genetic mapping

1. Gene mapping
 The technique of genetic mapping was first described in 1911 by Thomas Hunt Morgan, who was studying
the genetics of fruit flies.
 Morgan was able to study genetic mapping because he was able to actually see traits in the flies (like
having white eyes instead of red) that were caused by mutations in single genes. He noticed that some
traits violated Gregor Mendel's Law of Independent Assortment (which said that any two loci would
segregate independently and thus have a recombination fraction of 0.50).
 Genetic mapping did not start being applied to humans until the 1950s, because it was hard to know what
traits were caused by genetic mutations.
 When RFLPs were first described in 1980, a large effort was undertaken to generate maps of all the
chromosomes. The first such maps were made in the early 1980s but covered only parts of chromosomes
and had only a few markers. Maps of whole chromosomes were made by the late 1980s.

2. Introduction
Gene Mapping:
Also called linkage mapping - can offer firm evidence that a disease transmitted
from parent to child is linked to one or more genes. Mapping also provides clues
about which chromosome contains the gene and precisely where the gene lies on
that chromosome.
Assigning/locating of a specific gene to particular region of a chromosome and
determining the location of and relative distances between genes on the
chromosome.
Gene mapping studies the relation of genotypes and phenotypes.
Its goal is to identify, as precisely as possible, genomic regions affecting
particular phenotypes of interest and to estimate the importance of those
regions to phenotypic variability of the trait.

3. Goal
Gene mapping studies the relation of genotypes and phenotypes.
Its goal is to identify, as precisely as possible, genomic regions affecting
particular phenotypes of interest and to estimate the importance of those regions
to phenotypic variability of the trait. Genome Map.
GENOME MAP
A genome map helps scientists navigate around the genome. Like road maps and
other familiar maps, a genome map is a set of landmarks that tells people where
they are, and helps them get where they want to go.
The landmarks on a genome map might include short DNA sequences, regulatory
sites that turn genes on and off, and genes themselves. Often, genome maps are
used to help scientists find new genes.

4. What does a genome map look like?
Most everyday maps have length and width, latitude and longitude, like the
world around us. But a genome map is one-dimensional—it is linear, like the
DNA molecules that make up the genome itself.
A genome map looks like a straight line with landmarks noted at irregular
intervals along it, much like the towns along the map of a highway. The
landmarks are usually inscrutable combinations of letters and numbers that
stand for genes or other features—for example, D14S72, GATA-P7042, and
so on.

5. Why gene mapping is important?
Gene mapping is important because it can help us determine which genes
are responsible for which trait(s). That greatly simplifies scientific
investigations of all sorts.
 For example, using gene mapping, scientists were able to determine that
the same genes were responsible for all of the different bill shapes that are
found in the different species of Galapagos finches. It was then determined
that the different bill shapes are made possible by the differences in timing
and intensity of the expression of these genes.

6. Continue….
 Thirteen species of finches live on the Galápagos, the famous island group
visited by Charles Darwin in the 1830s.
 The finches have a variety of bill shapes and sizes, all suited to their
varying diets and lifestyles. The explanation given by Darwin was that they
are all the offspring of an original pair of finches, and that natural selection
is responsible for the differences.

7. TYPES
 Types of maps:
 Linkage maps
 Physical maps
 Linkage maps
 show the arrangement of genes and genetic markers along the chromosomes as
calculated by the frequency with which they are inherited together.
 Physical maps
 represent chromosomes and provide physical distances between chromosomal
landmarks ideally measured in nucleotide bases

8. Genetic map V/S physical map
 Genetic maps are based on the recombination frequency between molecular
markers. These maps are population specific.
 Physical maps are an alignment of DNA sequences, with distance between
markers measured in base pairs.
 Unique DNA sequences called molecular markers are compared to each other
to determine correct marker order (genetic map) and used to identify
overlapping segments of larger DNA pieces (physical map).
 Genetic mapping is based on recombination, the exchange of DNA sequence
between sister chromatids during meiosis

9. Uses of gene mapping
 Identify genes responsible for diseases.
 Heritable diseases
 Cancer
 Identify genes responsible for traits.
 Plants or Animals
 Disease resistance
 Meat or Milk Production

