Molecular marker introduction, classification, techniques, classification, application, case study in tomato

1. MOLECULAR MARKERS
Molecular markers are tags; used to identify specific genes and
locate them in relation to other genes
Submitted by
S.ADHIYAMAAN (2017603401)
I-M.Sc.,VEGETABLE SCIENCE
DEPT. OF VEGETABLE CROPS
HC & RI, TNAU, CBE.- 641 003

2. Outline
Introduction
Marker classification
Molecular techniques
Types of molecular marker
Application
Case study

3. • Sequence of Nucleic acids –segment of DNA
• Genetic linkage map
• Detect polymorphism, presence of gene
• Short/SNP/long segment
Markers are not normal genes – no biological effect
But identifiable DNA sequences found at specific locations of the
genome
Genetic marker – powerful tool to enhance the potential of R&D programs
Candidate
gene
Marker
geneDNA Markers

4. • Random marker- located at random sites in the genome and
their relevance to plant function is not known.
• Gene based marker- located within genes
• Functional marker – such gene based marker whose alleles
reliably reflect the functions of the alleles of concerned genes

5. Marker closed linked to the trait of interest will be inherited
together and rarely will be separated by recombination
• Laws of inheritance- Genetic linkage
MEIOSIS
QTL mapping’ is based on the principle that
genes and markers segregate via chromosome
recombination (called crossing-over) during
meiosis (i.e. sexual reproduction), thus allowing
their analysis in the progeny (Paterson, 1996)

6. Scope
• To select plant traits and develop new varieties
• Markers linked to gene of interest
• Enabling use of valuable gene (nutritional and non-nutritional factors )
• Evergreen Revolution (Borlaug, 2001; Swaminathan, 2007).
• Assist in conventional breeding
• Gene pyramid
India is placed at a dismal 97th rank among the 118
countries considered for the global hunger index.
-(The Hindu, Dec. 2016)

7. Perspectives
• Potential genetic gains per unit time
• Population improvement and germplasm enhancement
• New dimension to classical crop improvement
• Innovative management in gene banks
• Enhancement of antioxidants
• Improvements of organoleptic quality improve yield and quality traits
• Variability in popular cultivars
• Transferring QTLs for fruit quality traits
• Pigmentation biosynthetic pathways

8. Good molecular marker
(1) be polymorphic and evenly distributed throughout the genome,
(2) provide adequate resolution of genetic differences
(3) generate multiple, independent and reliable markers
(4) simple, quick and inexpensive
(5) need small amounts of tissue and DNA samples
(6) have linkage to distinct phenotypes, no epistasis
(7) require no prior information about the genome of an organism.

9. Good molecular marker
(8) Frequent occurrence in genome
(9) Selective neutral behaviour (the DNA sequences of any organism
are neutral to environmental conditions or management practices)
(10)Easy access
• But; difficult to find a marker which would meet all the above criteria
• SNP markers are close enough an ideal marker system (Xu Y,2010)

10. GENETICmarker
Morphological markers
Biochemical markers
Allozyme: one enzyme and
one locus
Isozyme: one enzyme,
more than one locus (gene
duplication; gene families)
Molecular markers
Biomarker
Cellular metabolites at
different stage

11. PHENOTYPE MARKER
Due to Ss, SS Genotype
Pumpkin- Yellow spot on upper surface
Watermelon- Non lobed leaf mutant
Variety= Durgapur Lal

12. Morphological marker- male sterility identification
•Bright green hypocotyls - Broccoli
•Glossy foliage - Brussels sprouts
•Potato leaf, green stem - Tomato
•Brown seed coat colour - Onion

13. Biochemical marker
PAGE
• Proteins (Isozymes) - dependant on
environmental factors, superior to
morphological markers
• less polymorphic differences (problem in
commercial breeds of plants)
• Enzymes are separated on the basis of net
charge and mass via electrophoresis gels.
•Particular protein visualized on a gel as bands of different mobility.

