for genes for specific traits such as egg number, body weight or carcass quality can be identified using markers and then they can be selected directly.
Genetics and heredity in orthodontics/certified fixed orthodontic courses by...Indian dental academy
The Indian Dental Academy is the Leader in continuing dental education , training dentists in all aspects of dentistry and offering a wide range of dental certified courses in different formats.
Indian dental academy provides dental crown & Bridge,rotary endodontics,fixed orthodontics,
Dental implants courses.for details pls visit www.indiandentalacademy.com ,or call
0091-9248678078
The role of DNA methylation in complex diseasesJordana Bell
A 1-hour lecture to 4th-year undergraduate and/or MSc students in human genetics, focusing on exploring the role of DNA methylation in human complex disease.
Early embryology - أطلس علم الجنين البشري الباكرMarwan Alhalabi
كتاب “ أطلس علم الجنين البشري الباكر “ للأستاذ الدكتور مروان الحلبي النائب العلمي لكلية الطب بجامعة دمشق و أستاذ طب الإخصاب والجنين والوراثة ..والدكتور حمدي نوفل الاختصاصي في طب الجنين والوراثة وعضو الهيئة التدريسية في كلية الطب بجامعة حلب .. والذي يقدم الأسس الضرورية واللازمة لممارسة طب الإخصاب ومعالجة العقم إضافة إلى العاملين في مختبرات أطفال الأنابيب .. والله من وراء القصد .
Handbooks of COVID-19 - الدليل الطبي المتكامل حول مرض فيروس كوروناMarwan Alhalabi
تم بعونه تعالى إصدار هذا الكتيب (Handbooks of COVID-19 - الدليل الطبي المتكامل حول مرض فيروس كورونا) عن آخر وأحدث التطورات حول داء كورونا المستجد COVID-19: الآلية الإمراضية والتشخيص والوقاية والعلاج .. والذي يوثق الخبرة السريرية لكل المراكز العالمية المتطورة في الوقاية والتشخيص والعلاج والتي نشرت في أهم المجلات الطبية المحكمة بهدف التصدي لهذا المرض .. تمت مراجعته وإعداده بإشراف الأستاذ الدكتور مروان الحلبي النائب العلمي لكلية الطب من قبل مجموعة من طلاب كلية الطب البشري في جامعة دمشق ...حيث ينقل هذا الكتاب أحدث التطورات في المعرفة و الخبرة السريرية الناجحة في تدبير هذا المرض ويختصر على الطواقم الطبية في وطننا الحبيب والدول العربية عناءً كان ثمنه الأرواح ليكون سلاحاً في يديّ مقدمي الخدمات الطبية ضد هذا الوباء الوخيم … كقيمة مضافة للمكتبة الطبية العربية
The content of this book extends beyond the curricula of most medicine, health and bioscience teaching programmes in terms of breadth, but we have limited its depth. Many embryology textbooks cover development in detail, but students struggle to get started,and to get to grips with early concepts. Hopefully we have addressed these difficulties with this book.
