SlideShare a Scribd company logo
Human Genome Project Determine the entire sequence of the human genome. 3 billion base pairs Problem: It’s really big!
Genome Sequencing As of 6/ 25/ 04 1128 genome projects: 199  complete (includes 28 eukaryotes) 508  prokaryotic genomes in progress 421  eukaryotic genomes in progress smallest: archaebacterium  Nanoarchaeum equitans  500 kb Bacillus anthracis  (anthrax)  5228 kb S. cerivisiae  (yeast)  12,069 kb Arabidopsis thaliana  115,428 kb Drosophila melanogaster  (fruit fly)  137,000 kb Anopheles gambiae  (malaria mosquito)  278,000 kb Oryza sativa  (rice)  420,000 kb Mus musculus  (mouse)  2,493,000 kb Homo sapiens  (human)  2,900,000 kb http:// www. genomesonline. org/ 1980 -  $10/bp 2001 -  $0.1 / bp S. cerevisiae 200x H. sapiens 200x A. dubia
 
Human Genome Project timeline E. coli   Drosophila   C. elegans   Yeast NRC Recommends HGP U.S. HGP Begins 1990 1995 2000 Human Gene Map (16,000 genes) Human Gene Map (30,181 genes) Goal for Human  Genetic Map Exceeded Physical Map Covers 98% of Genome Pilot Human  Sequencing Begins Full-Scale Human  Sequencing Begins Human draft   Phil Hieter
Completion of the genome 4-5 coverage 9x coverage 99.99 % acc GenBank entries double every 18 months “ Working Draft”  “ Complete”
Completion of the genome The current genome sequence (Build 35) contains  2.85  billion nucleotides interrupted by only  341  gaps.  It covers approximately  99%  of the euchromatic genome and is accurate to an error rate of approximately  1 event per 100,000  bases. Human genome seems to encode only  20,000-25,000  protein-coding genes   International   Human   Genome   Sequencing   Consortium . Finishing the euchromatic sequence of the human genome. Nature  2004  Oct 21;431(7011):931-45.
Institutes  that produced 85 % of the sequence 1. Whitehead Institute for Biomedical Research , Center for Genome  Research, Cambridge, MA 2.  The Sanger Centre , Cambridge, UK 3.  Washington University Genome Sequencing Center , St. Louis, MI 4.  US Department of Energy , JGI, Walnut Creek, CA 5.  Baylor College of Medicine Human Genome Sequencing Center ,  Houston, TX Countries: USA, UK, Japan, Germany, China, France
Genome Sequencing Genome: 3 Gb Cut genome into large pieces Clone into BACs: 100 kb Order based on sequence features ( markers ) = mapping Cut again Sequence AGAACAGGACGTATGTGGT TGTGGTTTTCTACTCC CTACTCCTGTGTT TTGTAAGTGAGAACA Assemble each BAC … TTGTAAGTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTT… Assemble entire sequence
 
 
 