14. Protein marker – PAGE Analysis

15. • Four major molecular techniques are commonly applied to reveal
genetic variation.
 Polymerase chain reaction (PCR)
 Electrophoresis
 Hybridization
 DNA sequencing

16. POLYMERASE CHAIN REACTION
PCR is a procedure used to amplify (make multiple copies of) a specific
sequence of DNA
The method was invented by
Kary Banks Mullis in 1983, for
which he received the Nobel
Prize in Chemistry ten years
later
three temperature-
controlled steps

17. ELECTROPHORESIS
Migration rate
depend on electrical
charge and size
The term 'electrophoresis' literally means "to carry
with electricity"
Technique for separating the
components of a mixture of
charged molecules (proteins,
DNAs, or RNAs) in an electric field
within a gel or other support

18. HYBRIDIZATION
One of the most commonly used
nucleic acid hybridization techniques
is Southern blot hybridization
Southern blotting was named after
Edward M. Southern who developed
this procedure at Edinburgh
University in the 1975

19. SEQUENCING
The process of determining the order of the nucleotide bases along a DNA strand is
called sequencing
In 1977, 24 years after the discovery of the structure of DNA, two separate methods
for sequencing DNA were developed: chain termination method and chemical
degradation method
Chain elongation
proceeds until, by
chance, DNA
polymerase inserts a
dideoxynucleotide,
blocking further
elongation
the purines(A+G) are depurinated using formic acid,
the guanines (and to some extent the adenines) are methylated
by dimethyl sulfate, and the pyrimidines (C+T) are hydrolysed
using hydrazine. The addition of salt (sodium chloride) to the
hydrazine reaction inhibits the reaction of thymine for the C-
only reaction.

20. Maxam-Gilbert sequencing method

21. Sanger Sequencing method

22. HIGH THROUGHPUT GENOTYPING
• Analyzes a large number of samples for a very large number of
markers
Low multiplex- KASP TM and Pyrosequencing- refers to sequencing
by synthesis, a simple to use technique for accurate analysis of DNA
sequences
Moderate multiplex- Open array and TaqMan – a probe used to
detect specific sequences in PCR products by employing 5’ to 3’
exonuclease activity of the Taq DNA polymerase
High level multiplexing- Illunina GoldenGate and Affymetrix
Whole genome based array platform

23. TYPES OF MOLECULAR MARKERS
Linked marker - located very close to major genes of interest
Direct marker - it is part of gene of interest
cis marker - linked with the trait of interest (dominant genes)
trans marker - linked with the opposite allele (recessive traits )
Candidate marker = gene of interest
Jargons

24. TYPES OF MOLECULAR MARKERS
• Due to rapid developments in the field of molecular genetics,
a variety of molecular markers has emerged during the last
few decades
Biochemical
marker
Allozyme
Non-PCR
based marker
RFLP
PCR based
marker
Microsatellite, RAPD, AFLP, CAPS
(PCR-RFLP), ISSR, SSCP, SCAR,
SNP, etc.
Traditional
marker
systems
PCR
generation: in
vitro DNA
amplification

25. • Codominance or dominace
Dominant marker:
A marker shows dominant inheritance
with homozygous dominant individuals
indistinguishable from heterozygous
individuals
Codominant marker:
A marker in which both alleles are
expressed, thus heterozygous individuals
can be distinguished from either
homozygous state

26. NON PCR BASED MARKER

27. Restriction fragment length polymorphism (RFLP)
• RFLP were the first type of DNA markers to be studied.
• specific recognition sequences.
• should always produce the same set of fragments.