هذا الكتيب إعرف عدوك عن آخر وأحدث التطورات حول داء كورونا المستجد الآلية الإمراضية والتشخيص والوقاية والعلاج .. والذي يوثق الخبرة السريرية لكل المراكز العالمية المتطورة في الوقاية والتشخيص والعلاج والتي نشرت في أهم المجلات الطبية المحكمة بهدف التصدي لهذا المرض .. تمت مراجعته وإعداده بإشراف الأستاذ الدكتور مروان الحلبي النائب العلمي لكلية الطب من قبل مجموعة من طلاب كلية الطب البشري في جامعة دمشق ...حيث ينقل هذا الكتاب أحدث التطورات في المعرفة و الخبرة السريرية الناجحة في تدبير هذا المرض ويختصر على الطواقم الطبية في وطننا الحبيب والدول العربية عناءً كان ثمنه الأرواح ليكون سلاحاً في يديّ مقدمي الخدمات الطبية ضد هذا الوباء الوخيم … كقيمة مضافة للمكتبة الطبية العربية
دلائل الإرشاد السريعة لـ COVID-19 - COVID-19 Rapid GuidelinesMarwan Alhalabi
دلائل الإرشاد السريعة من NICE لـ COVID-19
بإشراف: أ. د. مروان الحلبي
ترجمة وإعداد:
د. محمد أيهم محسن
د. نورس الحلبي
د. سهى القاسمي
د. محمد ناصر خطاب
د. عهد حمد
د. محمد الجراد
د. عامر قطان
نيسان 2020
كتيب عن داء كورونا المستجد COVID-19 الوقاية والعلاج - Handbook of COVID-19: P...Marwan Alhalabi
المستشفى الأول التابع لكلية الطب في جامعة Zhejiang
تمَّ تجميعه وفقاً للخبرة السريرية
نقله إلى العربية مجموعة من الأطباء وطلاب كلية الطب البشري بجامعة دمشق
بإشراف الأستاذ الدكتور مروان الحلبي
مرض كورونا المستجد: الدليل الإرشادي في الوقاية والتشخيص والعلاج - Guidance fo...Marwan Alhalabi
كلية الطب - جامعة دمشق
بإشراف الأستاذ الدكتور مروان الحلبي
ترجمة وإعداد:
الدكتور حسام النجم
الدكتور لبيب شاويش
الدكتورة آية ابراهيم
الدكتور مناف جاسم
الدكتور مضاء النجم
الدكتور نورس الحلبي
الدكنورة رهام محمد
الدكتورة لوليا خميس
الدكتور محمد حمود
الدكتور أحمد ابراهيم
الدكتورة باسمة شلغين
آذار 2020
Supervised by: Prof Marwan Alhalabi
review the evidence (RCT & meta-analyses) concerning the best practices in contemporary Recurrent Pregnancy Loss and Thrombophilia depending on Eshre guideline 2017 and other EBM sources.
HOT NEW PRODUCT! BIG SALES FAST SHIPPING NOW FROM CHINA!! EU KU DB BK substit...GL Anaacs
Contact us if you are interested:
Email / Skype : kefaya1771@gmail.com
Threema: PXHY5PDH
New BATCH Ku !!! MUCH IN DEMAND FAST SALE EVERY BATCH HAPPY GOOD EFFECT BIG BATCH !
Contact me on Threema or skype to start big business!!
Hot-sale products:
NEW HOT EUTYLONE WHITE CRYSTAL!!
5cl-adba precursor (semi finished )
5cl-adba raw materials
ADBB precursor (semi finished )
ADBB raw materials
APVP powder
5fadb/4f-adb
Jwh018 / Jwh210
Eutylone crystal
Protonitazene (hydrochloride) CAS: 119276-01-6
Flubrotizolam CAS: 57801-95-3
Metonitazene CAS: 14680-51-4
Payment terms: Western Union,MoneyGram,Bitcoin or USDT.
Deliver Time: Usually 7-15days
Shipping method: FedEx, TNT, DHL,UPS etc.Our deliveries are 100% safe, fast, reliable and discreet.
Samples will be sent for your evaluation!If you are interested in, please contact me, let's talk details.
We specializes in exporting high quality Research chemical, medical intermediate, Pharmaceutical chemicals and so on. Products are exported to USA, Canada, France, Korea, Japan,Russia, Southeast Asia and other countries.
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Ve...kevinkariuki227
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
micro teaching on communication m.sc nursing.pdfAnurag Sharma
Microteaching is a unique model of practice teaching. It is a viable instrument for the. desired change in the teaching behavior or the behavior potential which, in specified types of real. classroom situations, tends to facilitate the achievement of specified types of objectives.