What does the sequence mean? TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGTCATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACATACAAAATAATACCTCAGTGTAACCTCTGTTTGTATTTCCCTTGATTAACTGATGCTGAGCACATCTTCATGTGCTTATTGACCATTAATTAGTCTTATTTGTTAAATGTCTCAAATATTTTATACAGTTTTACATTGTGTTATTCATTTTTTAAAAAATTCATTTTAGGTTATATGTATGTGTGTGTCAAAGTGTGTGTACATCTATTTGATATATGTATGTCTATATATTCTGGATACCATCTCTGTTTCATGCATTGCATATATATTTGCCTATTTAGTGGTTTATCTTTTCATTTTCTTTTGGTATCTTTTCATTAGAAATGTTATTTATTTTGAGTAAGTAACATTTAATATATTCTGTAACATTTAATGAATCATTTTATGTTATGTTTAGTATTAAATTTCTGAAAACATTCTATGTATTCTACTAGAATTGTCATAATTTTATCTTTTATATACATTGATATTTTTATGTCAAATATGTAGGTATGTGATATTATGCACATGGTTTTAATTCAGTTAATTGTTCTTCCAGATGTTTGTACCATTCCAACATCATTTAAATCATTAAATGAAAAGCCTTTCCTTACTAGCTAGCCAGCTTTGAAAATCCATTCATAGGGTTTGTGTTAATATATTTTTGTTCTTTTTTTTCCTTTCTACTGATCTCTTTATATTAATACCTACTGTGGCTTTATATGAAGTCATGGAATAATACGTAGTAAGCCCTCTAACACTGTTCTGTTACTGTTGTTATTGTTTTCTCAGGGTACTTTGAAATATTCGAGATTTTATTATTTTTTAGTAGCCTAGATTTCAAGATTGTTTTGACGATCAATTTTTGAATCAATTGTCAATATTTTTAGTAATAAAATGATGATTTTTGATTGGAAATACATTAAATCTATAAGCCAAATTGGAGATTATTGATATATTAACAAAAATGAGTTTTCCAGTCCATGAATGTATGCACATTATAAAATTCATTCTTAAGTATGTCATTTTTTAAGTTTTAGTTTCAGCAGTATATGTTTGTTACATAGGTAAACTCCTGTCATGGGGGTTAGTTGTACAGGTTATTTTATCATCCAGGCATAAAGCCCAGTACCCAGTAGTTATCTTTTCTGCTCCTCTCCCTCCTGTCACCCTCCACTCTCAAGTAGACCCCAGTTTCTGTTGTTCTCTTCTTTGCATTAATGACTTCTCATCATTTAGATTGCACTTGTAAGTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTTAGTTTGCTAAGGATAACCACCTCCATCTCCATCCATGTTCCCACAAAAGACATGATCTCCTTTTTTATGGCTGCATATTATTCCATGGTATATATGTACCACATTTTCTTTATCCAATCTGTCATTGATGGACATTTAGGTTGTTTCCACATCATTGCCGTTGTAAATACTGCTGCAGTGAATATTCGTGTGTATGTCTTTATGGTAGAATGATTTATATTCCTCTGGGTATATTTCCAAGTAATGGGATGGTTGGGTCAAATGGTAATTCTGCTTTTAGCTTTTTGAGGAATTGCCATATTGCCTTTCACAACGGTTGAACTAATTTATACTCCCAAGAGTGTATAAGTTGTTCCTTTTTCTCTGCAACCTCGACATCACCTGTTATTTATGACTTTTATATAATAGCCATTCTGCTGGTCTGAGATGGTATCTCATTATGATTTTGATTTGCATTTCTCTAATGCTCAGTGATATTGAGCTTGGCTGCATATATGTCTTCTTTTAAAAATATCTGTTCATGTCCTTTGCCTAATTTATAACGGGGTTGTTTGTTTTTCTCTTGTAAATTTGTTTAAGTTCCTTATAGATTCTAGGTATTAAACCTTTTTTCAGAGGCGTGGCTTGCAAATATTTTCTCCCATTCTATAGGTTGTCTGTTTATTCTGTTGATAGTTTCCCTTGCTGTGCAGAAGCTCTTAACTTTAATTAGATCCGACTTGTCAATTTTTGCTTTGGTCGCAATTGCTTTTGATGTTATTGTCGTGAAATCTTTGCTAGTTCTTAGGTCCAGGATGATATTGCCCAAGTTGTCTTCCAGGGCTTTTATAATTTTGGATTTTACATTTAAGTCTTAATATATTTATTAAATTTGTTAGGGTTTCAGGATACAAGGACAATATAGCAGCAAACAATGTAAAAGTAAAATCTGAAAAATAATAGAAAACAGTTTAATTGAACACTTTACCATTATGTAATGCCCTTCTTTGTCTTTCCTGATCTTTGTTGGTTTGAAGTTCAAAAAAGACAAACTTAATGGTACAATAGGTATTGTAGATTTCAGGACTTTCTGTATAAAATATTTTGTATATATGAATAGATCATTTTTTATTTCCAGTCTTTAAACATTTTCTTAACATTTTCTTCTATTGCTTCACTTCACTCGCTAGGACCATCAGGACAGTGTTGAACAGAAATTGTCAGACTGATCATCACAACTTTTTCTAGATTTTAGAAGGAAATTTTTCTTTATTTCAACATAAAGCAGCATGTTAATGCCAAGTTTTAATATGTGTTATCAGATTGAAATTTTTTTGTATATTTCTACATTACCAAGAATTTTTAGCAAGAGTTTTTGTTGAGTTTTAATTTAAAAATCATTTGTTAATTTCATCTGATTTTTTTATTTCTCTTTTTACCTTAAGAGATTAAACTGACTACAGATTGAATATAAACAAACAAACAAACAAACAAAAACTCTAAAATGCTGTGGATCAACACCACTTAGTAATTTGTATACTTGGATTCAATTTGCTGAAATTTTGTTAGACATTTTTGCGTCGATATTTATGAGGGATGTTGATCTGTAAAAGTATTAAAATGCCTTTGACAGATTTTGATAGCAGTGTTATTCTGGCCTAATAAATCAAACTGAGGTATGATCCTTCCTTTTCTATTTCTTAATAGCATTTTTAAAATTGGTGGTTTTTTCCTTCCTTAGTGAAATTTACCAGCAAAGTAACAGGCCTTATATTTCTCTTGTGGAAATATTTTAATTTCAAATTAATGGTATTTTGTTCTTGTAGGGTGGTAATTTTCTCTGTGTTTGGTCTTAATGGACTCTTAGCTGATCACCCAGTTACTCAGCGAGGTCTCTTCACTCTGGAAGAGCTGGAACTCCAGTGTGTTTTAGTGCAGCATGACCACGGGTATTACCGTTCAACATTTAGGCTTTATCAGTGATAACTATTTGTCCTCATGGAGTTTTTGCCGCTGGGCCTACACAGTTTAGGCTTCAGCTTAGAACACATAATGAATTCTTATGCAGATTTCTGCCCACCTTTGACCTTTCATGATTTCCTCTTCTTGGGTAAGCTGCCTTATTAATCTGATACACTTCAGCAGTCCAGAACTACACTCTTTCCCTTCTCTGCTCTTGGAGATGACTCTTTTGTCTGAGATTCACTTTGCTGTGCTGAAAAAGAAAAGTGCTTCAAGGAAGATACCAAGGAAAATCACAGGGCTCATTTATGTATTTCTCTTCTTTCAAGGACTACAGCTTTGTGTTGCCTATGTTCAATTTCTGAAAATAATTAGAGCATATATACTCTGTGTGAGAAGGCAAATCCAGACAGTTAGTTTGTATGACTAGAAGCAGAAGTCTACATGGAGAATTTTACTTAACTGTGTTATAGTTTCTTTAATTATTTCAAGAGTATGTTTAATGTTCCACAGATCTCATTCTATAAATCTTTATCATCTTAGAGCTCTGATACTATTTAGAATTACTATTCCTTCAAATAAGAGATTAGAAACAGGGTTATATTTGGGGTAGGTTGACTTACTTTTCTGGGAACCAAAGCATATTAAATTGACCAGTTTTAACACACTTCTATGTATGCACAAAGATATATATTTACATTCTGCAAAATCATTCTTTCCTTTTTGAATTTGAAAAGGATCTTTGGTATACAGATATTCAATAGCCAGCCTGAAGATTCATTTGAATTCATTTAATGTTTAGATTCACTACATGAAATGATCCAGAAGAGAGTACTCAAATATAAGTATCTATAACGATGGAAATATACATCTCCACTGCCCAAGATGGTAGTCATGAGTCAATATTGATCATGTGAGACGTGGCAAGTGTTACTCAGGGTCTCAATATTTAAATGTATTAAGCTTTAATTAATGTAAATTTGAATTTAGCAAAACATGTATAGCTTGTGGTTACTGTTTTATTCAGTGCCAATATAGAACATTTCCATGATTACAGAAAGTTATCTTAGAATACTCAGTTCTGGACTATTTTATCTGGCTAAATTAAATGTTAAAATATTACAAATTCATCTTCAGGCTGGCTGTTGAATATTTTTATAGCAAAAGTCATTTATAAATTTAAAACTCAAATAATTATCTTTTTCAATATGTAAAATATGTCTTTACATATTCTACTCCCTTCTTACATACATATTCTGATGTAACATAGGTATTCTCTTATTCATGCACACTGAAATGACAACATAAATAATTTTACTAAGTGTCACCATATAAAAAACTTTGAACAAAATCAGATTATATCACTGTGGATATTTCTATTTTGAACTAACTTAGATGATAATTTTAATCTATATCCTAGATGAACTTTAAATCAATAAAATCTCTCAATGGTGTTATAAATCTCAAGCCATTAGCCACTGATTATCCCATTTTTATTCTTTTCATATTAATTTTATTGCCATGTATGAATGCTGTAGCATCCATGTTTAAATACTAGTTAACAAAATGCACTGGCATCAGATACAATAAGGATGAAATGAGATATAATTAGGACTCTGGTAACACACATAAAATTGGAAAGATACCCTGAAATTCAAGCCAAGAAGATATTTATCCAGCTTATTTTATTTTGAGACAGAGTCTTGCTCTCTCACTCAGGCTGGAGTGCAGTGGACCATTCTAGGCTCGCTCCAACCTCTGTCTCCCAAATTGAAGTAATTCTCGTGCCTCAATCTCCCGAGTAGCTGGGATTACAGGCATGTGTCACCAAGCCTGGCTGATTTTTGTAGTTTTAGTAGAGACGGGGTTTCACCATGATGGCCAGGCTGGTCTTGAACTCCTGGCCTCAAGTGACTGGAACACCTCGGCCTCCTAAAGTGCTGGGATTACAGACGAGAGCCACTGAACAGCTTTGATCCAACTTATTTGGATGAATGAGTTACATATTTTACATTAAATCTGTTATTGTGATAATTCTTCATGTTATTTTCCATGTATAGATTTATATATAATGTAATTTTAATTTTTTTTCACCGGAGAGTATAAACAACAATTATTTTATAAACAGGATAATAAAAATAAGACAAAAATTGTTGAAATGTCTTCATTTGACTACTAACTTTTTACATGTTTGTTACTTTGAAGCTGTTATCAATACTTGTGATGTATTACAATTAAGTAAAGATTTAAAGATGCCATTTTTAACTTATTATGACACAAAGTCTATAAATTCTTATATTTTGAGATTTGTATTTAAATAACTTGTGAAATTTAATTTTAAAATAAAATTTCTTCTATGGATTGGTCTTCAATCGAGGCATAAAAAGGAATATAACAGTGTGGCACTATAACTTCTATATTGAATTTCTATATTATTTAACACAATTATAATTTTGCTAATGAATTGTAATGTTTTTAAAAAGCTAGGTGAATTTTATTAAATTCATTACATGGCGATAACACAGAGAAAACATTTTGGGGATTCTTTTAAAATGGTATGTACAAAAGCTTAAAAGTTGTTATGTAGTGGCAGAGATAAAAAAGTAAAACAAAAAAAAGCTTAAAAGTTTGCTTTACTATTTATAGGCTCATAAGTGTAAGTGTGCCAGAAAATGAAAAAGAAAGGAGAGAAATTATAAATAACTGTGTGGAAAACACAGATAAAGCATAAAGATAGAATATAAAGATAGAAGCATTTTAATATGAGGCAGTGATGGCTTTTTGAAGAATCCCAACTAAGGACCTACTTTTAGTTAATAAATAATATGTTTCTAATCCCTATATTGTCCACAGCAACCTTTTTAGGACATGGAGCAGTGACTATGAGTGCCAGAAGGCAAGAGTAGAAGCAATTGTAAAATCATGAACACTAGTTTGTAAAATCCTCACTGAGATATAATATCTGTTTGCCTCTACCTTAGAATTATTAATGTCTTGAGGGCTGGGA A very small piece of chromosome 21
 