28. Restriction Fragment Length Polymorphism (RFLP)
• Genomic DNA digested with Restriction Enzymes
• DNA fragments separated via electrophoresis and transfer to
nylon membrane
• Membranes exposed to probes labeled with P32 via southern
hybridization
• Film exposed to X-Ray

29. RFLP
Parent P1 Parent P2
7 kb 5 kb 2 kb
Probe DNA Probe DNA
7 kb
5 kb
P1 P2
F1 plants
7 kb
5 kb
Co-dominant marker

30. RFLP
• Advantages
– Reproducible
– Co-dominant
– Simple
• Disadvantages
– Time consuming
– Expensive
– Use of radioactive
probes

31. PCR BASED MARKER

32.  Collection of plant material
 Isolation of DNA
 Quantification of DNA
 PCR amplification (RAPD/ISSR)
 Agarose gel electrophoresis
 Compilation of data
 Analysis by software (NTSYSpc, Popgene, GenAlex)
PCR based markers using arbitrary primers

33. RAPD
10-12 base pairs
several fragments
Size polymorphism

34. Advantages
Amplifies anonymous stretches of DNA using arbitrary primers
Fast and easy method for detecting polymorphisms
No sequence information needed
Disadvantages
 Dominant markers
 Reproducibility problems

35. Some variations in the RAPD technique
DNA amplification fingerprinting (DAF)
5bp single arbitrary primers
Identification of sex in papaya using OPA 06 primer (Somsri
et al, 2007)
Arbitrary primed Polymerase chain reaction (AP-PCR)
10-50 bp

36. Sequence Characterized Amplified Region (SCAR)
RAPD marker are sequenced and longer primers are
designed (22-24 bp) for specification amplification of
particular locus
The presence or absence of band indicates variation in
sequence
SCAR markers linked to the gene inducing beta-carotene
accumulation in Chinese cabbage (Fenglan et al, 2008)
Known sequence RAPD primer

37. Amplified Fragment Length Polymorphism (PCR + RFLP)
A variant of RAPD.
selectively amplifying a subset of restriction fragments restriction
endonucleases.
- Digestion
- Adaptor Ligation
- Amplification
- Electrophoresis
PROCEDURES

38. AFLP Markers
 Involves cleavage of DNA with two different enzymes
 Involves ligation of specific linker pairs to the digested DNA
 Subsets of the DNA are then amplified by PCR
 The PCR products are then separated on acrylamide gel
 AFLPs have stable amplification and good repeatability
 An additional advantage over RAPD is their reproducibility.
- Involves the use of RFLP and PCR techniques
- Compared with the widely used RFLP, AFLP is faster, less labour intensive
and provide more information.

39. SSR (Simple sequence repeat)
Site of the genome having a specific SSR Sequence is considered as a locus for the concerned SSR
sequence
DNA markers which developed by amplifying microsatellite in the genome
Sequence Primer
ACTGTCGACACACACACACACGCTAGCT (AC)7
TGACAGCTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACGCTAGCT (AC)8
TGACAGCTGTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACACACGCTAGCT (AC)10
TGACAGCTGTGTGTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACACACACACGCTAGCT (AC)12
TGACAGCTGTGTGTGTGTGTGTGTGTGTGTGCGATCGA
AC
GA
AT

40. Electrophoretic analysis of PCR product
Parent 1 Parent 2
SSR Polymorphism
24 bp difference
(CTT)20 times (CTT)12 times
AA
BB
F1 hybrid
A A B B
A B
A
B
Co-dominant marker (diploid
species)- Heterozygous
individuals (AB) can be
distingusied from either
homozygous individuals (AA or
BB)
x
Parent 1 Parent 2

41. Single nucleotide polymorphism (SNP)

42. SNP
Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as
SNPs.
Many SNPs have no effect on cell function and therefore can be used as molecular
markers.
Hybridization using fluorescent dyes
SNPs on a DNA strand
DNA markers which their polymorphism can be determined by single
nucleotide difference

43. SNP
• These are positions in a genome where same individuals have a nucleotide
(G) and other have a different nucleotide (C ).
• Huge number of SNPs present in each genome, at least one for every 10
kb of DNA.
• SNPs therefore enable very detailed genome maps to be constructed.

