Cell division requires DNA replication so that each daughter cell receives a copy of the DNA. DNA replication is semi-conservative, resulting in two DNA molecules where each contains one original strand and one newly synthesized complementary strand. DNA replication involves initiation, elongation, and termination. During elongation, the leading strand is synthesized continuously while the lagging strand is synthesized in fragments called Okazaki fragments.
RNA splicing, in molecular biology, is a form of RNA processing in which a newly made precursor messenger RNA transcript is transformed into a mature messenger RNA. During splicing, introns are removed and exons are joined together.
For MBBS, BDS and General Biochemistry students, coding strand, sense strand, anti-sense strand, promoter, enhancers, silencers, TATA box, Goldberg Hogness box, alternative spilicing, post-transcriptional modification
An Overview...
Definition of Translation.
Def. of Eukaryotes.
Translation: An Overview.
Components of Translation.
Some Enzymes .
Ribosome Role.
Mechanism of Translation.
Initiation.
Scanning Model of Initiation.
Initiation Factors.
Animation.
Elongation.
Chain Elongation: Translocation.
Animation.
Termination.
Animation....
It's not perfect still... what are your views friends?
RNA splicing, in molecular biology, is a form of RNA processing in which a newly made precursor messenger RNA transcript is transformed into a mature messenger RNA. During splicing, introns are removed and exons are joined together.
For MBBS, BDS and General Biochemistry students, coding strand, sense strand, anti-sense strand, promoter, enhancers, silencers, TATA box, Goldberg Hogness box, alternative spilicing, post-transcriptional modification
An Overview...
Definition of Translation.
Def. of Eukaryotes.
Translation: An Overview.
Components of Translation.
Some Enzymes .
Ribosome Role.
Mechanism of Translation.
Initiation.
Scanning Model of Initiation.
Initiation Factors.
Animation.
Elongation.
Chain Elongation: Translocation.
Animation.
Termination.
Animation....
It's not perfect still... what are your views friends?
Genetic Engineering and Biotechnology, a frontier discipline of modern science, has facilitated revolutionary developments in the fields of agriculture, industry, health and environment by genomic modification of animals, plants and microorganisms.
Genetic Codon The Three nucleotide base sequence in mRNA that act as code words for amino acids in protein constitute the genetic code or codons.
There are 64 different combinations of three base codons composed of Adenine (A), Guanine (G), Cytosine (C) and Uracil (U).
Written from the 5-’ end to 3’ end.
UAA,UAG & UGA do not code for amino acid. They are called as stop codon or non sense codon.
Characteristics of Genetic Code are:
University: same codon for same amino acid in all living organism.
Specificity: A particular codon will code for the same amino acid,highly specific or unambiguous.
Non overlapping : read from a fixed point as a continuous base sequence.
Degenerate: Most of the amino acids have more than one codon. 61 codons available to code for only 20 amino acids.
DNA :DNA stands for Deoxy Ribonucleic acid.
It’s the genetic code that determines all the characteristics of living organism.
DNA is a double stranded molecule, made up of two chains of nucleotides. Nucleotides consist of three subunits : a sugar, a phosphate group and a nitrogen base pair.
Sugar present is Deoxyribose and Nitrogen bases are :
Adenine (A)
Guanine (G)
Cytosine (C)
Thymine (T)
Structure of DNA : Double helical structure of DNA was proposed by James Watson and Francis Crick in 1953.
Features of model of DNA are:
DNA is a right handed double helix, have two polydeoxyribonucleotide chains twisted around each other on a common axis.
Two strands are antiparallel i.e., one strand runs in the 5’ to 3’ direction while the other in 3’ to 5’ direction.
The diameter of helix is 20 A° (2nm).
Each turn of the helix is 34 A° (3.4 nm) with 10 pairs of nucleotides, each pair placed at a distance of about 3.4 A°.
The two strands are held together by Hydrogen bonds formed by complementary base pairs. The A-T pair has 2 hydrogen bonds while G-C pair has 3 hydrogen bonds.
The complementary base pairing in DNA helix proves Chargaff’s rule. The content of adenine equals to that of thymine (A=T) and guanine equals to that of the cytosine (G≡C).