What’s in a genome? Genes   (i. e., protein coding) But. . . only <2% of the human genome encodes proteins Other than protein coding genes, what is there? •  genes for noncoding RNAs (rRNA, tRNA, miRNAs, etc.) •  structural sequences (scaffold attachment regions) R egulatory sequences • “ junk” (including transposons, retroviral insertions, etc.)
 
 
 
Genome overview ,[object Object],[object Object],[object Object],[object Object],[object Object]
Application to Medicine and Biology ,[object Object],[object Object],[object Object],[object Object]
The next steps ,[object Object],[object Object],[object Object],[object Object]
Chimpanzee   Sequencing   and   Analysis   Consortium .  Initial sequence of the chimpanzee genome and comparison with the human genome.   Nature  2005  Sep 1;437(7055):69-87.  Thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements.  98,6  % identitity to human genome sequence Differences in gene/exon structures
Apparent differences between humans and great apes in the incidence or severity   of medically important conditions (excluding differences explained by obvious anatomical   differences ). Medical Condition  Humans  Great Apes Definite HIV progression to AIDS  Common  Very rare Influenza A symptomatology  Moderate to severe  Mild Hepatitis B/C late complications  Moderate to severe  Mild P. falciparum  malaria  Susceptible  Resistant Menopause  Universal  Rare Likely E. coli  K99 gastroenteritis  Resistant  Sensitive? Alzheimer’s disease pathology  Complete  Incomplete Coronary atherosclerosis  Common  Uncommon Epithelial cancers  Common  Rare

More Related Content

What's hot

HGP, the human genome project
HGP, the human genome projectHGP, the human genome project
HGP, the human genome project
Bahauddin Zakariya University lahore
 
Human genome project
Human genome projectHuman genome project
Human genome project
Dilip jaipal
 
Human genome project
Human genome projectHuman genome project
Human genome project
sabahayat3
 
Human genome project by M.Sohail Riaz Hashmi
Human genome project by M.Sohail Riaz HashmiHuman genome project by M.Sohail Riaz Hashmi
Human genome project by M.Sohail Riaz Hashmi
Quaid-e-Azam University, Islamabad
 
The human genome project
The human genome projectThe human genome project
The human genome project
Kundol Laa
 
Human genome project - Decoding the codes of life
Human genome project - Decoding the codes of lifeHuman genome project - Decoding the codes of life
Human genome project - Decoding the codes of life
arjunaa7
 
The Human Genome Project
The Human Genome Project The Human Genome Project
The Human Genome Project
Astghik Stepanyan
 
Physical maps and their use in annotations
Physical maps and their use in annotationsPhysical maps and their use in annotations
Physical maps and their use in annotations
Sheetal Mehla
 
Genomics
GenomicsGenomics
An Introduction to Genomics
An Introduction to GenomicsAn Introduction to Genomics
An Introduction to Genomics
Dr NEETHU ASOKAN
 
Tools in phylogeny
Tools in phylogeny Tools in phylogeny
Tools in phylogeny
bhavnesthakur
 
Gemome annotation
Gemome annotationGemome annotation
Gemome annotation
Tajammal Daultana
 
Human genome project and elsi
Human genome project and elsiHuman genome project and elsi
Human genome project and elsi
Yuvaraj neelakandan
 
Mutation detection
Mutation detectionMutation detection
Genome annotation
Genome annotationGenome annotation
Genome annotation
Shifa Ansari
 
Gene mapping
Gene mappingGene mapping
Gene mapping
Deepak Kumar
 
Human genome project
Human genome projectHuman genome project
Human genome project
Budr ul Qunain
 
Human Genome Project
Human Genome ProjectHuman Genome Project
Human Genome Project
Peyman Ghoraishizadeh
 
Human genome project
Human genome projectHuman genome project
Human genome project
Vinitha Chandra Sekar
 
Genomics, Transcriptomics, Proteomics, Metabolomics - Basic concepts for clin...
Genomics, Transcriptomics, Proteomics, Metabolomics - Basic concepts for clin...Genomics, Transcriptomics, Proteomics, Metabolomics - Basic concepts for clin...
Genomics, Transcriptomics, Proteomics, Metabolomics - Basic concepts for clin...
Prasenjit Mitra
 

What's hot (20)

HGP, the human genome project
HGP, the human genome projectHGP, the human genome project
HGP, the human genome project
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Human genome project by M.Sohail Riaz Hashmi
Human genome project by M.Sohail Riaz HashmiHuman genome project by M.Sohail Riaz Hashmi
Human genome project by M.Sohail Riaz Hashmi
 
The human genome project
The human genome projectThe human genome project
The human genome project
 
