DNA mutations can cause changes in gene sequences over many generations, leading to evolution through natural selection. Mutations occur randomly during DNA replication and can be beneficial, harmful, or neutral. Charles Darwin observed through his voyage on the HMS Beagle that species adapt to their environments over time, with beneficial traits increasing an organism's chances of survival and reproduction.

1. Mutation, Evolution, and Natural SelectionDNA is found in the nucleus of the cellHttp://www.youtube.com/watch?v=ZK6YP1Smbxk

2. Mutation A mutation is a change in gene sequence.There are many different types of mutations and causes for them.Some mutations are harmful, while others can be beneficial.

3. HarmfulBeneficial

4. How does mutations work?DNA is very accurate when making copies of itself, however, sometimes it makes a mistake.Here’s a DNA sequenceAGCCCTTATAGGCTCWhat are the corresponding base pairs?TCGGGAATATCCGAGNow when it’s being copied it replaces the T with a U. Rewrite the your answer with U’s instead of T’s.UCGGGAAUAUCCGAGWhat amino acids will this be coded for?Serine, Glycine, Isoleucine, Serine, Glutamic Acid

6. The Mutation Here’s our original DNA sequenceAGCCCTTATAGGCTCATCCCTTATAGGCTC we replaced the G with a TNow what are the corresponding base pairs?TAGGGAATATCCGAGNow when it’s being copied it replaces the T with a U. Rewrite the your answer with U’s instead of T’s.UAGGGAAUAUCCGAGWhat amino acids will this be coded for?Stop, Glycine, Isoleucine, Serine, Glutamic Acid You can see how replacing 1 base will change everything!

7. Who was Charles Darwin?British scientist that in 1859 published The Origin of Species

8. Stated that all life come from a common ancestor, called evolution

9. This happens by a process called natural selection.

10. http://www.youtube.com/watch?v=nMgLF8n4DnADarwinGalapagosVoyage of H.M.S. Beagle, 1831 - 183690 feet of ship, 74 people living together for 5 years...

11. Evolution Evolution is the change in the inherited traits (passed on from parents to offspring) of a population over many generations. These traits could be physical, chemical or behavioral. This change is caused by mutations in the genes.http://www.youtube.com/watch?v=yVqJ_mQazik

12. AdaptationAdaptation is the evolutionary process where a population becomes better suited to its habitat.This process takes place over manygenerations.The term adaptation may also refer to a feature which is especially important for an organism's survival.For example, the adaptation of horses' teeth to the grinding of grass, or their ability to run fast and escape predators. Such adaptations are produced in a variable population by the better suited forms reproducing more successfully, which is natural selection.

13. How does Evolution Work?Natural Selection- survival of the fittest. Natural selection is simply the logical result of four features of living systems: variation- individuals in a population vary from one another (different genes caused by mutations)inheritance - parents pass on their traits to their offspring genetically selection - some variants reproduce more than others time - successful variations accumulate over many generations

14. There are 2 variations of the beetles, green and red.The birds prefer eating the green beetles.Over generations the red beetles increase in population because they are not eaten by the birds.More survive to produce more offspring.Generations later….Over time the red beetles have been selected over the green beetles

16. Why does this not work?Change through use and disuse

17. Natural Selection’s ExplanationAncestors had different neck lengthsThrough natural selection, longer necks survived and passed on their genes.Eventually all giraffes had long necks.

18. ONE Ancestor Many Varieties What are the different types?

19. What could cause all the variety?http://www.youtube.com/watch?v=sCEeefdaRcw

20. 225 Million Years Ago the continents were together making a super continent called Pangaea

21. When the continent began to split populations were separated.

22. This increased the variety of living things because they all had to adapt to different and new environments and habitats.When Darwin came across the Galapagos Islands he noticed that the finches had specialized beaks for the different islands.

23. These finches came from a common ancestor, but had adapted to a different environment in order to get a certain food type.