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdfAnujkumaranit
Artificial intelligence (AI) refers to the simulation of human intelligence processes by machines, especially computer systems. It encompasses tasks such as learning, reasoning, problem-solving, perception, and language understanding. AI technologies are revolutionizing various fields, from healthcare to finance, by enabling machines to perform tasks that typically require human intelligence.
Report Back from SGO 2024: What’s the Latest in Cervical Cancer?bkling
Are you curious about what’s new in cervical cancer research or unsure what the findings mean? Join Dr. Emily Ko, a gynecologic oncologist at Penn Medicine, to learn about the latest updates from the Society of Gynecologic Oncology (SGO) 2024 Annual Meeting on Women’s Cancer. Dr. Ko will discuss what the research presented at the conference means for you and answer your questions about the new developments.
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...VarunMahajani
Disruption of blood supply to lung alveoli due to blockage of one or more pulmonary blood vessels is called as Pulmonary thromboembolism. In this presentation we will discuss its causes, types and its management in depth.
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
Flu Vaccine Alert in Bangalore Karnatakaaddon Scans
As flu season approaches, health officials in Bangalore, Karnataka, are urging residents to get their flu vaccinations. The seasonal flu, while common, can lead to severe health complications, particularly for vulnerable populations such as young children, the elderly, and those with underlying health conditions.
Dr. Vidisha Kumari, a leading epidemiologist in Bangalore, emphasizes the importance of getting vaccinated. "The flu vaccine is our best defense against the influenza virus. It not only protects individuals but also helps prevent the spread of the virus in our communities," he says.
This year, the flu season is expected to coincide with a potential increase in other respiratory illnesses. The Karnataka Health Department has launched an awareness campaign highlighting the significance of flu vaccinations. They have set up multiple vaccination centers across Bangalore, making it convenient for residents to receive their shots.
To encourage widespread vaccination, the government is also collaborating with local schools, workplaces, and community centers to facilitate vaccination drives. Special attention is being given to ensuring that the vaccine is accessible to all, including marginalized communities who may have limited access to healthcare.
Residents are reminded that the flu vaccine is safe and effective. Common side effects are mild and may include soreness at the injection site, mild fever, or muscle aches. These side effects are generally short-lived and far less severe than the flu itself.
Healthcare providers are also stressing the importance of continuing COVID-19 precautions. Wearing masks, practicing good hand hygiene, and maintaining social distancing are still crucial, especially in crowded places.
Protect yourself and your loved ones by getting vaccinated. Together, we can help keep Bangalore healthy and safe this flu season. For more information on vaccination centers and schedules, residents can visit the Karnataka Health Department’s official website or follow their social media pages.
Stay informed, stay safe, and get your flu shot today!
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
Explore natural remedies for syphilis treatment in Singapore. Discover alternative therapies, herbal remedies, and lifestyle changes that may complement conventional treatments. Learn about holistic approaches to managing syphilis symptoms and supporting overall health.
Couples presenting to the infertility clinic- Do they really have infertility...Sujoy Dasgupta
Dr Sujoy Dasgupta presented the study on "Couples presenting to the infertility clinic- Do they really have infertility? – The unexplored stories of non-consummation" in the 13th Congress of the Asia Pacific Initiative on Reproduction (ASPIRE 2024) at Manila on 24 May, 2024.
Recomendações da OMS sobre cuidados maternos e neonatais para uma experiência pós-natal positiva.
Em consonância com os ODS – Objetivos do Desenvolvimento Sustentável e a Estratégia Global para a Saúde das Mulheres, Crianças e Adolescentes, e aplicando uma abordagem baseada nos direitos humanos, os esforços de cuidados pós-natais devem expandir-se para além da cobertura e da simples sobrevivência, de modo a incluir cuidados de qualidade.
Estas diretrizes visam melhorar a qualidade dos cuidados pós-natais essenciais e de rotina prestados às mulheres e aos recém-nascidos, com o objetivo final de melhorar a saúde e o bem-estar materno e neonatal.