Human genome project - Decoding the codes of life
Human genome project - Decoding the codes of lifeHuman genome project - Decoding the codes of life
Human genome project - Decoding the codes of life
 
The Human Genome Project
The Human Genome Project The Human Genome Project
The Human Genome Project
 
Physical maps and their use in annotations
Physical maps and their use in annotationsPhysical maps and their use in annotations
Physical maps and their use in annotations
 
Genomics
GenomicsGenomics
Genomics
 
An Introduction to Genomics
An Introduction to GenomicsAn Introduction to Genomics
An Introduction to Genomics
 
Tools in phylogeny
Tools in phylogeny Tools in phylogeny
Tools in phylogeny
 
Gemome annotation
Gemome annotationGemome annotation
Gemome annotation
 
Human genome project and elsi
Human genome project and elsiHuman genome project and elsi
Human genome project and elsi
 
Mutation detection
Mutation detectionMutation detection
Mutation detection
 
Genome annotation
Genome annotationGenome annotation
Genome annotation
 
Gene mapping
Gene mappingGene mapping
Gene mapping
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Human Genome Project
Human Genome ProjectHuman Genome Project
Human Genome Project
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Genomics, Transcriptomics, Proteomics, Metabolomics - Basic concepts for clin...
Genomics, Transcriptomics, Proteomics, Metabolomics - Basic concepts for clin...Genomics, Transcriptomics, Proteomics, Metabolomics - Basic concepts for clin...
Genomics, Transcriptomics, Proteomics, Metabolomics - Basic concepts for clin...
 

Viewers also liked

Human genome project ()
Human genome project ()Human genome project ()
Human genome project ()
Tapeshwar Yadav
 
MT115 Precision Medicine: Integrating genomics to enable better patient outcomes
MT115 Precision Medicine: Integrating genomics to enable better patient outcomesMT115 Precision Medicine: Integrating genomics to enable better patient outcomes
MT115 Precision Medicine: Integrating genomics to enable better patient outcomes
Dell EMC World
 
Ammonia
AmmoniaAmmonia
Human Genome
Human Genome Human Genome
Human Genome
Marwan Alhalabi
 
The Human Genome Project - Part II
The Human Genome Project - Part IIThe Human Genome Project - Part II
The Human Genome Project - Part II
hhalhaddad
 
Cracking the code of life
Cracking the code of lifeCracking the code of life
Cracking the code of lifegmtrainor3
 
The Human Genome Project - Part I
The Human Genome Project - Part IThe Human Genome Project - Part I
The Human Genome Project - Part I
hhalhaddad
 
Human genome project 2007
Human genome project 2007Human genome project 2007
Human genome project 2007Hesham Gaber
 
The human genome project vlad mike mike leo duff
The human genome project vlad mike mike leo duffThe human genome project vlad mike mike leo duff
The human genome project vlad mike mike leo duffguest73a974
 
The Human Genome Project - Part III
The Human Genome Project - Part IIIThe Human Genome Project - Part III
The Human Genome Project - Part III
hhalhaddad
 
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...
Institut Pasteur de Madagascar
 

Viewers also liked (11)

Human genome project ()
Human genome project ()Human genome project ()
Human genome project ()
 
MT115 Precision Medicine: Integrating genomics to enable better patient outcomes
MT115 Precision Medicine: Integrating genomics to enable better patient outcomesMT115 Precision Medicine: Integrating genomics to enable better patient outcomes
MT115 Precision Medicine: Integrating genomics to enable better patient outcomes
 
Ammonia
AmmoniaAmmonia
Ammonia
 
Human Genome
Human Genome Human Genome
Human Genome
 
The Human Genome Project - Part II
The Human Genome Project - Part IIThe Human Genome Project - Part II
The Human Genome Project - Part II
 
Cracking the code of life
Cracking the code of lifeCracking the code of life
Cracking the code of life
 
The Human Genome Project - Part I
The Human Genome Project - Part IThe Human Genome Project - Part I
The Human Genome Project - Part I
 
Human genome project 2007
Human genome project 2007Human genome project 2007
Human genome project 2007
 
The human genome project vlad mike mike leo duff
The human genome project vlad mike mike leo duffThe human genome project vlad mike mike leo duff
The human genome project vlad mike mike leo duff
 
The Human Genome Project - Part III
The Human Genome Project - Part IIIThe Human Genome Project - Part III
The Human Genome Project - Part III
 
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...
 

Similar to L14 human genome

Microbial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative GenomicsMicrobial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Jonathan Eisen
 
THE human genome
THE human genomeTHE human genome
THE human genome
rokanuzzaman moschus
 
Real-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe ParkerReal-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe Parker
Joe Parker
 
Human genome project
Human genome projectHuman genome project
Human genome project
YashaswineeSahoo
 
Introduction to 16S Microbiome Analysis
Introduction to 16S Microbiome AnalysisIntroduction to 16S Microbiome Analysis
Introduction to 16S Microbiome Analysis
Bioinformatics and Computational Biosciences Branch
 
Lecture 1,2
Lecture 1,2Lecture 1,2
Lecture 1,2
Sucheta Tripathy
 
2014 whitney-research
2014 whitney-research2014 whitney-research
2014 whitney-researchc.titus.brown
 
Genome sequencing
Genome sequencingGenome sequencing
Genome sequencing
Shital Pal
 
Beiko dcsi2013
Beiko dcsi2013Beiko dcsi2013
Beiko dcsi2013
beiko
 
Human genome project
Human genome projectHuman genome project
Human genome project
Shital Pal
 
Human genome project (2) converted
Human genome project (2) convertedHuman genome project (2) converted
Human genome project (2) converted
GAnchal
 
Bioinformatics final
Bioinformatics finalBioinformatics final
Bioinformatics final
Rainu Rajeev
 
Human genome project
Human genome projectHuman genome project
Human genome project
Rakesh R
 
Unilag workshop complex genome analysis
Unilag workshop   complex genome analysisUnilag workshop   complex genome analysis
Unilag workshop complex genome analysisDr. Olusoji Adewumi
 
Clase 2 - Genoma Humano proyecto conicet.pdf
Clase 2 - Genoma Humano proyecto conicet.pdfClase 2 - Genoma Humano proyecto conicet.pdf
Clase 2 - Genoma Humano proyecto conicet.pdf
NoraCRuizGuevara
 
Marzillier_09052014.pdf
Marzillier_09052014.pdfMarzillier_09052014.pdf
Marzillier_09052014.pdf
7006ASWATHIRR
 
Genome project.pdf
Genome project.pdfGenome project.pdf
Genome project.pdf
ManchikantiDivya
 
2013 ucdavis-smbe-eukaryotes
2013 ucdavis-smbe-eukaryotes2013 ucdavis-smbe-eukaryotes
2013 ucdavis-smbe-eukaryotesc.titus.brown
 

Similar to L14 human genome (20)