Function of DNA
RNA
DNA replication
Transcription
Translation
DNA replication is the process by which DNA makes a copy of itself during cell division.The separation of the two single strands of DNA creates a 'Y' shape called a replication 'fork'. The two separated strands will act as templates for making the new strands of DNA.
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...VarunMahajani
Disruption of blood supply to lung alveoli due to blockage of one or more pulmonary blood vessels is called as Pulmonary thromboembolism. In this presentation we will discuss its causes, types and its management in depth.
New Drug Discovery and Development .....NEHA GUPTA
The "New Drug Discovery and Development" process involves the identification, design, testing, and manufacturing of novel pharmaceutical compounds with the aim of introducing new and improved treatments for various medical conditions. This comprehensive endeavor encompasses various stages, including target identification, preclinical studies, clinical trials, regulatory approval, and post-market surveillance. It involves multidisciplinary collaboration among scientists, researchers, clinicians, regulatory experts, and pharmaceutical companies to bring innovative therapies to market and address unmet medical needs.
Title: Sense of Taste
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the structure and function of taste buds.
Describe the relationship between the taste threshold and taste index of common substances.
Explain the chemical basis and signal transduction of taste perception for each type of primary taste sensation.
Recognize different abnormalities of taste perception and their causes.
Key Topics:
Significance of Taste Sensation:
Differentiation between pleasant and harmful food
Influence on behavior
Selection of food based on metabolic needs
Receptors of Taste:
Taste buds on the tongue
Influence of sense of smell, texture of food, and pain stimulation (e.g., by pepper)
Primary and Secondary Taste Sensations:
Primary taste sensations: Sweet, Sour, Salty, Bitter, Umami
Chemical basis and signal transduction mechanisms for each taste
Taste Threshold and Index:
Taste threshold values for Sweet (sucrose), Salty (NaCl), Sour (HCl), and Bitter (Quinine)
Taste index relationship: Inversely proportional to taste threshold
Taste Blindness:
Inability to taste certain substances, particularly thiourea compounds
Example: Phenylthiocarbamide
Structure and Function of Taste Buds:
Composition: Epithelial cells, Sustentacular/Supporting cells, Taste cells, Basal cells
Features: Taste pores, Taste hairs/microvilli, and Taste nerve fibers
Location of Taste Buds:
Found in papillae of the tongue (Fungiform, Circumvallate, Foliate)
Also present on the palate, tonsillar pillars, epiglottis, and proximal esophagus
Mechanism of Taste Stimulation:
Interaction of taste substances with receptors on microvilli
Signal transduction pathways for Umami, Sweet, Bitter, Sour, and Salty tastes
Taste Sensitivity and Adaptation:
Decrease in sensitivity with age
Rapid adaptation of taste sensation
Role of Saliva in Taste:
Dissolution of tastants to reach receptors
Washing away the stimulus
Taste Preferences and Aversions:
Mechanisms behind taste preference and aversion
Influence of receptors and neural pathways
Impact of Sensory Nerve Damage:
Degeneration of taste buds if the sensory nerve fiber is cut
Abnormalities of Taste Detection:
Conditions: Ageusia, Hypogeusia, Dysgeusia (parageusia)
Causes: Nerve damage, neurological disorders, infections, poor oral hygiene, adverse drug effects, deficiencies, aging, tobacco use, altered neurotransmitter levels
Neurotransmitters and Taste Threshold:
Effects of serotonin (5-HT) and norepinephrine (NE) on taste sensitivity
Supertasters:
25% of the population with heightened sensitivity to taste, especially bitterness
Increased number of fungiform papillae
Couples presenting to the infertility clinic- Do they really have infertility...Sujoy Dasgupta
Dr Sujoy Dasgupta presented the study on "Couples presenting to the infertility clinic- Do they really have infertility? – The unexplored stories of non-consummation" in the 13th Congress of the Asia Pacific Initiative on Reproduction (ASPIRE 2024) at Manila on 24 May, 2024.
NVBDCP.pptx Nation vector borne disease control programSapna Thakur
NVBDCP was launched in 2003-2004 . Vector-Borne Disease: Disease that results from an infection transmitted to humans and other animals by blood-feeding arthropods, such as mosquitoes, ticks, and fleas. Examples of vector-borne diseases include Dengue fever, West Nile Virus, Lyme disease, and malaria.