Uma “experiência pós-natal positiva” é um resultado importante para todas as mulheres que dão à luz e para os seus recém-nascidos, estabelecendo as bases para a melhoria da saúde e do bem-estar a curto e longo prazo. Uma experiência pós-natal positiva é definida como aquela em que as mulheres, pessoas que gestam, os recém-nascidos, os casais, os pais, os cuidadores e as famílias recebem informação consistente, garantia e apoio de profissionais de saúde motivados; e onde um sistema de saúde flexível e com recursos reconheça as necessidades das mulheres e dos bebês e respeite o seu contexto cultural.
Estas diretrizes consolidadas apresentam algumas recomendações novas e já bem fundamentadas sobre cuidados pós-natais de rotina para mulheres e neonatos que recebem cuidados no pós-parto em unidades de saúde ou na comunidade, independentemente dos recursos disponíveis.
É fornecido um conjunto abrangente de recomendações para cuidados durante o período puerperal, com ênfase nos cuidados essenciais que todas as mulheres e recém-nascidos devem receber, e com a devida atenção à qualidade dos cuidados; isto é, a entrega e a experiência do cuidado recebido. Estas diretrizes atualizam e ampliam as recomendações da OMS de 2014 sobre cuidados pós-natais da mãe e do recém-nascido e complementam as atuais diretrizes da OMS sobre a gestão de complicações pós-natais.
O estabelecimento da amamentação e o manejo das principais intercorrências é contemplada.
Recomendamos muito.
Vamos discutir essas recomendações no nosso curso de pós-graduação em Aleitamento no Instituto Ciclos.
Esta publicação só está disponível em inglês até o momento.
Prof. Marcus Renato de Carvalho
www.agostodourado.com
2. • The Human Genome
Project goals :
• To determine the
nucleotide sequence all
DNA in the human
genome.
• To identify the location
and sequence of every
human gene.
3. • Genome: All of
the DNA for an
organism
• Human Genome
• Nucleus: 3 billion base
pairs packaged into
chromosomes
• Mitochondrion: 16,600
base pairs packaged in
one circular
chromosome
9. 1. Transcriptional control sequences:
bind transcription factors that can activate or inhibit
transcription
2. Promoter: recruits RNA polymerase and marks the
start of the transcribed region
3. Transcript: corresponds to the RNA sequence
Can be further subdivided into:
4. Termination sequences: required to terminate
transcription
10. • DNA copy itself:
• Replication
• DNA synthesize RNA
• Transcription
• RNA synthesize protein
• Translation
Two Main Process:
Transcription and Translation
11. DNA
molecule
Gen
e 1
Gene 2
Gene 3
DNA strand
TRANSCRIPTION
RNA
Polypeptide
TRANSLATION
Codon
Amino acid
Central Dogma of Biology
— How does the information flow in biological systems?
12. The central dogma of biology is
that information stored in DNA
is transferred to RNA molecules
during transcription and to
proteins during translation.
13. Work to keep the
cell alive
DNA
RNA Protein
Transcription Translation
Carries the
directions to the
cytoplasm
Directions to make
proteins are safely
stored in the nucleus
20. • These result in ploidy changes.
• Aneuploidy.
• Plus or minus one or a few chromosomes.
3n or more = polyploidy
n = haploid (gametes)
2n = diploid (normal individual)
31. •Greater accuracy in identifying
the suspect of a crime by
matching their DNA profile with
that of any body tissue found at
the scene of the crime.
•Paternity testing and other
family relationships.
•Exoneration of individual falsely
accused of a crime.
•Determine pedigree for seed or
livestock breeds
32.
33. •Assess health damage and risks caused by radiation exposure, including
low-dose exposures .
•Assess health damage and risks caused by exposure to mutagenic
chemicals and cancer-causing toxins.
•Reduce the likelihood ofheritable mutations.
35. • Planned in 1988.