Microbial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative GenomicsMicrobial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative Genomics
 
THE human genome
THE human genomeTHE human genome
THE human genome
 
Real-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe ParkerReal-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe Parker
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Introduction to 16S Microbiome Analysis
Introduction to 16S Microbiome AnalysisIntroduction to 16S Microbiome Analysis
Introduction to 16S Microbiome Analysis
 
Lecture 1,2
Lecture 1,2Lecture 1,2
Lecture 1,2
 
2014 whitney-research
2014 whitney-research2014 whitney-research
2014 whitney-research
 
Genome sequencing
Genome sequencingGenome sequencing
Genome sequencing
 
Beiko dcsi2013
Beiko dcsi2013Beiko dcsi2013
Beiko dcsi2013
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Human genome project (2) converted
Human genome project (2) convertedHuman genome project (2) converted
Human genome project (2) converted
 
bai2
bai2bai2
bai2
 
Bioinformatics final
Bioinformatics finalBioinformatics final
Bioinformatics final
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Human encodeproject
Human encodeprojectHuman encodeproject
Human encodeproject
 
Unilag workshop complex genome analysis
Unilag workshop   complex genome analysisUnilag workshop   complex genome analysis
Unilag workshop complex genome analysis
 
Clase 2 - Genoma Humano proyecto conicet.pdf
Clase 2 - Genoma Humano proyecto conicet.pdfClase 2 - Genoma Humano proyecto conicet.pdf
Clase 2 - Genoma Humano proyecto conicet.pdf
 
Marzillier_09052014.pdf
Marzillier_09052014.pdfMarzillier_09052014.pdf
Marzillier_09052014.pdf
 
Genome project.pdf
Genome project.pdfGenome project.pdf
Genome project.pdf
 
2013 ucdavis-smbe-eukaryotes
2013 ucdavis-smbe-eukaryotes2013 ucdavis-smbe-eukaryotes
2013 ucdavis-smbe-eukaryotes
 

More from MUBOSScz

Neuroscience sofia ultimo2
Neuroscience sofia ultimo2Neuroscience sofia ultimo2
Neuroscience sofia ultimo2MUBOSScz
 
BIOCHEMISTRY II EXAM ANSWERS
BIOCHEMISTRY II EXAM ANSWERSBIOCHEMISTRY II EXAM ANSWERS
BIOCHEMISTRY II EXAM ANSWERSMUBOSScz
 
Captain’s role
Captain’s roleCaptain’s role
Captain’s roleMUBOSScz
 
Tooth, esophagus, stomach, small intestine
Tooth, esophagus, stomach, small intestineTooth, esophagus, stomach, small intestine
Tooth, esophagus, stomach, small intestineMUBOSScz
 
Respiratory syst copy
Respiratory syst   copyRespiratory syst   copy
Respiratory syst copyMUBOSScz
 
Practicals 3 digestive system iii
Practicals 3   digestive system iiiPracticals 3   digestive system iii
Practicals 3 digestive system iiiMUBOSScz
 
Epithelium copy
Epithelium   copyEpithelium   copy
Epithelium copyMUBOSScz
 
Cytology copy
Cytology   copyCytology   copy
Cytology copyMUBOSScz
 
Connective tissue proper copy
Connective tissue proper   copyConnective tissue proper   copy
Connective tissue proper copyMUBOSScz
 
Cartilage, bone copy
Cartilage, bone   copyCartilage, bone   copy
Cartilage, bone copyMUBOSScz
 
Cardiovascular system copy
Cardiovascular system   copyCardiovascular system   copy
Cardiovascular system copyMUBOSScz
 
Bone, cartilage copy
Bone, cartilage   copyBone, cartilage   copy
Bone, cartilage copyMUBOSScz
 
Blood development copy
Blood development   copyBlood development   copy
Blood development copyMUBOSScz
 
Tissue processing
Tissue processingTissue processing
Tissue processingMUBOSScz
 
Section a dermatology
Section a dermatologySection a dermatology
Section a dermatologyMUBOSScz
 
Oncology section a
Oncology section aOncology section a
Oncology section aMUBOSScz
 
Section b dermatology
Section b dermatologySection b dermatology
Section b dermatologyMUBOSScz
 
Working and training in the national health service a guide for im gs final
Working and training in the national health service   a guide for im gs finalWorking and training in the national health service   a guide for im gs final
Working and training in the national health service a guide for im gs finalMUBOSScz
 
Histology slide guide
Histology slide guideHistology slide guide
Histology slide guideMUBOSScz
 

More from MUBOSScz (20)

Neuroscience sofia ultimo2
Neuroscience sofia ultimo2Neuroscience sofia ultimo2
Neuroscience sofia ultimo2
 
BIOCHEMISTRY II EXAM ANSWERS
BIOCHEMISTRY II EXAM ANSWERSBIOCHEMISTRY II EXAM ANSWERS
BIOCHEMISTRY II EXAM ANSWERS
 
Cz uk
Cz ukCz uk
Cz uk
 
Captain’s role
Captain’s roleCaptain’s role
Captain’s role
 
Tooth, esophagus, stomach, small intestine
Tooth, esophagus, stomach, small intestineTooth, esophagus, stomach, small intestine
Tooth, esophagus, stomach, small intestine
 
Respiratory syst copy
Respiratory syst   copyRespiratory syst   copy
Respiratory syst copy
 
Practicals 3 digestive system iii
Practicals 3   digestive system iiiPracticals 3   digestive system iii
Practicals 3 digestive system iii
 
Epithelium copy
Epithelium   copyEpithelium   copy
Epithelium copy
 
Cytology copy
Cytology   copyCytology   copy
Cytology copy
 
Connective tissue proper copy
Connective tissue proper   copyConnective tissue proper   copy
Connective tissue proper copy
 
Cartilage, bone copy
Cartilage, bone   copyCartilage, bone   copy
Cartilage, bone copy
 
Cardiovascular system copy
Cardiovascular system   copyCardiovascular system   copy
Cardiovascular system copy
 
Bone, cartilage copy
Bone, cartilage   copyBone, cartilage   copy
Bone, cartilage copy
 
Blood development copy
Blood development   copyBlood development   copy
Blood development copy
 
Tissue processing
Tissue processingTissue processing
Tissue processing
 
Section a dermatology
Section a dermatologySection a dermatology
Section a dermatology
 
Oncology section a
Oncology section aOncology section a
Oncology section a
 
Section b dermatology
Section b dermatologySection b dermatology
Section b dermatology
 
Working and training in the national health service a guide for im gs final
Working and training in the national health service   a guide for im gs finalWorking and training in the national health service   a guide for im gs final
Working and training in the national health service a guide for im gs final
 
Histology slide guide
Histology slide guideHistology slide guide
Histology slide guide
 

Recently uploaded

DevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA ConnectDevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA Connect
Kari Kakkonen
 
GraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge GraphGraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge Graph
Guy Korland
 
The Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and SalesThe Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and Sales
Laura Byrne
 
State of ICS and IoT Cyber Threat Landscape Report 2024 preview
State of ICS and IoT Cyber Threat Landscape Report 2024 previewState of ICS and IoT Cyber Threat Landscape Report 2024 preview
State of ICS and IoT Cyber Threat Landscape Report 2024 preview
Prayukth K V
 
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
James Anderson
 
When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...
Elena Simperl
 
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdfFIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance
 
How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...
Product School
 
Connector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a buttonConnector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a button
DianaGray10
 
Epistemic Interaction - tuning interfaces to provide information for AI support
Epistemic Interaction - tuning interfaces to provide information for AI supportEpistemic Interaction - tuning interfaces to provide information for AI support
Epistemic Interaction - tuning interfaces to provide information for AI support
Alan Dix
 
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptxIOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
Abida Shariff
 
UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4
DianaGray10
 
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
BookNet Canada
 
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
Sri Ambati
 
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Thierry Lestable
 
Assuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyesAssuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyes
ThousandEyes
 
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Tobias Schneck
 
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdfFIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance
 
Neuro-symbolic is not enough, we need neuro-*semantic*
Neuro-symbolic is not enough, we need neuro-*semantic*Neuro-symbolic is not enough, we need neuro-*semantic*
Neuro-symbolic is not enough, we need neuro-*semantic*
Frank van Harmelen
 
To Graph or Not to Graph Knowledge Graph Architectures and LLMs
To Graph or Not to Graph Knowledge Graph Architectures and LLMsTo Graph or Not to Graph Knowledge Graph Architectures and LLMs
To Graph or Not to Graph Knowledge Graph Architectures and LLMs
Paul Groth
 

Recently uploaded (20)

DevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA ConnectDevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA Connect
 
GraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge GraphGraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge Graph
 
The Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and SalesThe Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and Sales
 
State of ICS and IoT Cyber Threat Landscape Report 2024 preview
State of ICS and IoT Cyber Threat Landscape Report 2024 previewState of ICS and IoT Cyber Threat Landscape Report 2024 preview
State of ICS and IoT Cyber Threat Landscape Report 2024 preview
 
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
 
When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...
 
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdfFIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
 
How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...
 
Connector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a buttonConnector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a button
 
Epistemic Interaction - tuning interfaces to provide information for AI support
Epistemic Interaction - tuning interfaces to provide information for AI supportEpistemic Interaction - tuning interfaces to provide information for AI support
Epistemic Interaction - tuning interfaces to provide information for AI support
 
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptxIOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
 
UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4
 
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
 
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
 
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
 
Assuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyesAssuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyes
 
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
 
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdfFIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
 
Neuro-symbolic is not enough, we need neuro-*semantic*
Neuro-symbolic is not enough, we need neuro-*semantic*Neuro-symbolic is not enough, we need neuro-*semantic*
Neuro-symbolic is not enough, we need neuro-*semantic*
 
To Graph or Not to Graph Knowledge Graph Architectures and LLMs
To Graph or Not to Graph Knowledge Graph Architectures and LLMsTo Graph or Not to Graph Knowledge Graph Architectures and LLMs
To Graph or Not to Graph Knowledge Graph Architectures and LLMs
 