44. Start codon targeted polymorphism (SCoT)
• SCoT primer – 19 nt
• The amplification of a genomic region will take place when the
start codon of two genes are located within 2 kb of each other
• Dominant marker

45. Other markers
• Cleaved Amplified Polymorphic Sequence (CAPS/PCR-RFLP)
• Inter Simple Sequence Repeat (ISSR)
• Single-strand conformation Polymorphism (SSCP)
More recent markers
• Single-Nucleotide Polymorphism (SNP)
• Diversity Array Technology (DArT)
• Retrotransposon-based markers
Sequence-Specific Amplified Polymorphism (S-SAP)
Inter-retrotransposon Amplified Polymorphism (IRAP)
Retrotransposon-Microsatellite Amplified Polymorphism (REMAP)
Retrotransposon-Based Insertional Polymorphism (RBIP)

46. Markers differ with respect to important features:
• Genomic abundance
• Polymorphism level
• Locus specificity
• Reproducibility
• Technical requirements
• Financial investment

48. 1. Assessment of genetic diversity
 Genetic diversity is the first hand
information.
 Excellent tool for accessing genetic
diversity.
 Direct utility in breeding programme.
 Genetic diversity using molecular
markers has been studied.

49. 2. DNA fingerprinting for varietal identification
 Large number of cultivars in vegetable crops
 Breeders rights : DUS + molecular profiles
 Molecular profiles: biotechnologically developed varieties
 Characterization & protection of germplasm (esp. CMS lines)
 Genetic purity of F1 hybrids

50. GENOME SEQUENCED CROPS
Determining the order of nucleotide
 Cucumber - 367mb
 Potato - 844mb
 Chinese cabbage - 283.8mb
 Tomato - 900mb
 Melon -450mb
 Watermelon - 375mb
https://vegmarks.nivot.affrc.go.jp/VegMarks/app/mapSelect/Crop?crop_id=5

51. APPLICATION GENOME SEQUENCE
• Transcript protein and metabolite profiling
• QTL mapping
• Useful for functional genomics
• Detection in SNP and Mutational analysis
• TILLING or EcoTILLING
• Gene prediction
• Genome Characterization
• Genome evaluation

52. AID IN MUTATION BREEDING

54. Websites for nucleotide & protein database

55. 3. Gene tagging
It refers to mapping of genes of economic importance close to known markers
Molecular marker very closely linked to gene act as a tag
Several genes of economic importance traits like resistance to diseases, insect, stress
tolerance, fertility restoration etc.
A pre-requisite for marker assisted selection (MAS) and map based gene cloning
Linkage maps indicate the position and relative genetic distances between
markers along chromosome. -----------QTL Mapping
 Genetic markers that are located in close proximity to genes (i.e.
tightly linked) may be referred to as gene ‘tags’

56. 4. Sex identification
In plant kingdom dioecy (4% of angiosperm)
Development of male/ female specific markers
Early identification of male & female plants
Efficiency in improving of dioecious vegetables (Ivy gourd, Pointed gourd ,
Spine gourd, Asparagus etc.)
Codominants STS markers enabling the differentiation of XY from YY
males in asparagus were developed by Reamon Buttner and Jung (2002).
BAC-derived diagnostic markers for sex determination in asparagus by
Jamsri & co worker (2003)

57. 5. Genetic mapping
QTL: A region of genome that is associated with an effect on a
quantitative trait.
Software's for QTL analysis: Mapmaker, PlabQTL & MapQTL
The three main steps of linkage map construction are:
(1) production of a mapping population (50-250)
(2) identification of polymorphism and
(3) linkage analysis of markers.