• Begun formally in 1990.
• Originally planned to last 15
years, but rapid
technological advances
accelerated completion
date to 2003.
• Announced è 97%
finished in 2000
• Final HGP papers were
published in 2006.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45. • Human genome has a
lot of “junk” so what is
the value of sequencing
it?
• Is it too expensive?
• HGP cost ~ $3 billion
dollars. About $1 per
base pair.
79. CACACTTGCATGTGAGAGCTTCTAATATCTAAATTAATGTTGAATCATTATTCAGAAACAGAGAGCTAACTGTTATCCCATCCTGACTTTATTCTTTATG
AGAAAAATACAGTGATTCC
AAGTTACCAAGTTAGTGCTGCTTGCTTTATAAATGAAGTAATATTTTAAAAGTTGTGCATAAGTTAAAATTCAGAAATAAAACTTCATCCTAAAACTCTGTGTGTTGCTTTAAATAAT
C
AGAGCATCTGC TACTTAATTTTTTGTGTGTGGGTGCACAATAGATGTTTAATGAGATCCTGTCATCTGTCTGCTTTTTTATTGTAAAACAGGAGGGGTTTTAATACTGGAGGAACAA
CTGATGTACCTCTGAAAAGAGA AGAGATTAGTTATTAATTGAATTGAGGGTTGTCTTGTCTTAGTAGCTTTTATTCTCTAGGTACTATTTGATTATGATTGTGAAAATAGAATTTATCC
CTCATTAAATGTAAAATCAACAGGAGAATAGCAAAAACTTATGAGATAGATGAACGTTGTGTGAGTGGCATGGTTTAATTTGTTTGGAAGAAGCACTTGCCCCAGAAGATACACA
AT
GAAATTCATGTTATTGAGTAGAGTAGTAATACAGTGTGTTCCCTTGTGAAGTTCATAACCAAGAATTTTAGTAGTGGATAGGTAGGCTGAATAACTGACTTCCTATC ATTTTCAGGTT
CTGCGTTTGATTTTTTTTACATATTAATTTCTTTGATCCACATTAAGCTCAGTTATGTATTTCCATTTTATAAATGAAAAAAAATAGGCACTTGCAAATGTCAGATCACTTGCCTGTGGT
CATTCGGGTAGAGATTTGTGGAGCTAAGTTGGTCTTAATCAAATGTCAAGCTTTTTTTTTTCTTATAAAATATAGGTTTTAATATGAGTTTTAAAATAAAATTAATTAGAAAAAGGCA
A
ATTACTCAATATATATAAGGTATTGCATTTGTAATAGGTAGGTATTTCATTTTCTAGTTATGGTGGGATATTATTCAGACTATAATTCCCAATGAAAAAACTTTAAAAAATGCTAGTG
A
TTGCACACTTAAAACACCTTTTAAAAAGCATTGAGAGCTTATAAAATTTTAATGAGTGATAAAACCAAATTTGAAGAGAAAAGAAGAACCCAGAGAGGTAAGGATATAACCTTAC
C
AGTTGCAATTTGCCGATCTCTACAAATATTAATATTTATTTTGACAGTTTCAGGGTGAATGAGAAAGAAACCAAAACCCAAGACTAGCATATGTTGTCTTCTTAAGGAGCCCTCCCC
T
AAAAGATTGAGATGACCAAATCTTATACTCTCAGCATAAGGTGAACCAGACAGACCTAAAGCAGTGGTAGCTTGGATCCACTACTTGGGTTTGTGTGTGGCGTGACTCAGGTAATC
T
CAAGAATTGAACATTTTTTTAAGGTGGTCCTACTCATACACTGCCCAGGTATTAGGGAGAAGCAAATCTGAATGCTTTATAAAAATACCCTAAAGCTAAATCTTACAATATTCTCAA