L14 human genome

  • 1. Human Genome Project Determine the entire sequence of the human genome. 3 billion base pairs Problem: It’s really big!
  • 2. Genome Sequencing As of 6/ 25/ 04 1128 genome projects: 199 complete (includes 28 eukaryotes) 508 prokaryotic genomes in progress 421 eukaryotic genomes in progress smallest: archaebacterium Nanoarchaeum equitans 500 kb Bacillus anthracis (anthrax) 5228 kb S. cerivisiae (yeast) 12,069 kb Arabidopsis thaliana 115,428 kb Drosophila melanogaster (fruit fly) 137,000 kb Anopheles gambiae (malaria mosquito) 278,000 kb Oryza sativa (rice) 420,000 kb Mus musculus (mouse) 2,493,000 kb Homo sapiens (human) 2,900,000 kb http:// www. genomesonline. org/ 1980 - $10/bp 2001 - $0.1 / bp S. cerevisiae 200x H. sapiens 200x A. dubia
  • 3.  
  • 4. Human Genome Project timeline E. coli Drosophila C. elegans Yeast NRC Recommends HGP U.S. HGP Begins 1990 1995 2000 Human Gene Map (16,000 genes) Human Gene Map (30,181 genes) Goal for Human Genetic Map Exceeded Physical Map Covers 98% of Genome Pilot Human Sequencing Begins Full-Scale Human Sequencing Begins Human draft Phil Hieter
  • 5. Completion of the genome 4-5 coverage 9x coverage 99.99 % acc GenBank entries double every 18 months “ Working Draft” “ Complete”
  • 6. Completion of the genome The current genome sequence (Build 35) contains 2.85 billion nucleotides interrupted by only 341 gaps. It covers approximately 99% of the euchromatic genome and is accurate to an error rate of approximately 1 event per 100,000 bases. Human genome seems to encode only 20,000-25,000 protein-coding genes International Human Genome Sequencing Consortium . Finishing the euchromatic sequence of the human genome. Nature 2004 Oct 21;431(7011):931-45.
  • 7. Institutes that produced 85 % of the sequence 1. Whitehead Institute for Biomedical Research , Center for Genome Research, Cambridge, MA 2. The Sanger Centre , Cambridge, UK 3. Washington University Genome Sequencing Center , St. Louis, MI 4. US Department of Energy , JGI, Walnut Creek, CA 5. Baylor College of Medicine Human Genome Sequencing Center , Houston, TX Countries: USA, UK, Japan, Germany, China, France
  • 8. Genome Sequencing Genome: 3 Gb Cut genome into large pieces Clone into BACs: 100 kb Order based on sequence features ( markers ) = mapping Cut again Sequence AGAACAGGACGTATGTGGT TGTGGTTTTCTACTCC CTACTCCTGTGTT TTGTAAGTGAGAACA Assemble each BAC … TTGTAAGTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTT… Assemble entire sequence
  • 9.  
  • 10.  
  • 11.  
  • 12. What does the sequence mean? TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGTCATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACATACAAAATAATACCTCAGTGTAACCTCTGTTTGTATTTCCCTTGATTAACTGATGCTGAGCACATCTTCATGTGCTTATTGACCATTAATTAGTCTTATTTGTTAAATGTCTCAAATATTTTATACAGTTTTACATTGTGTTATTCATTTTTTAAAAAATTCATTTTAGGTTATATGTATGTGTGTGTCAAAGTGTGTGTACATCTATTTGATATATGTATGTCTATATATTCTGGATACCATCTCTGTTTCATGCATTGCATATATATTTGCCTATTTAGTGGTTTATCTTTTCATTTTCTTTTGGTATCTTTTCATTAGAAATGTTATTTATTTTGAGTAAGTAACATTTAATATATTCTGTAACATTTAATGAATCATTTTATGTTATGTTTAGTATTAAATTTCTGAAAACATTCTATGTATTCTACTAGAATTGTCATAATTTTATCTTTTATATACATTGATATTTTTATGTCAAATATGTAGGTATGTGATATTATGCACATGGTTTTAATTCAGTTAATTGTTCTTCCAGATGTTTGTACCATTCCAACATCATTTAAATCATTAAATGAAAAGCCTTTCCTTACTAGCTAGCCAGCTTTGAAAATCCATTCATAGGGTTTGTGTTAATATATTTTTGTTCTTTTTTTTCCTTTCTACTGATCTCTTTATATTAATACCTACTGTGGCTTTATATGAAGTCATGGAATAATACGTAGTAAGCCCTCTAACACTGTTCTGTTACTGTTGTTATTGTTTTCTCAGGGTACTTTGAAATATTCGAGATTTTATTATTTTTTAGTAGCCTAGATTTCAAGATTGTTTTGACGATCAATTTTTGAATCAATTGTCAATATTTTTAGTAATAAAATGATGATTTTTGATTGGAAATACATTAAATCTATAAGCCAAATTGGAGATTATTGATATATTAACAAAAATGAGTTTTCCAGTCCATGAATGTATGCACATTATAAAATTCATTCTTAAGTATGTCATTTTTTAAGTTTTAGTTTCAGCAGTATATGTTTGTTACATAGGTAAACTCCTGTCATGGGGGTTAGTTGTACAGGTTATTTTATCATCCAGGCATAAAGCCCAGTACCCAGTAGTTATCTTTTCTGCTCCTCTCCCTCCTGTCACCCTCCACTCTCAAGTAGACCCCAGTTTCTGTTGTTCTCTTCTTTGCATTAATGACTTCTCATCATTTAGATTGCACTTGTAAGTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTTAGTTTGCTAAGGATAACCACCTCCATCTCCATCCATGTTCCCACAAAAGACATGATCTCCTTTTTTATGGCTGCATATTATTCCATGGTATATATGTACCACATTTTCTTTATCCAATCTGTCATTGATGGACATTTAGGTTGTTTCCACATCATTGCCGTTGTAAATACTGCTGCAGTGAATATTCGTGTGTATGTCTTTATGGTAGAATGATTTATATTCCTCTGGGTATATTTCCAAGTAATGGGATGGTTGGGTCAAATGGTAATTCTGCTTTTAGCTTTTTGAGGAATTGCCATATTGCCTTTCACAACGGTTGAACTAATTTATACTCCCAAGAGTGTATAAGTTGTTCCTTTTTCTCTGCAACCTCGACATCACCTGTTATTTATGACTTTTATATAATAGCCATTCTGCTGGTCTGAGATGGTATCTCATTATGATTTTGATTTGCATTTCTCTAATGCTCAGTGATATTGAGCTTGGCTGCATATATGTCTTCTTTTAAAAATATCTGTTCATGTCCTTTGCCTAATTTATAACGGGGTTGTTTGTTTTTCTCTTGTAAATTTGTTTAAGTTCCTTATAGATTCTAGGTATTAAACCTTTTTTCAGAGGCGTGGCTTGCAAATATTTTCTCCCATTCTATAGGTTGTCTGTTTATTCTGTTGATAGTTTCCCTTGCTGTGCAGAAGCTCTTAACTTTAATTAGATCCGACTTGTCAATTTTTGCTTTGGTCGCAATTGCTTTTGATGTTATTGTCGTGAAATCTTTGCTAGTTCTTAGGTCCAGGATGATATTGCCCAAGTTGTCTTCCAGGGCTTTTATAATTTTGGATTTTACATTTAAGTCTTAATATATTTATTAAATTTGTTAGGGTTTCAGGATACAAGGACAATATAGCAGCAAACAATGTAAAAGTAAAATCTGAAAAATAATAGAAAACAGTTTAATTGAACACTTTACCATTATGTAATGCCCTTCTTTGTCTTTCCTGATCTTTGTTGGTTTGAAGTTCAAAAAAGACAAACTTAATGGTACAATAGGTATTGTAGATTTCAGGACTTTCTGTATAAAATATTTTGTATATATGAATAGATCATTTTTTATTTCCAGTCTTTAAACATTTTCTTAACATTTTCTTCTATTGCTTCACTTCACTCGCTAGGACCATCAGGACAGTGTTGAACAGAAATTGTCAGACTGATCATCACAACTTTTTCTAGATTTTAGAAGGAAATTTTTCTTTATTTCAACATAAAGCAGCATGTTAATGCCAAGTTTTAATATGTGTTATCAGATTGAAATTTTTTTGTATATTTCTACATTACCAAGAATTTTTAGCAAGAGTTTTTGTTGAGTTTTAATTTAAAAATCATTTGTTAATTTCATCTGATTTTTTTATTTCTCTTTTTACCTTAAGAGATTAAACTGACTACAGATTGAATATAAACAAACAAACAAACAAACAAAAACTCTAAAATGCTGTGGATCAACACCACTTAGTAATTTGTATACTTGGATTCAATTTGCTGAAATTTTGTTAGACATTTTTGCGTCGATATTTATGAGGGATGTTGATCTGTAAAAGTATTAAAATGCCTTTGACAGATTTTGATAGCAGTGTTATTCTGGCCTAATAAATCAAACTGAGGTATGATCCTTCCTTTTCTATTTCTTAATAGCATTTTTAAAATTGGTGGTTTTTTCCTTCCTTAGTGAAATTTACCAGCAAAGTAACAGGCCTTATATTTCTCTTGTGGAAATATTTTAATTTCAAATTAATGGTATTTTGTTCTTGTAGGGTGGTAATTTTCTCTGTGTTTGGTCTTAATGGACTCTTAGCTGATCACCCAGTTACTCAGCGAGGTCTCTTCACTCTGGAAGAGCTGGAACTCCAGTGTGTTTTAGTGCAGCATGACCACGGGTATTACCGTTCAACATTTAGGCTTTATCAGTGATAACTATTTGTCCTCATGGAGTTTTTGCCGCTGGGCCTACACAGTTTAGGCTTCAGCTTAGAACACATAATGAATTCTTATGCAGATTTCTGCCCACCTTTGACCTTTCATGATTTCCTCTTCTTGGGTAAGCTGCCTTATTAATCTGATACACTTCAGCAGTCCAGAACTACACTCTTTCCCTTCTCTGCTCTTGGAGATGACTCTTTTGTCTGAGATTCACTTTGCTGTGCTGAAAAAGAAAAGTGCTTCAAGGAAGATACCAAGGAAAATCACAGGGCTCATTTATGTATTTCTCTTCTTTCAAGGACTACAGCTTTGTGTTGCCTATGTTCAATTTCTGAAAATAATTAGAGCATATATACTCTGTGTGAGAAGGCAAATCCAGACAGTTAGTTTGTATGACTAGAAGCAGAAGTCTACATGGAGAATTTTACTTAACTGTGTTATAGTTTCTTTAATTATTTCAAGAGTATGTTTAATGTTCCACAGATCTCATTCTATAAATCTTTATCATCTTAGAGCTCTGATACTATTTAGAATTACTATTCCTTCAAATAAGAGATTAGAAACAGGGTTATATTTGGGGTAGGTTGACTTACTTTTCTGGGAACCAAAGCATATTAAATTGACCAGTTTTAACACACTTCTATGTATGCACAAAGATATATATTTACATTCTGCAAAATCATTCTTTCCTTTTTGAATTTGAAAAGGATCTTTGGTATACAGATATTCAATAGCCAGCCTGAAGATTCATTTGAATTCATTTAATGTTTAGATTCACTACATGAAATGATCCAGAAGAGAGTACTCAAATATAAGTATCTATAACGATGGAAATATACATCTCCACTGCCCAAGATGGTAGTCATGAGTCAATATTGATCATGTGAGACGTGGCAAGTGTTACTCAGGGTCTCAATATTTAAATGTATTAAGCTTTAATTAATGTAAATTTGAATTTAGCAAAACATGTATAGCTTGTGGTTACTGTTTTATTCAGTGCCAATATAGAACATTTCCATGATTACAGAAAGTTATCTTAGAATACTCAGTTCTGGACTATTTTATCTGGCTAAATTAAATGTTAAAATATTACAAATTCATCTTCAGGCTGGCTGTTGAATATTTTTATAGCAAAAGTCATTTATAAATTTAAAACTCAAATAATTATCTTTTTCAATATGTAAAATATGTCTTTACATATTCTACTCCCTTCTTACATACATATTCTGATGTAACATAGGTATTCTCTTATTCATGCACACTGAAATGACAACATAAATAATTTTACTAAGTGTCACCATATAAAAAACTTTGAACAAAATCAGATTATATCACTGTGGATATTTCTATTTTGAACTAACTTAGATGATAATTTTAATCTATATCCTAGATGAACTTTAAATCAATAAAATCTCTCAATGGTGTTATAAATCTCAAGCCATTAGCCACTGATTATCCCATTTTTATTCTTTTCATATTAATTTTATTGCCATGTATGAATGCTGTAGCATCCATGTTTAAATACTAGTTAACAAAATGCACTGGCATCAGATACAATAAGGATGAAATGAGATATAATTAGGACTCTGGTAACACACATAAAATTGGAAAGATACCCTGAAATTCAAGCCAAGAAGATATTTATCCAGCTTATTTTATTTTGAGACAGAGTCTTGCTCTCTCACTCAGGCTGGAGTGCAGTGGACCATTCTAGGCTCGCTCCAACCTCTGTCTCCCAAATTGAAGTAATTCTCGTGCCTCAATCTCCCGAGTAGCTGGGATTACAGGCATGTGTCACCAAGCCTGGCTGATTTTTGTAGTTTTAGTAGAGACGGGGTTTCACCATGATGGCCAGGCTGGTCTTGAACTCCTGGCCTCAAGTGACTGGAACACCTCGGCCTCCTAAAGTGCTGGGATTACAGACGAGAGCCACTGAACAGCTTTGATCCAACTTATTTGGATGAATGAGTTACATATTTTACATTAAATCTGTTATTGTGATAATTCTTCATGTTATTTTCCATGTATAGATTTATATATAATGTAATTTTAATTTTTTTTCACCGGAGAGTATAAACAACAATTATTTTATAAACAGGATAATAAAAATAAGACAAAAATTGTTGAAATGTCTTCATTTGACTACTAACTTTTTACATGTTTGTTACTTTGAAGCTGTTATCAATACTTGTGATGTATTACAATTAAGTAAAGATTTAAAGATGCCATTTTTAACTTATTATGACACAAAGTCTATAAATTCTTATATTTTGAGATTTGTATTTAAATAACTTGTGAAATTTAATTTTAAAATAAAATTTCTTCTATGGATTGGTCTTCAATCGAGGCATAAAAAGGAATATAACAGTGTGGCACTATAACTTCTATATTGAATTTCTATATTATTTAACACAATTATAATTTTGCTAATGAATTGTAATGTTTTTAAAAAGCTAGGTGAATTTTATTAAATTCATTACATGGCGATAACACAGAGAAAACATTTTGGGGATTCTTTTAAAATGGTATGTACAAAAGCTTAAAAGTTGTTATGTAGTGGCAGAGATAAAAAAGTAAAACAAAAAAAAGCTTAAAAGTTTGCTTTACTATTTATAGGCTCATAAGTGTAAGTGTGCCAGAAAATGAAAAAGAAAGGAGAGAAATTATAAATAACTGTGTGGAAAACACAGATAAAGCATAAAGATAGAATATAAAGATAGAAGCATTTTAATATGAGGCAGTGATGGCTTTTTGAAGAATCCCAACTAAGGACCTACTTTTAGTTAATAAATAATATGTTTCTAATCCCTATATTGTCCACAGCAACCTTTTTAGGACATGGAGCAGTGACTATGAGTGCCAGAAGGCAAGAGTAGAAGCAATTGTAAAATCATGAACACTAGTTTGTAAAATCCTCACTGAGATATAATATCTGTTTGCCTCTACCTTAGAATTATTAATGTCTTGAGGGCTGGGA A very small piece of chromosome 21
  • 13.  
  • 14. What’s in a genome? Genes (i. e., protein coding) But. . . only <2% of the human genome encodes proteins Other than protein coding genes, what is there? • genes for noncoding RNAs (rRNA, tRNA, miRNAs, etc.) • structural sequences (scaffold attachment regions) R egulatory sequences • “ junk” (including transposons, retroviral insertions, etc.)
  • 15.  
  • 16.  
  • 17.  
  • 18.
  • 19.
  • 20.
  • 21. Chimpanzee Sequencing and Analysis Consortium . Initial sequence of the chimpanzee genome and comparison with the human genome. Nature 2005 Sep 1;437(7055):69-87. Thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements. 98,6 % identitity to human genome sequence Differences in gene/exon structures
  • 22. Apparent differences between humans and great apes in the incidence or severity of medically important conditions (excluding differences explained by obvious anatomical differences ). Medical Condition Humans Great Apes Definite HIV progression to AIDS Common Very rare Influenza A symptomatology Moderate to severe Mild Hepatitis B/C late complications Moderate to severe Mild P. falciparum malaria Susceptible Resistant Menopause Universal Rare Likely E. coli K99 gastroenteritis Resistant Sensitive? Alzheimer’s disease pathology Complete Incomplete Coronary atherosclerosis Common Uncommon Epithelial cancers Common Rare