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Ve...kevinkariuki227
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...i3 Health
i3 Health is pleased to make the speaker slides from this activity available for use as a non-accredited self-study or teaching resource.
This slide deck presented by Dr. Kami Maddocks, Professor-Clinical in the Division of Hematology and
Associate Division Director for Ambulatory Operations
The Ohio State University Comprehensive Cancer Center, will provide insight into new directions in targeted therapeutic approaches for older adults with mantle cell lymphoma.
STATEMENT OF NEED
Mantle cell lymphoma (MCL) is a rare, aggressive B-cell non-Hodgkin lymphoma (NHL) accounting for 5% to 7% of all lymphomas. Its prognosis ranges from indolent disease that does not require treatment for years to very aggressive disease, which is associated with poor survival (Silkenstedt et al, 2021). Typically, MCL is diagnosed at advanced stage and in older patients who cannot tolerate intensive therapy (NCCN, 2022). Although recent advances have slightly increased remission rates, recurrence and relapse remain very common, leading to a median overall survival between 3 and 6 years (LLS, 2021). Though there are several effective options, progress is still needed towards establishing an accepted frontline approach for MCL (Castellino et al, 2022). Treatment selection and management of MCL are complicated by the heterogeneity of prognosis, advanced age and comorbidities of patients, and lack of an established standard approach for treatment, making it vital that clinicians be familiar with the latest research and advances in this area. In this activity chaired by Michael Wang, MD, Professor in the Department of Lymphoma & Myeloma at MD Anderson Cancer Center, expert faculty will discuss prognostic factors informing treatment, the promising results of recent trials in new therapeutic approaches, and the implications of treatment resistance in therapeutic selection for MCL.
Target Audience
Hematology/oncology fellows, attending faculty, and other health care professionals involved in the treatment of patients with mantle cell lymphoma (MCL).
Learning Objectives
1.) Identify clinical and biological prognostic factors that can guide treatment decision making for older adults with MCL
2.) Evaluate emerging data on targeted therapeutic approaches for treatment-naive and relapsed/refractory MCL and their applicability to older adults
3.) Assess mechanisms of resistance to targeted therapies for MCL and their implications for treatment selection
263778731218 Abortion Clinic /Pills In Harare ,sisternakatoto
263778731218 Abortion Clinic /Pills In Harare ,ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group of receptionists, nurses, and physicians have worked together as a teamof receptionists, nurses, and physicians have worked together as a team wwww.lisywomensclinic.co.za/
Explore natural remedies for syphilis treatment in Singapore. Discover alternative therapies, herbal remedies, and lifestyle changes that may complement conventional treatments. Learn about holistic approaches to managing syphilis symptoms and supporting overall health.
Ethanol (CH3CH2OH), or beverage alcohol, is a two-carbon alcohol
that is rapidly distributed in the body and brain. Ethanol alters many
neurochemical systems and has rewarding and addictive properties. It
is the oldest recreational drug and likely contributes to more morbidity,
mortality, and public health costs than all illicit drugs combined. The
5th edition of the Diagnostic and Statistical Manual of Mental Disorders
(DSM-5) integrates alcohol abuse and alcohol dependence into a single
disorder called alcohol use disorder (AUD), with mild, moderate,
and severe subclassifications (American Psychiatric Association, 2013).
In the DSM-5, all types of substance abuse and dependence have been
combined into a single substance use disorder (SUD) on a continuum
from mild to severe. A diagnosis of AUD requires that at least two of
the 11 DSM-5 behaviors be present within a 12-month period (mild
AUD: 2–3 criteria; moderate AUD: 4–5 criteria; severe AUD: 6–11 criteria).
The four main behavioral effects of AUD are impaired control over
drinking, negative social consequences, risky use, and altered physiological
effects (tolerance, withdrawal). This chapter presents an overview
of the prevalence and harmful consequences of AUD in the U.S.,
the systemic nature of the disease, neurocircuitry and stages of AUD,
comorbidities, fetal alcohol spectrum disorders, genetic risk factors, and
pharmacotherapies for AUD.