58. Basic procedure in QTL mapping
Development of mapping population
Genotyping and phenotyping of the mapping population
Construction of genetic maps using molecular marker data
Detection of QTL
Confirmation and validation of detected QTL

59. QTL analysis methods
 Single marker ANOVA
 Interval mapping
 Composite Interval Mapping
 Multiple Interval Mapping

60. • Genetic mapping is easier in self pollinated crops than
allogamy due to presence of polyploidy, IBD, recombinant
inbred (RI) takes more time
• Cross b/w heterozygotes and haploid parent , DH

61. Mapping populations

62. • The frequency of recombinant genotypes can be used to calculate
recombination fractions
• Markers that have a recombination frequency of 50% are described as
‘unlinked’ and assumed to be located far apart on the same
chromosome or on different chromosomes.
• Mapping functions are used to convert recombination fractions into
map units called centi-Morgans (cM)

64. Diagram indicating cross-over or recombination events between homologous chromosomes that occur during
meiosis. Gametes that are produced after meiosis are either parental (P) or recombinant (R). The smaller the
distance between two markers, the smaller the chance of recombination occurring between the two markers.
Therefore, recombination between markers G and H should occur more frequently than recombination
between markers E and F. This can be observed in a segregating mapping population. By analysing the number
of recombinants in a population, it could be determined that markers E and F are closer together compared to G
and H.

65. X
Development of saturated genetic maps

66. MAGIC POPULATION :Multiparent Advanced Generation InterCross
Potential of a tomato MAGIC population to decipher the genetic control of quantitative traits and detect causal
variants in the resequencing era

67. QTL cloned
TOMATO
Fruit shape – ovate
Fruit sugar
Fruit weight
Sw4.IQTL
POTATO
Resistance to Ro-1
quality trait cold sweetening
Flavonoid 3,5, hydroxylase
CAULIFLOWER
Orange gene (Or) - DNA J cysteine rich domain
 Candidate gene = Positional cloning complementation

68. 6. Molecular Breeding
6.1 Marker assisted selection (MAS)
6.2 Marker Assisted Backcrossing (MABC)
6.3 Gene pyramiding
6.4 Combined approaches

69. Overall genetic performance of a breeding population will follow a
bell curve distribution
Markers allow breeders to find individuals in the right hand tail of the curve
more quickly, more consistently and at a more competitive cost.

70. Benefits of marker technology in MAS
• Speed
• Consistency
• Efficient
• Effective

71. • Tomato is the first crop in which QTL
mapping and MAS has been
demonstrated
• In 1981: MAS for metric traits using
isozyme markers
• In 1993: first time map-based cloning
• fw2.2 (fruit size)
• ovate (fruit shape)
•Se2.1 (stigma exsertion)
Steven Tanksley
Genesis of MAS

73. • Assembling multiple desirable genes from multiple parents into a single
genotype
• Genotype with all target gene
• Objective
1. Enhance trait performance
2. Increase durability
3. Broadening genetic base
Gene Pyramiding

74. The success of gene pyramiding are the inheritance model of the
genes for the target traits, linkage and pleiotropism between the
target trait and other traits
Problem
• Linkage drag
• Target gene tightly linked to gene with large negative
effects on other traits

75. Advantages of MAS
It can be performed on seedling material
It is not affected by environmental conditions.
Determination of recessive alleles.
Gene pyramiding.
Selecting traits with low heritability.
Testing specific traits (quarantine).
It is cheaper and faster.

76. Other opportunity in Biomarkers (PPV&FR)
• Patent DNA sequences
• Erythropoietin- stimulates RBC (4 B in 2001)
• Patent Gene
• Constraints:
• Restrict competition
• Leads to higher prices
• Curtails new inventions

77. MARKER GENE

78. Marker gene
Vector – Gene of interest + Promoter sequence + Marker gene

79. Types of Marker gene
• Reporter / Scoreable / Screenable gene
• Beta Glucuronidase
• Green Fluorescent Protein
• Firefly Luciferase
• Selectable Marker Gene
• Antibiotic Resistance marker
• Neomycin Phosphotransferase II
• Hygromycin Phosphotransferase
• Herbicide resistance marker
• Bar gene
• Aro A gene