10. Physical maps useful for sequencing a
genome:
 Low Resolution-Cytogenetic/FISH maps
 Stained chromosomes produce banding patterns composed of bands that average 6
Mb.
 Regions are designated by their position relative to the centromere.
“q” = long arm
“p” = short arm
 Genes and other sequences are localized to chromosome maps with probes and by
using a technique called fluorescent in situ hybridization (FISH)
 Various types of radioactive probes and stains also can be used to mark specific
regions of chromosomes.
 Provides a physical map of the overall structure of each chromosome/region.

12. BASIC CONCEPTS
 Genes with recombination frequencies less than 50 percent are on the
same chromosome = linked)
 Linkage group = all known genes on a chromosome
 Two genes that undergo independent assortment have recombination
frequency of 50 percent and are located on non homologous
chromosomes or far apart on the same chromosome = unlinked
 The presence in a population of two or more relatively common forms of a
gene or a chromosome is called polymorphism.

13. Gene Conversion
 Gene conversion is frequently accompanied by recombination between
genetic markers on either side of the conversion event, even when the
flanking markers are tightly linked
 Gene conversion results from a normal DNA repair process in the cell
known as mismatch repair
 Gene conversion suggests a molecular mechanism of recombination

14.  One of two ways to resolve the resulting structure,
known as a Holliday junction, leads to recombination,
the other does not

15. Role Of Markers
 A genetic marker is a gene or DNA sequence with a known location on a
chromosome and associated with a particular gene or trait.
 markers provide more accurate genetic information and better
understanding to genetic resources.

16. Conti………..
 If the gene product is unknown, locating and sequencing a gene is more
difficult.
 Use recombination frequencies to determine a relative distances between
markers on a chromosome + association with trait or disease of interest.
 The unit measured for each linkage map is the recombination frequency =
recombinants/total progeny.
 Reported as map units (mu) or centiMorgans (cM) --- distinct from physical
distances.

17. Markers which are use in genetic diversity.
RFLPs
 Restriction endonucleases are used to map genes as they produce a
unique set of fragments for a gene
 There are more than 200 restriction endonucleases in use, and each
recognizes a specific sequence of DNA bases
 Example,
EcoR1 cuts double-stranded DNA at the sequence
5’-GAATTC-3’ wherever it occurs

18. SNPs
 Single-nucleotide polymorphisms (SNPs) are abundant in the human
genome
 Rare mutants of virtually every nucleotide can probably be found, but rare
variants are not generally useful for family studies of heritable variation in
susceptibility to disease
 For this reason, in order for a difference in nucleotide sequence to be
considered as an SNP, the less-frequent base must have a frequency of
greater than about 5% in the human population.
 By this definition, the density of SNPs in the human genome averages
about one per 1300 bp

20. SSRs
 A third type of DNA polymorphism results from differences in the number of
copies of a short DNA sequence that may be repeated many times in
tandem at a particular site in a chromosome
 When a DNA molecule is cleaved with a restriction endonuclease that
cleaves at sites flanking the tandem repeat, the size of the DNA fragment
produced is determined by the number of repeats present in the molecule
 There is an average of one SSR per 2 kb of human DNA
GCGTATACGGGTTACCCCCTTTGCAATCAGTGCACACACAC
 ACACACACACACACACACACACACACACACAGTGCCAAGCA

21. High-density genetic
map of 5,264
microsatellites localized
to each of 23
chromosomes.
Humans require 24 different
maps, one for each of the 22
autosomes and one each for
the X and Y chromosomes.

22. Other Markers,
 DNA barcoding markers
 A DNA barcode is a short DNA sequence from a standardized region of the
genome used for identifying species.
 To enhance discovery of new species.
 Allozyme markers
 Allozymes are enzyme variants due to allelic differences and can be
visualized through protein electrophoresis.
 Mitochondrial DNA (mtDNA)
 mtDNA is an extra-chromosomal genome in the cell mitochondria that
resides outside of the nucleus, and is inherited from mother.

23. Thanks