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
How STIs Influence the Development of Pelvic Inflammatory Disease.pptx
Dna replication;transcription and translation
1. • Cell Division (mitosis)
Cells must copy their chromosomes
(DNA synthesis) before they divide so
that each daughter cell will have a copy
A region of the chromosome remains
uncopied (centromere) in order to hold
the sister chromatids together
– Keeps chromatids organized to help
make sure each daughter cell gets
exactly one copy
– Nondisjunction is when sister
chromatids do not assort correctly
and one cell ends up with both
copies while the other cell ends up
with none
DNA Replication
2. • DNA Synthesis
The DNA bases on each
strand act as a template to
synthesize a complementary
strand
• Recall that Adenine (A)
pairs with thymine (T)
and guanine (G) pairs
with cytosine (C)
The process is
semiconservative because
each new double-stranded
DNA contains one old
strand (template) and one
newly-synthesized
complementary strand
DNA Replication
A
G
C
T
G
T
C
G
A
C
A
G
C
T
G
T
C
G
A
C
A
G
C
T
G
T
C
G
A
C
A
G
C
T
G
T
C
G
A
C
T
C
G
A
C
A
G
C
T
G
3. Figure 16.10 a–c
Conservative
model. The two
parental strands
reassociate
after acting as
templates for
new strands,
thus restoring
the parental
double helix.
Semiconservative
model. The two
strands of the
parental molecule
separate,
and each functions
as a template
for synthesis of
a new, comple-
mentary strand.
Dispersive
model. Each
strand of both
daughter mol-
ecules contains
a mixture of
old and newly
synthesized
DNA.
Parent cell
First
replication
Second
replication
• DNA replication is semiconservative
– Each of the two new daughter molecules will have
one old strand, derived from the parent molecule,
and one newly made strand
(a)
(b)
(c)
4. DNA Replication
• DNA Polymerase
Enzyme that catalyzes the covalent bond between the phosphate of one
nucleotide and the deoxyribose (sugar) of the next nucleotide
DNA Polymerization
5. 3’ end has a free deoxyribose
5’ end has a free phosphate
DNA polymerase:
can only build the new strand in
the 5’ to 3’ direction
Thus scans the template strand in
3’ to 5’ direction
DNA Replication
6. Initiation
• Primase (a type of RNA polymerase) builds an RNA primer
(5-10 ribonucleotides long)
• DNA polymerase attaches onto the 3’ end of the RNA primer
DNA Replication
DNA polymerase
7. Elongation
• DNA polymerase uses each strand as a template in the 3’ to 5’
direction to build a complementary strand in the 5’ to 3’ direction
DNA Replication
DNA polymerase
8. Elongation
• DNA polymerase uses each strand as a template in the 3’ to 5’
direction to build a complementary strand in the 5’ to 3’ direction
results in a leading strand and a lagging strand
DNA Replication
9. Leading Strand
1. Topisomerase unwinds DNA and then Helicase breaks H-bonds
2. DNA primase creates a single RNA primer to start the replication
3. DNA polymerase slides along the leading strand in the 3’ to 5’ direction
synthesizing the matching strand in the 5’ to 3’ direction
4. The RNA primer is degraded by RNase H and replaced with DNA nucleotides by
DNA polymerase, and then DNA ligase connects the fragment at the start of the
new strand to the end of the new strand (in circular chromosomes)
DNA Replication
10. Lagging Strand
1. Topisomerase unwinds DNA and then Helicase breaks H-bonds
2. DNA primase creates RNA primers in spaced intervals
3. DNA polymerase slides along the leading strand in the 3’ to 5’ direction
synthesizing the matching Okazaki fragments in the 5’ to 3’ direction
4. The RNA primers are degraded by RNase H and replaced with DNA nucleotides
by DNA polymerase
5. DNA ligase connects the Okazaki fragments to one another (covalently bonds the
phosphate in one nucleotide to the deoxyribose of the adjacent nucleotide)
DNA Replication
11. Topoisomerase - unwinds DNA
Helicase – enzyme that breaks H-bonds
DNA Polymerase – enzyme that catalyzes connection of nucleotides to form complementary
DNA strand in 5’ to 3’ direction (reads template in 3’ to 5’ direction)
Leading Strand – transcribed continuously in 5’ to 3’ direction
Lagging Strand – transcribed in segments in 5’ to 3’ direction (Okazaki fragments)
DNA Primase – enzyme that catalyzes formation of RNA starting segment (RNA primer)