G
AACACAGTGAA ACAAGGCAAAATAAGTTAAAATCAACAAAAACAACATGAAACATAATTAGACACACAAAGACTTCAAACATTGGAAAATACCAGAGAAAGATAATAAATAT
TTTACTCTTTAAAAATTTAGTTAAAAGCTTAAACTAATTGTAGAGAAAA
AACTATGTTAGTATTATATTGTAGATGAAATAAGCAAAACATTTAAAATACAAATGTGATTACTTAAAT
TAAATATAATAGATAATTTACCACCAGATTAGATACCATTGAAGGAATAATTAATATACTGAAATACAGGTCAGTAGAATTTTTTTCAATTCAGCATGGAGATGTAAAAAATGAAA
A
TTAATGCAAAAAATAAGGGCACAAAAAGAAATGAGTAATTTTGATCAGAAATGTATTAAAATTAATAAACTGGAAATTTGACATTTAAAAAAAGCATTGTCATCCAAGTAGATGT
G
TCTATTAAATAGTTGTTCTCATATCCAGTAATGTAATTATTATTCCCTCTCATGCAGTTCAGATTCTGGGGTAATCTTTAGACATCAGTTTTGTCTTTTATATTATTTATTCTGTTTACTA
C
ATTTTATTTTGCTAATGATATTTTTAATTTCTGACATTCTGGAGTATTGCTTGTAAAAGGTATTTTTAAAAATACTTTATGGTTATTTTTGTGATTCCTATTCCTCTATGGACACCAAGGC
T
ATTGACATTTTCTTTGGTTTCTTCTGTTACTTCTATTTTCTTAGTGTTTATATCATTTCATAGATAGGATATTCTTTATTTTTTATTTTTATTTAAATATTTGGTGATTCTTGGTTTTCTCAGC
C
ATCTATTGTCAAGTGTTCTTATTAAGCATTATTATTAAATAAAGATTATTTCCTCTAATCACATGAGAATCTTTATTTCCCCCAAGTAATTGAAAATTGCAATGCCATGCTGCCATGTG
G
TACAGCATGGGTTTGGGCTTGCTTTCTTCTTTTTTTTTTAACTTTTATTTTAGGTTTGGGAGTACCTGTGAAAGTTTGTTATATAGGTAAACTCGTGTCACCAGGGTTTGTTGTACAGATC
A
TTTTGTCACCTAGGTACCAAGTACTCAACAATTATTTTTCCTGCTCCTCTGTCTCCTGTCACCCTCCACTCTCAAGTAGACTCCGGTGTCTGCTGTTCCATTCTTTGTGTCCATGTGTTCT
C
ATAATTTAGTTCCCCACTTGTAAGTGAGAACATGCAGTATTTTCTAGTATTTGGTTTTTTGTTCCTGTGTTAATTTGCCCAGTATAATAGCCTCCAGCTCCATCCATGTTACTGCAAAGA
A
CATGATCTCATTCTTTTTTATAGCTCCATGGTGTCTATATACCACATTTTCTTTATCTAAACTCTTATTGATGAGCATTGAGGTGGATTCTATGTCTTTGCTATTGTGCATATTGCTGCAA
G
AACATTTGTGTGCATGTGTCTTTATGGTAGAATGATATATTTTCTTCTGGGTATATATGCAGTAATGCGATTGCTGGTTGGAATGGTAGTTCTGCTTTTATCTCTTTGAGGAATTGCCAT
G
CTGCTTTCCACAATAGTTGAACTAACTTACACTCCCACTAACAGTGTGTAAGTGTTTCCTTTTCTCCACAACCTGCCAGCATCTGTTATTTTTTGACATTTTAATAGTAGCCATTTTAAC
5000 bases per page
84. • The human genome is nearly the same in
all people (99.9%).
• Only 2% of the genome contains genes.
• Humans have an estimated 20,500 genes,
half of which are still unknown.
• Half of all human proteins share
similarities with those of other organisms.