81. Objective
• Ph-3 gene evaluation
• MAS
• Ultracontig
• Development of SCAR Marker

82. Introduction
• Ph-3 locus is resistant to Late blight (Phytophthora infestans) was
evaluated using molecular mapping of the TG328 and TG591 regions
(CAPS marker from Francis et al. 2012)
• which are tightly linked to the Ph-3 locus, was performed using F6 families
derived by crossing the LB-resistant accession “L3708” (Solanum
pimpinellifolium) with the LB-susceptible accession “AV107-4”
(S.lycopersicum)

83. Materials and methods
• The F2 plants were self-pollinated across generations, and 112 F6
recombinant inbred lines (RILs) were generated in a greenhouse at the
Pusan National University between 2008 and 2011.
• Ten inbred tomato accessions possessing resistance to diverse
array of diseases and horticultural characters were used for evaluation
of gene-based SCAR markers. (Hwang et al., 2012)
• DNA isolated from young true leaves by Hwang et al., (2012) method

84. Phenotypic evaluation of RILs
• The purified P. infestans isolate “KA2” was maintained at 22◦C on agar medium
for pathogen inoculation.
• sprayed on seedlings at the 4–5 true leaf stage.
• The inoculated seedlings were maintained in a moistened room at 20◦C for48 h
and were then transferred to a growth chamber maintained at 95% relative
humidity.
• After 3 days, each plant was evaluated visually for the disease severity index
(DSI)
• Disease severity rating (%) = (number of plants with symptom × DSI)
4 × number of plants
Disease severity rating (%) = X 100

85. Linkage evaluation of LB resistance with TG591 and TG328
• Genomic DNA sequence for RFLP clones obtained from SOL genomics
network using the marker search engine
• The ultracontig (SL2.4ch09) of the S.pimpinellifolium draft genome
sequence clone by a BLASTN search
• This ultracontig were confirmed
• Protein coding sequence CDS identified using ClustalW software
Visit this- https://solgenomics.net/

87. Development of the Ph-3 gene-based marker
using ClustalW software PCR primer designed
Genomic organization of the Ph-3 locus
The candidate gene sequence for Ph-3 were identified by BLAST
alignment of the forward and reverse genomic sequences of TG 328 and
TG591 clones in the S. pimpinellifolium draft-genome

88. Result
• Three PCR primer pairs (SCAR-Ph3-
1, SCAR-Ph3-2, and SCAR-Ph3-3),
which covered that regions
• Notably, for SCAR-Ph3-1 and
SCAR-Ph3-3, PCR bands that were
expected from any Ph-3 homolog in
“L3708”were detected whereas a
single PCR band (band a,b, g, and h
in Fig. 4)

89. MAS

90. Discussion
• In the present study, 4 Ph-3 homologs (Ph-3a, Ph-3b,Ph-3c, and Ph-
3d) showed a high level of resistance gene
• Evaluation of SCAR markers revealed polymorphisms between the
Ph-3 candidate alleles of “L3708” and most of the LB-susceptible
accessions tested, which indicated that these SCAR markers could be
efficiently used for introgression of the Ph-3 gene by MAS. Since
Ph-3 exhibited only partial resistance to LB and new pathogenic
strains that could completely overcome Ph-3 may still emerge,
pyramiding multiple LB-resistance genes, including Ph-4, Ph-5, and
other durable QTLs, should be seriously considered.

91. REFERENCE
• Singh B.D and N.S Shekhawat. (2018). Molecular plant breeding.
Scientific Publishers
• (India). New Delhi.
• M.K. Rana (2011). Breeding and Protection of Vegetables. New India
Publishing Agency. New Delhi.
• Tomar R.S. and coworkers. Molecular markers and plant biotechnology
• Collard B.C.Y. et al,. 2005, An introduction to markers, quantitative trait
loci (QTL) mapping and marker-assisted selection for crop improvement:
The basic concepts. Springer Euphytica (2005) 142: 169–196.

92. THANK YOU