DNA Ligase – enzyme that catalyzes connection of two Okazaki fragments
DNA Replication
12. • DNA provides the instructions for how to build proteins
• Each gene dictates how to build a single protein in prokaryotes
• The sequence of nucleotides (AGCT) in DNA dictate the order
of amino acids that make up a protein
Protein Synthesis
Nucleotide sequence of His gene
13. Protein Synthesis
Nucleotide sequence of His gene
Amino acid sequence of His protein
• DNA provides the instructions for how to build proteins
• Each gene dictates how to build a single protein in prokaryotes
• The sequence of nucleotides (AGCT) in DNA dictate the order
of amino acids that make up a protein
14. • Protein synthesis occurs in two primary steps
Protein Synthesis
mRNA (messenger RNA)
copy of a gene is
synthesized
Cytoplasm of prokaryotes
Nucleus of eukaryotes
1
mRNA is used by ribosome to
build protein
(Ribosomes attach to the
mRNA and use its sequence of
nucleotides to determine the
order of amino acids in the
protein)
Cytoplasm of prokaryotes
and eukaryotes
Some proteins feed directly into
rough ER in eukaryotes
2
15. (eukaryotes)
Protein Synthesis
1) INITIATION
• Transcription
Initiation
RNA polymerase binds to a
region on DNA known as the
promoter, which signals the
start of a gene
Promoters are specific to genes
RNA polymerase does not need
a primer
Transcription factors assemble
at the promoter forming a
transcription initiation complex
– activator proteins help stabilize
the complex
Gene expression can be regulated (turned
on/off or up/down) by controlling the amount
of each transcription factor
16. Protein Synthesis
1) INITIATION
• Transcription
Elongation
RNA polymerase unwinds
the DNA and breaks the
H-bonds between the bases
of the two strands, separating
them from one another
Base pairing occurs between
incoming RNA nucleotides
and the DNA nucleotides of
the gene (template)
• recall RNA uses uracil
instead of thymine
AGTCAT
UCAGUA
17. Protein Synthesis
• Transcription
Elongation
RNA polymerase unwinds
the DNA and breaks the
H-bonds between the bases
of the two strands, separating
them from one another.
Base pairing occurs between
incoming RNA nucleotides
and the DNA nucleotides of
the gene (template)
• recall RNA uses uracil
instead of thymine
RNA polymerase catalyzes bond to
form between ribose of 3’ nucleotide
of mRNA and phosphate of incoming
RNA nucleotide
3’
5’
3’
5’
+ ATP
+ ADP
19. Protein Synthesis
1) INITIATION
• Transcription
Termination
A region on DNA known as
the terminator signals the
stop of a gene
RNA polymerase disengages
the mRNA and the DNA
20. Exons are
“coding” regions
Introns are removed
different combinations
of exons form
different mRNA
resulting in multiple
proteins from the
same gene
Humans have 30,000
genes but are capable
of producing 100,000
proteins
Protein Synthesis
• Alternative Splicing (eukaryotes only)
21. mRNA copy of a gene
is synthesized
Cytoplasm of prokaryotes
Nucleus of eukaryotes
1
Protein Synthesis
mRNA is used by ribosome to
build protein
(Ribosomes attach to the
mRNA and use its sequence of
nucleotides to determine the
order of amino acids in the
protein)
Cytoplasm of prokaryotes
and eukaryotes
Some proteins feed directly into
rough ER in eukaryotes
2
mRNA
Transcription
Translation
mRNA
tRNA
synthesis
27. Protein Synthesis
• Translation
Initiation
Start codon signals where the gene
begins (at 5’ end of mRNA)
Ribosome binding site (Shine
Dalgarno sequence) upstream from
the start codon binds to small
ribosomal subunit
– then this complex recruits the
large ribosomal subunit
Small ribosomal subunit
Small ribosomal subunit
Ribosome
Large ribosomal subunit
28. Protein Synthesis
• Translation
Scanning
The ribosome moves in 5’ to 3’ direction “reading” the mRNA and
assembling amino acids into the correct protein
large ribosome subunit
small
ribosome
subunit
32. Practice Question
Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
33. Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser
Practice Question
Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
34. Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
Practice Question
Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
S – Y –H– T – H – P – S – S – S - S
Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser