clustered regularly interspaced short palindromic repeats is a family of DNA sequences found in the genomes of prokaryotic organisms such as bacteria. Now CRISPR use as genome editing tool in different Plant Breeder to manipulate the DNA of the crop
CRISPR-Cas9 is a gene editing technique that utilizes the Cas9 enzyme to cut DNA at specific locations guided by CRISPR RNA. It allows scientists to precisely modify genes and has applications in medicine, agriculture, and scientific research. Some examples include developing disease-resistant crops and mosquitoes, growing human organs in pigs, and potentially curing genetic diseases. While promising, CRISPR also faces ethical concerns regarding safety, unintended effects, germline editing, and unequal access to treatment. Overall, CRISPR is a revolutionary new biotechnology but more research is still needed to fully realize its benefits and address ethical implications.
Genome editing with the CRISPR-Cas9 system has become one of the major tools in modern biotechnology. This slide share discusses the fundamentals in a simple, easy to understand format.
1) The document discusses the CRISPR-Cas9 system of genome editing and its applications.
2) CRISPR-Cas9 allows for accurate and multiplex gene modification guided by RNA and is an advanced technique compared to earlier tools like ZFNs and TALENs.
3) The document covers the mechanism of CRISPR-Cas9 immunity in bacteria, the general protocol for genome editing using CRISPR-Cas9, and new developments like modified Cas9 enzymes and the Cpf1 protein.
The document provides an overview of the CRISPR/Cas9 gene editing technology. It discusses the history and components of the CRISPR system, how it works, applications in various fields like microbiology, biomedicine, agriculture, and therapeutics. Recent advances expand its use for transcriptional regulation, epigenetic editing, and live imaging. While powerful, it faces challenges like off-target effects that require further research to optimize its safe and ethical application.
Introduction to CRISPR Cas9 technology. View in slide show after downloading for better viewing. Description is minimal, but it will be worth going through the slides that are full of pictures, if you have a minimal understanding of CRISPR.
Prepared in Oct 2015
Genome editing uses engineered nucleases to insert, delete, or replace sections of the genome. CRISPR/Cas9 is a popular genome editing technique that uses guide RNA to direct nucleases to specific DNA sequences. While promising for treating disease, human germline editing raises ethical concerns. Early studies editing human embryos and non-viable embryos demonstrated proof-of-concept but had low efficiencies and off-target mutations. Later studies improved targeting and showed potential for correcting genetic defects. However, regulation is needed as the first claimed use of CRISPR to genetically edit human babies was unapproved.
Genome editing technologies allow genetic material to be added, removed or altered at specific locations in an organism's genome. Several approaches exist, including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), CRISPR/Cas9, and base editors. These tools create precise breaks in DNA that can be repaired through non-homologous end joining or homology-directed repair. They enable trait discovery and crop improvement by generating plants with high yield, stress resistance, or other desired properties. While powerful, challenges remain in fully editing complex genomes and reducing off-target mutations.
This document summarizes a presentation on CRISPR/Cas genome editing. It defines CRISPR/Cas as a type of genetic engineering that uses artificially engineered nucleases to make specific cuts in DNA. It describes the CRISPR/Cas system's origins and components, including Cas9, guide RNA, and PAM sequences. Applications discussed include genome editing in animals and plants, as well as concerns over off-target effects. Companies offering CRISPR services or kits are also mentioned.
CRISPR-Cas9 is a gene editing technique that utilizes the Cas9 enzyme to cut DNA at specific locations guided by CRISPR RNA. It allows scientists to precisely modify genes and has applications in medicine, agriculture, and scientific research. Some examples include developing disease-resistant crops and mosquitoes, growing human organs in pigs, and potentially curing genetic diseases. While promising, CRISPR also faces ethical concerns regarding safety, unintended effects, germline editing, and unequal access to treatment. Overall, CRISPR is a revolutionary new biotechnology but more research is still needed to fully realize its benefits and address ethical implications.
Genome editing with the CRISPR-Cas9 system has become one of the major tools in modern biotechnology. This slide share discusses the fundamentals in a simple, easy to understand format.
1) The document discusses the CRISPR-Cas9 system of genome editing and its applications.
2) CRISPR-Cas9 allows for accurate and multiplex gene modification guided by RNA and is an advanced technique compared to earlier tools like ZFNs and TALENs.
3) The document covers the mechanism of CRISPR-Cas9 immunity in bacteria, the general protocol for genome editing using CRISPR-Cas9, and new developments like modified Cas9 enzymes and the Cpf1 protein.
The document provides an overview of the CRISPR/Cas9 gene editing technology. It discusses the history and components of the CRISPR system, how it works, applications in various fields like microbiology, biomedicine, agriculture, and therapeutics. Recent advances expand its use for transcriptional regulation, epigenetic editing, and live imaging. While powerful, it faces challenges like off-target effects that require further research to optimize its safe and ethical application.
Introduction to CRISPR Cas9 technology. View in slide show after downloading for better viewing. Description is minimal, but it will be worth going through the slides that are full of pictures, if you have a minimal understanding of CRISPR.
Prepared in Oct 2015
Genome editing uses engineered nucleases to insert, delete, or replace sections of the genome. CRISPR/Cas9 is a popular genome editing technique that uses guide RNA to direct nucleases to specific DNA sequences. While promising for treating disease, human germline editing raises ethical concerns. Early studies editing human embryos and non-viable embryos demonstrated proof-of-concept but had low efficiencies and off-target mutations. Later studies improved targeting and showed potential for correcting genetic defects. However, regulation is needed as the first claimed use of CRISPR to genetically edit human babies was unapproved.
Genome editing technologies allow genetic material to be added, removed or altered at specific locations in an organism's genome. Several approaches exist, including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), CRISPR/Cas9, and base editors. These tools create precise breaks in DNA that can be repaired through non-homologous end joining or homology-directed repair. They enable trait discovery and crop improvement by generating plants with high yield, stress resistance, or other desired properties. While powerful, challenges remain in fully editing complex genomes and reducing off-target mutations.
This document summarizes a presentation on CRISPR/Cas genome editing. It defines CRISPR/Cas as a type of genetic engineering that uses artificially engineered nucleases to make specific cuts in DNA. It describes the CRISPR/Cas system's origins and components, including Cas9, guide RNA, and PAM sequences. Applications discussed include genome editing in animals and plants, as well as concerns over off-target effects. Companies offering CRISPR services or kits are also mentioned.
This document provides information on CRISPR Cas9 genome editing. It discusses the history and discovery of CRISPR dating back to 1987. It describes the key components of the CRISPR Cas9 system including Cas9 proteins, CRISPR RNA, protospacers, and PAM sequences. The mechanisms of how CRISPR Cas9 edits genomes through double strand breaks is explained. Finally, applications of CRISPR Cas9 are summarized, including using it to correct genetic mutations causing diseases in animals and potential applications in humans.
CRISPR-Cas9 system a tool for gene editing presentation RashmiSharma304
CRISPR Cas9 System for Gene Editing
The document summarizes CRISPR Cas9 gene editing. It discusses the timeline of CRISPR discoveries from 1987-2019. It describes the classification, structure, and mechanism of the CRISPR Cas9 system. Applications discussed include using CRISPR in bacteria, wheat, and to alter muscle mass in humans. Ethical concerns regarding uses in human embryos and potential for non-medical enhancement are also covered.
Overview on arabidopsis and rice genomeGopal Singh
This document summarizes the sequencing of the Arabidopsis and rice genomes. It describes that Arabidopsis was the first plant and third multicellular organism to have its genome sequenced, which was completed in 2000 through an international collaboration. The rice genome sequencing project began in 1997 and was completed in 2005, providing a 389Mb sequence with 95% accuracy. Both projects used BAC and PAC libraries to sequence the genomes. The Arabidopsis genome is 115Mb across 5 chromosomes, while the rice genome is larger at 400-430Mb across 12 chromosomes.
Genome editing is a technique used to precisely modify DNA within a cell. It involves using artificially engineered nucleases called "molecular scissors" to cut DNA at specific locations. This creates breaks that can then be repaired through natural cellular processes, allowing the genome to be altered. Early methods like homologous recombination were inefficient. New tools like zinc finger nucleases, TALENs, and the CRISPR/Cas9 system allow genome editing to be targeted to specific DNA sequences with greater accuracy and efficiency. These programmable nucleases make targeted cuts in the genome that can then be repaired through mechanisms like non-homologous end joining or homology-directed repair. CRISPR/Cas9 has become particularly
1. CRISPR is a bacterial immune system that provides immunity against viruses. It works by matching DNA sequences from viruses to DNA spacers and cleaving invading DNA.
2. The type II CRISPR system is the most well studied and requires only three components - Cas9 protein, CRISPR RNA (crRNA), and trans-activating CRISPR RNA (tracrRNA) - to function. Combining crRNA and tracrRNA into a single RNA molecule called sgRNA was crucial for developing the CRISPR technique.
3. CRISPR technology has become a powerful genome editing tool due to its simplicity, high efficiency, low cost, and ease of use. It allows targeted
It is very fast and new technique for detection and degradation of viral DNA and it is so helpful for us to understand how to degraded viral DNA... what type of function naturally present in bacteria........ so its very excellent technique
The document discusses the CRISPR-Cas9 genome editing tool. CRISPR-Cas9 uses an enzyme called Cas9 and a guide RNA to cut DNA at a specific location, allowing DNA to be removed, added, or altered. It was developed based on the bacterial immune system and provides a simple, precise way to edit genomes. While promising for treating genetic diseases, its use in germline editing raises ethical concerns that require further discussion.
CRISPR-Cas9 is a gene editing technology that uses the bacterial immune system to cut DNA at specific locations. It allows researchers to understand, characterize, and control DNA. CRISPR-Cas9 uses an RNA-guided DNA endonuclease enzyme called Cas9 that is directed by guide RNA to cleave target DNA. It has numerous applications including modifying genes in plants and animals, developing disease resistant crops, and potentially curing genetic diseases in humans by precisely editing genes. While revolutionary, it also raises ethical concerns that must be considered and addressed.
The document summarizes the CRISPR-Cas immune system. It discusses how CRISPR-Cas systems use clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins to recognize and cleave foreign DNA. The systems acquire spacers from invading viruses and phages and integrate them into the CRISPR loci to develop immunity. The CRISPR-Cas system has three stages - adaptation, expression and interference. It also discusses applications of CRISPR-Cas9 in genome editing and modulation of gene expression.
CRISPR-Cas is a natural defense system in bacteria that uses CRISPR sequences and Cas proteins to target and degrade foreign DNA such as from viruses. It has been adapted for genome editing in other organisms using a Cas9 protein guided by a synthetic single guide RNA to introduce targeted double-strand breaks. This system allows for precise genome modifications and has applications in biomedical research, disease treatment, and engineering of plants and other organisms. However, off-target effects and delivery methods require further optimization.
Crispr cas: A new tool of genome editing palaabhay
The document summarizes a presentation on CRISPR cas9, a new genome editing tool. It discusses the history of CRISPR, how CRISPR functions in bacteria, the classification and components of CRISPR systems, and the mechanism of CRISPR cas9. It then covers applications of CRISPR cas9 in genome editing, databases of CRISPR sequences, case studies using the technology, and future directions of CRISPR research.
This document discusses genome editing techniques. It begins by defining genomes and how they consist of DNA or RNA that contains both coding and non-coding regions. It then discusses several methods of genome editing including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR-Cas system. Each method uses engineered nucleases to introduce targeted double-strand breaks in DNA, allowing the cell's repair mechanisms to modify the genome. The CRISPR-Cas system was selected as the breakthrough of the year in 2015 due to its simplicity, efficiency and precision for genome editing applications.
CRISPR/Cas9 is an advanced genome editing technology that can be used to develop plant disease resistance. It involves a Cas9 enzyme that acts like molecular scissors to cut DNA at specific locations guided by CRISPR RNA. This triggers DNA repair that can introduce changes to genes. Researchers have used CRISPR/Cas9 to develop resistance in plants against viruses, fungi, and bacteria by editing genes involved in host-pathogen interaction and disease susceptibility. It provides a precise and efficient way to edit plant genomes to improve crop resistance compared to previous tools. Scientists continue working to enhance the specificity and control of CRISPR/Cas9 for genome editing applications in agriculture.
This document provides an overview of CRISPR-Cas9 technology. It defines CRISPR as DNA sequences in bacteria that contain snippets of viral DNA used to detect and destroy invading viruses. The CRISPR system contains Cas9 proteins that cut DNA at specific locations guided by RNA, and RNA guide molecules. It works by integrating viral DNA into the bacteria's CRISPR loci, which are then transcribed into RNA to guide Cas9 to cleave invading viral DNA. Applications of CRISPR include disease modeling, cancer research, and correcting mutations in human embryos.
a brief description on the new emerging genome editing technology CRISPR-Cas9. this technique is making its place stronger and stronger day by day. and impossible things can be possible by this technique. and some main and famous names who discovered this technique.
Transgene-free CRISPR/Cas9 genome-editing methods in plantsCIAT
"Transgene-free CRISPR/Cas9 genome-editing methods in plants" by Matthew R. Willmann, Ph.D. Director, Plant Transformation Facility College of Agriculture and Life Sciences, School of Integrative Plant Science, Cornell University.
This document provides an overview of CRISPR-Cas9 technology. It describes how CRISPR sequences in bacteria contain snippets of DNA from viruses that have attacked the bacterium. These sequences are used by the bacterium to detect and destroy DNA from further viral attacks. The document outlines the mechanism of how the Cas9 protein works with a guide RNA to target and cut specific areas of DNA. Applications of CRISPR-Cas9 technology include gene editing in plants, animals and humans to treat genetic diseases, develop crops with desired traits, and further biomedical research.
This document summarizes information about the CRISPR Cas9 genome editing tool. It discusses how CRISPR Cas9 uses guide RNA and the Cas9 enzyme to create targeted double-strand breaks in DNA, allowing genes to be knocked out or altered. The document outlines the history and mechanism of CRISPR Cas9, compares it to other genome editing tools, discusses its applications in plant breeding including reducing off-target effects, and provides an example of using it to create parthenocarpic tomato plants.
This document provides an overview of CRISPR-Cas9 gene editing technology and its applications in food editing. It explains that CRISPR-Cas9 utilizes guide RNA and Cas9 nuclease to precisely target and edit DNA sequences. The document discusses how CRISPR-Cas9 is being used to improve crop traits like yield, nutrition, and disease resistance in tomatoes, rice, wheat, and other plants. While promising for agriculture, the document notes there are still controversies around off-target effects and safety that require further study before wide application of CRISPR gene editing in food.
CRISPR-Revolutionary Genome editing tools for Plants.....BHU,Varanasi, INDIA
CRISPR/Cas9 is a revolutionary genome editing tool discovered in bacterial immune systems. It provides acquired immunity against viruses and phages. CRISPR components include crRNA, tracrRNA, and Cas9 protein. There is an ongoing patent war over CRISPR between major scientists and institutions. CRISPR has been used to successfully edit plant genomes and develop disease resistant and drought tolerant crops like rice, cotton, wheat, and maize. It also shows promise for developing virus resistant varieties and removing unwanted plant species. CRISPR's applications extend to human health by potentially destroying cancer cells and disabling viruses like HIV.
This document provides information on CRISPR Cas9 genome editing. It discusses the history and discovery of CRISPR dating back to 1987. It describes the key components of the CRISPR Cas9 system including Cas9 proteins, CRISPR RNA, protospacers, and PAM sequences. The mechanisms of how CRISPR Cas9 edits genomes through double strand breaks is explained. Finally, applications of CRISPR Cas9 are summarized, including using it to correct genetic mutations causing diseases in animals and potential applications in humans.
CRISPR-Cas9 system a tool for gene editing presentation RashmiSharma304
CRISPR Cas9 System for Gene Editing
The document summarizes CRISPR Cas9 gene editing. It discusses the timeline of CRISPR discoveries from 1987-2019. It describes the classification, structure, and mechanism of the CRISPR Cas9 system. Applications discussed include using CRISPR in bacteria, wheat, and to alter muscle mass in humans. Ethical concerns regarding uses in human embryos and potential for non-medical enhancement are also covered.
Overview on arabidopsis and rice genomeGopal Singh
This document summarizes the sequencing of the Arabidopsis and rice genomes. It describes that Arabidopsis was the first plant and third multicellular organism to have its genome sequenced, which was completed in 2000 through an international collaboration. The rice genome sequencing project began in 1997 and was completed in 2005, providing a 389Mb sequence with 95% accuracy. Both projects used BAC and PAC libraries to sequence the genomes. The Arabidopsis genome is 115Mb across 5 chromosomes, while the rice genome is larger at 400-430Mb across 12 chromosomes.
Genome editing is a technique used to precisely modify DNA within a cell. It involves using artificially engineered nucleases called "molecular scissors" to cut DNA at specific locations. This creates breaks that can then be repaired through natural cellular processes, allowing the genome to be altered. Early methods like homologous recombination were inefficient. New tools like zinc finger nucleases, TALENs, and the CRISPR/Cas9 system allow genome editing to be targeted to specific DNA sequences with greater accuracy and efficiency. These programmable nucleases make targeted cuts in the genome that can then be repaired through mechanisms like non-homologous end joining or homology-directed repair. CRISPR/Cas9 has become particularly
1. CRISPR is a bacterial immune system that provides immunity against viruses. It works by matching DNA sequences from viruses to DNA spacers and cleaving invading DNA.
2. The type II CRISPR system is the most well studied and requires only three components - Cas9 protein, CRISPR RNA (crRNA), and trans-activating CRISPR RNA (tracrRNA) - to function. Combining crRNA and tracrRNA into a single RNA molecule called sgRNA was crucial for developing the CRISPR technique.
3. CRISPR technology has become a powerful genome editing tool due to its simplicity, high efficiency, low cost, and ease of use. It allows targeted
It is very fast and new technique for detection and degradation of viral DNA and it is so helpful for us to understand how to degraded viral DNA... what type of function naturally present in bacteria........ so its very excellent technique
The document discusses the CRISPR-Cas9 genome editing tool. CRISPR-Cas9 uses an enzyme called Cas9 and a guide RNA to cut DNA at a specific location, allowing DNA to be removed, added, or altered. It was developed based on the bacterial immune system and provides a simple, precise way to edit genomes. While promising for treating genetic diseases, its use in germline editing raises ethical concerns that require further discussion.
CRISPR-Cas9 is a gene editing technology that uses the bacterial immune system to cut DNA at specific locations. It allows researchers to understand, characterize, and control DNA. CRISPR-Cas9 uses an RNA-guided DNA endonuclease enzyme called Cas9 that is directed by guide RNA to cleave target DNA. It has numerous applications including modifying genes in plants and animals, developing disease resistant crops, and potentially curing genetic diseases in humans by precisely editing genes. While revolutionary, it also raises ethical concerns that must be considered and addressed.
The document summarizes the CRISPR-Cas immune system. It discusses how CRISPR-Cas systems use clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins to recognize and cleave foreign DNA. The systems acquire spacers from invading viruses and phages and integrate them into the CRISPR loci to develop immunity. The CRISPR-Cas system has three stages - adaptation, expression and interference. It also discusses applications of CRISPR-Cas9 in genome editing and modulation of gene expression.
CRISPR-Cas is a natural defense system in bacteria that uses CRISPR sequences and Cas proteins to target and degrade foreign DNA such as from viruses. It has been adapted for genome editing in other organisms using a Cas9 protein guided by a synthetic single guide RNA to introduce targeted double-strand breaks. This system allows for precise genome modifications and has applications in biomedical research, disease treatment, and engineering of plants and other organisms. However, off-target effects and delivery methods require further optimization.
Crispr cas: A new tool of genome editing palaabhay
The document summarizes a presentation on CRISPR cas9, a new genome editing tool. It discusses the history of CRISPR, how CRISPR functions in bacteria, the classification and components of CRISPR systems, and the mechanism of CRISPR cas9. It then covers applications of CRISPR cas9 in genome editing, databases of CRISPR sequences, case studies using the technology, and future directions of CRISPR research.
This document discusses genome editing techniques. It begins by defining genomes and how they consist of DNA or RNA that contains both coding and non-coding regions. It then discusses several methods of genome editing including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR-Cas system. Each method uses engineered nucleases to introduce targeted double-strand breaks in DNA, allowing the cell's repair mechanisms to modify the genome. The CRISPR-Cas system was selected as the breakthrough of the year in 2015 due to its simplicity, efficiency and precision for genome editing applications.
CRISPR/Cas9 is an advanced genome editing technology that can be used to develop plant disease resistance. It involves a Cas9 enzyme that acts like molecular scissors to cut DNA at specific locations guided by CRISPR RNA. This triggers DNA repair that can introduce changes to genes. Researchers have used CRISPR/Cas9 to develop resistance in plants against viruses, fungi, and bacteria by editing genes involved in host-pathogen interaction and disease susceptibility. It provides a precise and efficient way to edit plant genomes to improve crop resistance compared to previous tools. Scientists continue working to enhance the specificity and control of CRISPR/Cas9 for genome editing applications in agriculture.
This document provides an overview of CRISPR-Cas9 technology. It defines CRISPR as DNA sequences in bacteria that contain snippets of viral DNA used to detect and destroy invading viruses. The CRISPR system contains Cas9 proteins that cut DNA at specific locations guided by RNA, and RNA guide molecules. It works by integrating viral DNA into the bacteria's CRISPR loci, which are then transcribed into RNA to guide Cas9 to cleave invading viral DNA. Applications of CRISPR include disease modeling, cancer research, and correcting mutations in human embryos.
a brief description on the new emerging genome editing technology CRISPR-Cas9. this technique is making its place stronger and stronger day by day. and impossible things can be possible by this technique. and some main and famous names who discovered this technique.
Transgene-free CRISPR/Cas9 genome-editing methods in plantsCIAT
"Transgene-free CRISPR/Cas9 genome-editing methods in plants" by Matthew R. Willmann, Ph.D. Director, Plant Transformation Facility College of Agriculture and Life Sciences, School of Integrative Plant Science, Cornell University.
This document provides an overview of CRISPR-Cas9 technology. It describes how CRISPR sequences in bacteria contain snippets of DNA from viruses that have attacked the bacterium. These sequences are used by the bacterium to detect and destroy DNA from further viral attacks. The document outlines the mechanism of how the Cas9 protein works with a guide RNA to target and cut specific areas of DNA. Applications of CRISPR-Cas9 technology include gene editing in plants, animals and humans to treat genetic diseases, develop crops with desired traits, and further biomedical research.
This document summarizes information about the CRISPR Cas9 genome editing tool. It discusses how CRISPR Cas9 uses guide RNA and the Cas9 enzyme to create targeted double-strand breaks in DNA, allowing genes to be knocked out or altered. The document outlines the history and mechanism of CRISPR Cas9, compares it to other genome editing tools, discusses its applications in plant breeding including reducing off-target effects, and provides an example of using it to create parthenocarpic tomato plants.
This document provides an overview of CRISPR-Cas9 gene editing technology and its applications in food editing. It explains that CRISPR-Cas9 utilizes guide RNA and Cas9 nuclease to precisely target and edit DNA sequences. The document discusses how CRISPR-Cas9 is being used to improve crop traits like yield, nutrition, and disease resistance in tomatoes, rice, wheat, and other plants. While promising for agriculture, the document notes there are still controversies around off-target effects and safety that require further study before wide application of CRISPR gene editing in food.
CRISPR-Revolutionary Genome editing tools for Plants.....BHU,Varanasi, INDIA
CRISPR/Cas9 is a revolutionary genome editing tool discovered in bacterial immune systems. It provides acquired immunity against viruses and phages. CRISPR components include crRNA, tracrRNA, and Cas9 protein. There is an ongoing patent war over CRISPR between major scientists and institutions. CRISPR has been used to successfully edit plant genomes and develop disease resistant and drought tolerant crops like rice, cotton, wheat, and maize. It also shows promise for developing virus resistant varieties and removing unwanted plant species. CRISPR's applications extend to human health by potentially destroying cancer cells and disabling viruses like HIV.
The document provides an introduction to the CRISPR/Cas9 genome editing technique. It discusses that CRISPR/Cas9 uses guide RNAs to direct the Cas9 nuclease to cut DNA at specific locations, and this double strand break can be repaired through nonhomologous end joining or homology directed repair to knock out or knock in genes. It also explains that CRISPR/Cas9 is more efficient, less expensive, and easier to use than previous genome editing techniques like ZFNs and TALENs. The document outlines several applications of CRISPR/Cas9 in biomedical research areas such as immunology, stem cell research, and generating transgenic animals.
Genome editing in crop improvement one of the desirable biotechnology concept. It is useful for the production of new varieties against resistance to diseases and insect pests
This document provides an overview of CRISPR/Cas9 genome editing. It discusses how CRISPR/Cas9 enables precise modification of DNA sequences, outlines the timeline of key discoveries in CRISPR research, and describes the molecular mechanism and potential applications of this technology, including in microbial research, crop improvement, and human gene therapy. It also notes some limitations of the CRISPR/Cas9 system and concludes by emphasizing the opportunities it provides to advance research and address challenges like food security.
CRISPR-Cas9 is a genome editing tool that is creating a buzz in the science world. It is faster, cheaper and more accurate than previous techniques of editing DNA and has a wide range of potential applications.
This document discusses the CRISPR-Cas9 genome editing technique. It begins with an overview of genome editing and provides a brief history. It then focuses on explaining CRISPR-Cas9, including its key components, how it was discovered as a natural bacterial immune system, and how it functions as a genomic tool. The document outlines the general CRISPR-Cas9 protocol and recent advances in the technique. It discusses applications in agriculture and for diseases. It also touches on advantages and limitations, as well as ethical issues. Two case studies are provided that demonstrate using CRISPR-Cas9 to modify genes in rice plants.
Engineering plant immunity using crispr cas9 to generate virus resistanceSheikh Mansoor
Targeted genome editing by use of artificial nucleases has the plausible potential to speed basic research as well as plant breeding by providing the means to modify genomes quickly in a specific and predictable manner but advanced CRISPR-Cas9 based technologies first confirmed in mammalian cell systems are quickly being fitted for use in plants. These new technologies increase CRISPR-Cas9’s utility and effectiveness by diversifying cellular capabilities through expression construct system evolution and enzyme orthogonality, as well as enhanced efficiency through delivery and expression mechanisms. RNA-guided genome editing using Streptococcus pyogenes CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats) has renewed the concept of genome editing in plants. CRISPR-associated surveillance complexes are easily programmable molecular sleds that can target any sequence of choice. These complexes offer new opportunities for implementation in biotechnology. Recent studies have used CRISPR/Cas9 to engineer virus resistance in plants, either by directly targeting and cleaving the viral genome, or by modifying the host plant genome to introduce viral immunity. The CRISPR/Cas9 platform could also be used for targeted mutagenesis to identify host factors that control plant resistance and susceptibility to viral infection. Thus, CRISPR/Cas9 technology offers a promising approach for under- standing and engineering resistance to single and multiple viral infections in plants.
CRISPR/Cas9 is a genome editing technique that allows for highly specific modification of DNA. It involves a Cas9 protein guiding a customized RNA to a target location in the genome to cut DNA. Scientists adapted the natural CRISPR immune system found in bacteria for genome editing. CRISPR/Cas9 holds promise for treating genetic diseases and developing crops but also raises ethical concerns when applied to human germline cells due to heritable effects. Researchers continue improving targeting specificity and developing new Cas proteins for additional applications in genome editing and gene regulation.
CRISPR-Cas9 is a gene editing technology that uses the Cas9 enzyme guided by CRISPR sequences to target and cleave specific strands of DNA. It provides a simple and precise way to edit genes and is being applied in agriculture, animal breeding, and biomedicine. In agriculture, CRISPR-Cas9 is being used to develop virus-resistant and disease-resistant crops with improved traits like increased nutritional content and stress tolerance. In animals, it is modifying traits like disease resistance and removing allergens from products like eggs and milk. Future applications include improving human health by editing disease-causing genes and enabling organ transplantation.
CRISPR/Cas9 is a powerful genome editing tool that allows genetic material to be added, altered or removed at specific locations in the genome. It involves a bacterial adaptive immune system where CRISPR sequences and Cas genes work together. The Cas9 protein uses a guide RNA to introduce double stranded breaks at targeted DNA sequences. This enables precise genome editing through non-homologous end joining or homology directed repair. CRISPR/Cas9 provides a simple and accurate way to modify genes for applications in research, medicine, agriculture and more. While it holds great promise, there are also limitations and concerns regarding off-target effects that researchers continue working to address.
CRISPR-Cas is an adaptive immune system existing in most bacteria and archaea, preventing them from being infected by phages, viruses and other foreign genetic elements.
This presentation explains about the working and applications of CRISPR-CAS system.
This document discusses genome editing using the CRISPR-Cas9 system. It begins by introducing three main genome editing technologies - zinc-finger nucleases, TALENs, and the CRISPR-Cas9 system. It then describes the key events in the discovery of CRISPR-Cas9, including its origins as a bacterial defense system. The document outlines the main components of the CRISPR-Cas9 system, including crRNA, tracrRNA, sgRNA, and Cas9. It also summarizes the two main steps in genome editing using CRISPR-Cas9 - knocking out genes and DNA repair. The document concludes by discussing opportunities for applying CRISPR-Cas9 technology across various
Genome editing with engineered nucleasesKrishan Kumar
Genome editing uses engineered nucleases to insert, replace or remove DNA from the genome. These nucleases create targeted double-strand breaks which are repaired through natural DNA repair processes, allowing for changes to the genome sequence. Three main engineered nuclease systems for genome editing are ZFNs, TALENs, and CRISPR-Cas9. CRISPR uses a guide RNA and Cas9 nuclease to make precise cuts at targeted DNA sequences for editing. It has advantages over ZFNs and TALENs in being cheaper, easier to design, and more efficient. Genome editing holds promise for applications in crops, medicine, and research.
CRISPR/Cas9 gene editing is based on a microbial restriction system, that has been harnessed for genome targeting using only a short sequence of RNA as a guide.
The beauty of the system is that unlike protein binding based technologies such as Zinc Fingers and TALENs which require complex protein engineering, the design rules are very simple, and it is this fact that is allowing CRISPR to take genome engineering from a relatively niche persuit to the mainstream scientific community.
The principle of the system is that a short guide RNA, homologous to the target site recruits a nuclease – Cas9
This then cuts the dsDNA, triggering repair by either the low fidelity NHEJ pathway, or by HDR in the presence of an exogenous donor sequence.
High Efficiencies for both knockouts and knock-ins have been reported and whilst there are understandable concerns about specificity, new methodologies to address these are now being developed
The system itself is comprised of three key components
the Cas9 protein, which cuts/cleaves the DNA and
Two RNAs - a crispr RNA contains the sequence homologous to the target site and a trans-activating crisprRNA (or TracrRNA) which recruits the nuclease/crispr complex
For genome editing, the crisperRNA and TraceRNA are generally now constructed together into a single guideRNA or sgRNA
Genome editing is elicited through hybridization of the sgRNA with its matching genomic sequence, and the recruitment of the Cas9, which cleaves at the target site.
CRISPR/Cas9 gene editing is based on a microbial restriction system, that has been harnessed for genome targeting using only a short sequence of RNA as a guide.
CRISPR-CAS System: From Adaptive Immunity To Genome editingDebanjan Pandit
The document summarizes the CRISPR-Cas system, beginning with what CRISPR refers to as patterns of DNA sequences found in bacterial genomes. It describes the three stages of adaptive immunity in CRISPR-Cas systems: insertion of invading DNA as a spacer, transcription of precursor CRISPR RNA which is processed into individual CRISPR RNAs targeting the invader, and Cas protein-directed cleavage of foreign nucleic acid guided by the CRISPR RNA. Applications of CRISPR-Cas systems discussed include genome editing, gene regulation through catalytically inactive Cas9 fusion proteins, cargo delivery by fusing Cas9 to other proteins, and RNA cleavage by Type III CRISPR-Cas systems.
1. Researchers used CRISPR/Cas9 to efficiently generate biallelic RAG1 knockout in mouse embryonic stem cells. They designed single-guide RNAs targeting RAG1 and transfected stem cells with Cas9, achieving indels in 92% of clones, including 59% with homozygous out-of-frame mutations.
2. The RAG1 knockout stem cell lines maintained pluripotent gene expression and normal morphology. CRISPR/Cas9 allowed faster generation of RAG1 knockout mice than previous methods by creating chimeric embryos.
3. Precisely designed single-guide RNAs and targeting multiple sites simultaneously enhanced CRISPR/Cas9's ability to introduce double-
1. Researchers used CRISPR/Cas9 to efficiently generate biallelic RAG1 knockout mouse embryonic stem cells (mESCs).
2. They designed sgRNAs targeting RAG1 and transfected mESCs, resulting in mutations in 92% of clones, including 59% with homozygous out-of-frame indels.
3. The RAG1 knockout mESC lines maintained pluripotency gene expression and normal morphology, providing a faster way to generate RAG1 knockout mice than traditional methods.
Similar to CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) (20)
To handle complex Traits like Yield, different stress we must do modification in DNA molecular breeding techniques help us to do such changes in DNA to archive the Goals.
Power Point is deals with the different aspects of Quantitative genetics in plant breeding it converse Basic Principles of Biometrical Genetics, estimation of Variability, Correlation, Principal Component Analysis, Path analysis, Different Matting design and Stability so on
Advanced biometrical and quantitative genetics akshayAkshay Deshmukh
Additive and Multiplicative Model
Shifted Multiplicative Model
Analysis and Selection of Genotype
Methods and steps to select the best model
Bioplot and mapping genotype
Strategies for Effective Upskilling is a presentation by Chinwendu Peace in a Your Skill Boost Masterclass organisation by the Excellence Foundation for South Sudan on 08th and 09th June 2024 from 1 PM to 3 PM on each day.
Communicating effectively and consistently with students can help them feel at ease during their learning experience and provide the instructor with a communication trail to track the course's progress. This workshop will take you through constructing an engaging course container to facilitate effective communication.
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
Chapter wise All Notes of First year Basic Civil Engineering.pptxDenish Jangid
Chapter wise All Notes of First year Basic Civil Engineering
Syllabus
Chapter-1
Introduction to objective, scope and outcome the subject
Chapter 2
Introduction: Scope and Specialization of Civil Engineering, Role of civil Engineer in Society, Impact of infrastructural development on economy of country.
Chapter 3
Surveying: Object Principles & Types of Surveying; Site Plans, Plans & Maps; Scales & Unit of different Measurements.
Linear Measurements: Instruments used. Linear Measurement by Tape, Ranging out Survey Lines and overcoming Obstructions; Measurements on sloping ground; Tape corrections, conventional symbols. Angular Measurements: Instruments used; Introduction to Compass Surveying, Bearings and Longitude & Latitude of a Line, Introduction to total station.
Levelling: Instrument used Object of levelling, Methods of levelling in brief, and Contour maps.
Chapter 4
Buildings: Selection of site for Buildings, Layout of Building Plan, Types of buildings, Plinth area, carpet area, floor space index, Introduction to building byelaws, concept of sun light & ventilation. Components of Buildings & their functions, Basic concept of R.C.C., Introduction to types of foundation
Chapter 5
Transportation: Introduction to Transportation Engineering; Traffic and Road Safety: Types and Characteristics of Various Modes of Transportation; Various Road Traffic Signs, Causes of Accidents and Road Safety Measures.
Chapter 6
Environmental Engineering: Environmental Pollution, Environmental Acts and Regulations, Functional Concepts of Ecology, Basics of Species, Biodiversity, Ecosystem, Hydrological Cycle; Chemical Cycles: Carbon, Nitrogen & Phosphorus; Energy Flow in Ecosystems.
Water Pollution: Water Quality standards, Introduction to Treatment & Disposal of Waste Water. Reuse and Saving of Water, Rain Water Harvesting. Solid Waste Management: Classification of Solid Waste, Collection, Transportation and Disposal of Solid. Recycling of Solid Waste: Energy Recovery, Sanitary Landfill, On-Site Sanitation. Air & Noise Pollution: Primary and Secondary air pollutants, Harmful effects of Air Pollution, Control of Air Pollution. . Noise Pollution Harmful Effects of noise pollution, control of noise pollution, Global warming & Climate Change, Ozone depletion, Greenhouse effect
Text Books:
1. Palancharmy, Basic Civil Engineering, McGraw Hill publishers.
2. Satheesh Gopi, Basic Civil Engineering, Pearson Publishers.
3. Ketki Rangwala Dalal, Essentials of Civil Engineering, Charotar Publishing House.
4. BCP, Surveying volume 1
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UPRAHUL
This Dissertation explores the particular circumstances of Mirzapur, a region located in the
core of India. Mirzapur, with its varied terrains and abundant biodiversity, offers an optimal
environment for investigating the changes in vegetation cover dynamics. Our study utilizes
advanced technologies such as GIS (Geographic Information Systems) and Remote sensing to
analyze the transformations that have taken place over the course of a decade.
The complex relationship between human activities and the environment has been the focus
of extensive research and worry. As the global community grapples with swift urbanization,
population expansion, and economic progress, the effects on natural ecosystems are becoming
more evident. A crucial element of this impact is the alteration of vegetation cover, which plays a
significant role in maintaining the ecological equilibrium of our planet.Land serves as the foundation for all human activities and provides the necessary materials for
these activities. As the most crucial natural resource, its utilization by humans results in different
'Land uses,' which are determined by both human activities and the physical characteristics of the
land.
The utilization of land is impacted by human needs and environmental factors. In countries
like India, rapid population growth and the emphasis on extensive resource exploitation can lead
to significant land degradation, adversely affecting the region's land cover.
Therefore, human intervention has significantly influenced land use patterns over many
centuries, evolving its structure over time and space. In the present era, these changes have
accelerated due to factors such as agriculture and urbanization. Information regarding land use and
cover is essential for various planning and management tasks related to the Earth's surface,
providing crucial environmental data for scientific, resource management, policy purposes, and
diverse human activities.
Accurate understanding of land use and cover is imperative for the development planning
of any area. Consequently, a wide range of professionals, including earth system scientists, land
and water managers, and urban planners, are interested in obtaining data on land use and cover
changes, conversion trends, and other related patterns. The spatial dimensions of land use and
cover support policymakers and scientists in making well-informed decisions, as alterations in
these patterns indicate shifts in economic and social conditions. Monitoring such changes with the
help of Advanced technologies like Remote Sensing and Geographic Information Systems is
crucial for coordinated efforts across different administrative levels. Advanced technologies like
Remote Sensing and Geographic Information Systems
9
Changes in vegetation cover refer to variations in the distribution, composition, and overall
structure of plant communities across different temporal and spatial scales. These changes can
occur natural.
Walmart Business+ and Spark Good for Nonprofits.pdfTechSoup
"Learn about all the ways Walmart supports nonprofit organizations.
You will hear from Liz Willett, the Head of Nonprofits, and hear about what Walmart is doing to help nonprofits, including Walmart Business and Spark Good. Walmart Business+ is a new offer for nonprofits that offers discounts and also streamlines nonprofits order and expense tracking, saving time and money.
The webinar may also give some examples on how nonprofits can best leverage Walmart Business+.
The event will cover the following::
Walmart Business + (https://business.walmart.com/plus) is a new shopping experience for nonprofits, schools, and local business customers that connects an exclusive online shopping experience to stores. Benefits include free delivery and shipping, a 'Spend Analytics” feature, special discounts, deals and tax-exempt shopping.
Special TechSoup offer for a free 180 days membership, and up to $150 in discounts on eligible orders.
Spark Good (walmart.com/sparkgood) is a charitable platform that enables nonprofits to receive donations directly from customers and associates.
Answers about how you can do more with Walmart!"
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...PECB
Denis is a dynamic and results-driven Chief Information Officer (CIO) with a distinguished career spanning information systems analysis and technical project management. With a proven track record of spearheading the design and delivery of cutting-edge Information Management solutions, he has consistently elevated business operations, streamlined reporting functions, and maximized process efficiency.
Certified as an ISO/IEC 27001: Information Security Management Systems (ISMS) Lead Implementer, Data Protection Officer, and Cyber Risks Analyst, Denis brings a heightened focus on data security, privacy, and cyber resilience to every endeavor.
His expertise extends across a diverse spectrum of reporting, database, and web development applications, underpinned by an exceptional grasp of data storage and virtualization technologies. His proficiency in application testing, database administration, and data cleansing ensures seamless execution of complex projects.
What sets Denis apart is his comprehensive understanding of Business and Systems Analysis technologies, honed through involvement in all phases of the Software Development Lifecycle (SDLC). From meticulous requirements gathering to precise analysis, innovative design, rigorous development, thorough testing, and successful implementation, he has consistently delivered exceptional results.
Throughout his career, he has taken on multifaceted roles, from leading technical project management teams to owning solutions that drive operational excellence. His conscientious and proactive approach is unwavering, whether he is working independently or collaboratively within a team. His ability to connect with colleagues on a personal level underscores his commitment to fostering a harmonious and productive workplace environment.
Date: May 29, 2024
Tags: Information Security, ISO/IEC 27001, ISO/IEC 42001, Artificial Intelligence, GDPR
-------------------------------------------------------------------------------
Find out more about ISO training and certification services
Training: ISO/IEC 27001 Information Security Management System - EN | PECB
ISO/IEC 42001 Artificial Intelligence Management System - EN | PECB
General Data Protection Regulation (GDPR) - Training Courses - EN | PECB
Webinars: https://pecb.com/webinars
Article: https://pecb.com/article
-------------------------------------------------------------------------------
For more information about PECB:
Website: https://pecb.com/
LinkedIn: https://www.linkedin.com/company/pecb/
Facebook: https://www.facebook.com/PECBInternational/
Slideshare: http://www.slideshare.net/PECBCERTIFICATION
Temple of Asclepius in Thrace. Excavation resultsKrassimira Luka
The temple and the sanctuary around were dedicated to Asklepios Zmidrenus. This name has been known since 1875 when an inscription dedicated to him was discovered in Rome. The inscription is dated in 227 AD and was left by soldiers originating from the city of Philippopolis (modern Plovdiv).
Gender and Mental Health - Counselling and Family Therapy Applications and In...PsychoTech Services
A proprietary approach developed by bringing together the best of learning theories from Psychology, design principles from the world of visualization, and pedagogical methods from over a decade of training experience, that enables you to: Learn better, faster!
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh - RAYH...
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)
1. Vasantrao Naik Marathwada Krishi Vidyapeeth,
Parbhani
College of Agriculture, Parbhani
Akshay Deshmukh Ph.D. Scholar (2019 A/05P)
1
CRISPR/Cas9 Genome Editing Tool in Plant Breeding
Name of Student : Deshmukh A. S. Registration No. : 2019A/05P
Research Guide : Dr. D. B. Deosarkar Seminar In-charge : Dr. H.V. Kalpande
Semester : III Date : 01/04 /2021
Course No : GP-691 Course Title : Doctoral Seminar
Research Guided:-
Dr. D. B. Deosarkar
Associate Dean and Principal
College of Agriculture,
Golegaon
Head of Department:-
Dr. J. E. Jahagirdar
Dept. Agril. Botany
College of Agriculture,
Parbhani
Seminar Incharge:-
Dr. H. V. Kalpande
Department of Agril. Botany
College of Agriculture,
Parbhani
Presented by – A. S. Deshmukh Ph. D. Scholar (201A/05P)
2. 2
1 • Genome Editing
2 • CRISPR/Cas9
3 • History of CRSPR/Cas System
4 • Prerequisites of CRISPR/Cas System
5 • Target genome editing using CRISPR/Cas9
6 • Mechanism of CRISPR/Cas9 System
7 • Types of CRISPR/Cas9 system
8 • Applications of CRISPR/Cas9 System
9 • Limitation of CRISPR/Cas9 System
10 • Improvement to CRISPR/Cas9 System
11 • Future recommendation of CRISPR/Cse9 System
12 • Case Study
13 • Conclusion of Seminar
INDEX
3. Genome Editing
Genome editing is a group of technologies that gives
scientist the ability to change an organism’s DNA.
These technologies allow genetic material to be added
removed or altered at particular location in the genome.
Why Genome editing…..?
To understand the function of gene or a protein, one
interferes with its in sequence-specific way and monitors
its effects on the plants phenotype.
Allow site specific mutagenesis.
Genome editing gives cent percent results.
Genome editing work on Site specific Nuclease mechanism 3
5. “knocking in” “knocking out”
.
After the DNA break is induced, it will trigger the DNA repair mechanisms.
Non-homologous end joining (NHEJ) mechanism.
Homologous-directed repair (HDR) mechanism.
SSNs-based genome editing system is classified into three categories
Leong et al. (2018) 5
7. CRISPR/Cas9
Clustered regularly interspaced short palindromic repeats
(CRISPR)/ CRISPR-associated nuclease 9 (Cas9)
CRISPR is a family of DNA sequences found in
the genomes of prokaryotic organisms such as bacteria.
These sequences are derived from DNA fragments
of bacteriophages that had previously infected the
prokaryote.
They are used to detect and destroy DNA from similar
bacteriophages during subsequent infections.
The CRISPR-Cas system is a prokaryotic immune system
that confers resistance to foreign genetic elements such as
those present within plasmids and phages and provides a
form of acquired immunity
Cas9 is a 160 kilodalton protein which plays a vital role in
the immunological defense of certain bacteria
against plasmids.
7
Wikipedia
8. History of CRISPR/Cas System
1987
• CRISPR repeats first observed in bacterial genome.
2002
• CRISPR elements and associated genes identified and named.
2005
• CRISPR Spacer identified foreign DNA.
2006
• CRISPR proposed to be a bacterial adoptive immune system.
2012
• CRISPR/Cas9 developed as gene editing tool.
2013
• First use of CRISPR/Cas9 in plants.
2015
• CRISPR/Cas9 used to develop virus-resistant tomato plants.
2016
• USDA determines CRISPR/Cas9 edited crops will be not be regulated as GMOs.
2017
• US patent office awards key CRISPR/Cas9 patents to the broad institute.
2020 • Jennifer A. Doudna & E. Charpentier awarded a Nobel Prize for valuable work on CRISPR.
8
www.sciencedirect.com
11. CAS-9 Nuclease
11
HNH domain
• cleaves the target DNA
strand complimentary to the
guided RNA sequence
RuvC domain • cleave the non target strand
El-Moundai et al. (2020)
12. Mechanism of CRISPR/Cas9 System
Formation of the editing Complex
Cas9 pairing with sgRNA
sgRNA carry complimentary sequences and deliver Cas-9 to the genome
12
13. Pairing with the target gene
Find complimentary sequences
Cas9 + sgRNA join the target genome
13
14. Cutting the Target DNA
Cas9 cut the target gene on the genome
The all attempts to repair the DNA that creates a mutation
that disables its function permanently
14
15. Inserting new gene
Desirable gene with a specific
function is then inserted to fill the
gap and replace the original gene
15
18. Methodology's for the screening of
CRISPR/ Cas9 Plants
qPCR
Mutated DNA sequence easily determine by PCR
qPCR can be used to distinguish wish homozygous and Heterozygous mutation.
Surveyor Nuclease and T7 endonuclease assays
Widely use
Recognize and digest mismatched heteroduplex DNA.
It identify the mismatch and cleave it downstream to the mismatch
High-resolution melting analysis (HRMA) based assays
DNA sequence amplification by qPCR
Incorporating fluorescent dye followed by amplicon melt curve analysis
High-Throughput Tracking of Mutation (H-TOM)
Hi-TOM is an software for detection of mutation cause by the CRISPR system.
Whole-genome sequencing (WGS) to detect on- and off- target
It is crucial to understand the scope of on and off target mutation
18
Manghwar et al. (2019)
20. Types of CRISPR/Cas9 System
20
Jennifer Doudna (2018)
Class-1 Class-2
Type-I Type-III Type-II Type-V Type-VI
cascade Csm/emr Cas9 Cas12 Cas13
Non intrinsic nuclease
activity in cascade
recruits Cas3 to
cleaves DNA
Csm cleaves DNA
(transcription dependent)
RNA
Csm6 is an auxiliary
RNase
Cleaves
dsDNA
Cleaves
dsDNA
Cleaves
ssDNA
21. Different Cas proteins and their
functions
Protein Distribution Process Function
Cas1 Universal Spacer acquisition DNAse, Not sequence specific, can bind RNA; Present
in all types
Cas2 Universal Spacer acquisition Specific to U rich region; Present in all types
Cas3 Type I Signature Target Interference DNA helicase, Endonuclease
Cas4 Type I, II Spacer acquisition RecB- Like nuclease with endonuclease activity
homologous to RecB
Cas5 Type I Spacer acquisition RAMP protein, endoribonuclease involve in crRNA
biogenesis; Part of CASCADE
Cas6 Type I, III Spacer acquisition RAMP protein, endoribonuclease involve in crRNA
biogenesis; Part of CASCADE
Cas7 Type I Spacer acquisition RAMP protein, endoribonuclease involve in crRNA
biogenesis; Part of CASCADE
Cas8 Type I Spacer acquisition Large protein with McrA/HNH-nuclease domain &
RuvC- like nuclease; part of CASCADE
Cas9 Type II Signature Target Interference Large multidomain protein with McrA-HNH
nuclease domain & RuvC- like nuclease domain;
necessary for interference & target cleavage
Cas10 Type III Signature crRNA Expression &
Interference
HD nuclease domain, palm domain Zn Ribbon, some
homologies with CASCADE elements. 21
22. Applications of CRISPR/Cas9
System
Gene Silencing
By Gene Knockout
Transcriptome Analysis/Modification
Allow Selective Transcription
By shutdown the Cas9 protein in the CRISPR/Cas9 and adding
transcription factor.
Targeted mutagenesis
22
Crop Knockout gene Gene Function Achievement
Maize Waxy (WX1) Starch-Synthesis Protein
that involved in Kernel
Maintenance
Uniformity
Stability
Manghwar et al. (2019)
23. Genome-edited Plant
Paint Genome
By deactivating PAM site or catalytic subunit of Cas9, and adding tag FP
(Fluorescent protein) to mark location of specific gene in our genome.
Epigenetic modification
Gene replacement and gene Knock-in
Eg. Replacement of the endogenous 5-enolpyruvylshikimate-3-phosphate synthase
(OsEPSPS) in rice with a gene encoding a form of the protein tolerant to the
herbicide glyphosate.
Multiple GE
Crop Trait improved Name of Organization
Waxy Corn Disease and Drought resistance DuPont Pioneer (USA)
Wheat Produce gluten-free wheat by
eliminating gliadins in wheat
Institute for Sustainable
Agriculture (Spain)
Soybean Produce healthier oil with reduced
unsaturated fat content by increasing
the percentage of oleic acid
Institute for Basic Research
(IBS) (South Korea)
White button
mushroom
Browning resistant Yinong Yang; Penn State
College of Agricultural Science
Manghwar et al. (2019)
23
24. Limitation of CRISPR/Cas9
System
24
Bigger protein size
Limited PAM size
Low HDR efficiency
It introduce multiple and random
mutations in the genome
Needs Agrobacterium-mediated
transformation system
Misuse
Hard to commercialize the
transgenic crops
Manghwar et al. (2019)
25. 25
Dr. He Jiankui
World’s First Genetically Modified Babies
He had worked toward this for two years, altering their
genes as embryos to try making them resistant to their
father’s HIV infection.
26. Improvements to CRISPR/Cas9 System
several modifications of the Cas9 enzyme have
been developed to increase target specificity and
reduce off-target cleavage
An increase in the protospacer adjacent motif
length is another strategy that is being used to
minimize off-target cleavage
26
El-Mounadi et al. (2019)
27. Future recommendations for the
CRISPR/Cas9 System
Future
recommendation
CRISPR/Cas9
System
Gene Knockout
CRISPR activation
Gene Knockdown
CRISPR + epigenetic modification
Gene Knock in
Small size new CRISPR
CRISPR system with no PAM site
Avoid off target effects
High-throughput
Base Editing 27
Manghwar et al. (2019)
28. Case Study I
First Report of CRISPR/Cas9 Mediated
DNA-Free Editing of 4CL and RVE7
Genes in Chickpea Protoplasts
Author:- Sapna Badhan, Andrew S.
Ball and Nitin Mantri *
Publish in:- International Journal of
molecular biology
Published on:- 1 January 2021
Objective:-study will help unravel the
role 4CL and RVE7 genes under
drought stress and understand the
complex drought stress mechanism
pathways.
28
29. Function of Gene:-
4CL- 4-coumarate ligase
4-coumatrate: CoA ligase gene codes for coumarate ligase enzyme
which is well known for its role in the biosynthesis of secondary
plant metabolites during phenylpropanoid metabolism.
phenylpropanoid enzyme is essential for the activation of the
hydroxycinnamic acids during lignin biosynthesis.
RVE7- Reveille 7
RVE7 is a gene that encodes the transcription factor involved in
circadian rhythm and the opening of cotyledon mediated by
phytochrome A.
RVE7 is active in controlling the circadian clock’s downstream
processes such as hypocotyl growth and flowering .
Badhan et al. (2021)29
30. Material Methodology:-
1. Chickpea Plant Material and Cas9 Protein
Commercial Kabuli chickpea plants were use.
The recombinant S. pyogenes Cas9 nuclease purified from an E.coli
strain expressing the nuclease was used in this study.
2. Target Site Selection and sgRNA Design
The sgRNA targets were designed using CHOPCHOP tool
drought tolerance associated genes (4CL and RVE7) were selected for
knockout based on their expression levels in ICC283 and ICC8261 under
drought stress
Gene Name
ICC8261
drought tolerant genotype
ICC283
drought sensitive genotype
RVE7
SAM-2.63,
FB-3.4,
FOF-1.29
YP-1.9
SAM-3.4
FB-3.02
FOF-5.9
YP-0
4CL FB-10.39 Not Differentially expressed data
Badhan et al. (2021)30
31. 3. In Vitro Cleavage Assay
4. Protoplast Isolation
Plant Media BioWORLD kit (Protoplast Isolation kit)
5. Protoplast Transformation with RNP Complex
crRNA + transRNA + Cas9 = RNA cpmolex
The sample treated only with the Cas9 enzyme was used as a negative
control.
6. DNA Extraction and PCR Amplification of Target Region
Gene Name sgRNA sgRNA Sequence
4-coumarate-CoA ligase-like 1
NW_004516753.1_162798-165892
Length 3094
4CLsgRNA1
4CLsgRNA2
TATGTCACCGTCTAGTTCATTGG
GTTTAGGTTACCGAACGAAGAGG
REVEILLE 7-like
NW_004516329.1_420654-4253847
RVE7sgRNA1
RVE7sgRNA2
GTGGAGGATTGAATGTAAGACGG
AGTGTGCAGCTGATGTATCGAGG
Badhan et al. (2021)31
32. Result:-
sgRNA Selection and Design
The sgRNA for the target location were designed using CHOPCHOP and verified by other
tools such as CCTop using the genome sequence for Kabuli chickpea.
Systematic design to show the location of sgRNA target sites in RVE7 and 4CL
nucleotide sequences.
(a) Systematic illustration of the nucleotide sequence of RVE7 gene locus.
(b) Systematic diagram of the nucleotide sequence of 4CL gene locus.
represent exons and connecting lines represent intron
Badhan et al. (2021)32
33. sgRNA Selection and Design In Vitro Digestion Assay
The DNA of 5 kb PCR-amplified fragments for gene 4CL and RVE7 were treated with
preassembled RNP and in vitro cleavage assay was performed.
(a) sgRNA 1 for 4CL and RVE7.
For in vitro cleavage assay non-treated samples were used as negative controls in
gel electrophoresis.
expected band sizes for 4CL is 4931 and 1170;
expected band sizes for RVE7 is 2298 and 3543
(a) sgRNA 2 for 4CL and RVE7.
The digested samples for 4CL left side and RVE7 at right side.
The expected band size for 4CL is 4469 and 1363.
The expected band size for RVE-7 is 4477 and 1428
Badhan et al. (2021)33
34. Conclusion:-
The results obtained from this study could help in developing new
traits and understanding the drought mechanism in chickpea
plants by knocking out the desired gene, followed by protoplast
regeneration or using the plant tissue for transformation.
Badhan et al. (2021)34
35. Case Study II
Programmed Editing of Rice (Oryza sativa
L.) OsSPL16 Gene Using CRISPR/Cas9
Improves Grain Yield by Modulating the
Expression of Pyruvate Enzymes and Cell
Cycle Proteins.
Authors:- Babar Usman, Gul Nawaz,
Neng Zhao, Shanyue Liao, Baoxiang Qin,
Fang Liu, Yaoguang Liu and Rongbai Li
Publish in :- International Journal of
Molecular Science
Published:- 29 December 2020
Objective:-
Improve Grain Yield by Modulating
the Expression of Pyruvate Enzymes
and Cell Cycle Proteins with the
addition of OsSPL16 Gene.
35
Usman et al. (2020)
36. OsSPL16 Gene
OsSPL16 gene encodes a promoter binding protein that promotes cell
division and increases GWD.
Loss-of-function mutations of OsSPL16 confer slender grain type and
better quality of appearance in Basmati rice
Material Methodology:-
1. Material Used and Experimental Conditions
The Indica rice variety VP4892 was selected.
The CRISPR/Cas9 intermediate vector pYLCRISPR/Cas9pubiH and
gRNA promoters (U6a and U6b) used in this study.
Usman et al. (2020)36
37. 2. Target Site Selection and Vector Construction
The OsSPL16 gene is located on chromosome 8,
The OsSPL16 gene has a total length of 5032 bp.
the amplification of the OsSPL16 gene was performed for VP4892 variety
by using specific primers (GW8F/R).
two 20 bp long sgRNAs sequences followed by PAM were designed
We selected five potential off-targets containing at least two nucleotide
mismatches for each target to analyze off-target effects
Usman et al. (2020)37
38. Construction of vector and Rice Transformation
Adapter primersWx-U6-F/Wx-U6-R were use to construct the ligation reaction of
the sgRNA.
The ligation product was used as a template for PCR amplification
The expression cassette was transformed into A. tumefaciens EHA105 by
electroporation and rice transformation was achieved .
Genotyping, Phenotypic and Screening of T-DNA-Free Plants
The target sites of the T0,T1 and T2 generations of the genetic transformation
material were sequenced and analyzed.
The sequencing files were processed using the DSDecode M tool.
The agronomic traits such as Plant height, number of panicle, Panicle length,
thousand grain weight, gran weight etc. mutant lines wee recorded in T0, T1 and
T2 generations.
Protein Preparation, Labeling, and Fractionation
Proteomic data analysis
Proteome Discoverer 1.2 software is use.
Data Analysis
Agronomic data were analyzed with SPSS 20.0 software, using Student’s t-test
The graphs for agronomic data and proteomic data were developed by Graph Pad
Prism
Usman et al. (2020)38
39. Result:-
Validation of Targets Assembly and Genotyping of Mutant Plants
The amplified product was mixed and purified by TaKaRa MiniBEST Purification Kit
Ver.4.0
The purified product was sequenced using specific primers (SPL1/SPR; Table S1).
the constructed vector is suitable for the next step of Agrobacterium Mediated genetic
transformation of rice
Usman et al. (2020)39
40. Genotyping, and Protein Modeling
• 50 calli were treated with transformed A. tumefaciens and 12 rice plantlets were
obtained.
• The sequencing results displayed that 9 independent mutant lines showed
mutations in target sites, representing an editing efficiency of 75%.
First target
• There were 4 mono-allelic heterozygous, 2 bi-allelic heterozygous, 3
homozygous, and 3 Wild Type plantlets.
• GXU52-6 6 bp and GXU52-8 9 bp ) presented homozygous mutation
Second Target
• 3 monoallelic heterozygous, 1 bi-allelic heterozygous, 4 homozygous, and 4
WT plantlets at the second target.
• (GXU52-6 7 bp and GXU52-8 3 bp ) presented homozygous mutations
The predicted off-target regions were successfully amplified and there were no off-target
mutations found in selected five loci against both targets.
Usman et al. (2020)40
42. (A) and grain phenotype (B) of wild type (WT) and mutant lines.
Seeds were randomly collected from GXU52-3, GXU52-6, and GXU52-8 mutant lines
for phenotyping.
Usman et al. (2020)42
43. Conclusion
The targeted multiplex genome editing facilitated the
identification of some candidate proteins and biological pathways
that may involve in rice grain development.
The targeted genome editing also facilitated a path way level study
for engineered rice mutants with enhanced grain yield.
The OsSPL16 mutants laid an imperative material foundation for
additional application in stable and high yield breeding of rice.
43
Usman et al. (2020)
44. Case Study-III
Engineering of CRISPR/Cas9-mediated
potyvirus resistance intransgene-free
Arabidopsis plants
Authors:- Douglas E. Pyott, Emma
Sheehan And Attila Molnar
Publish in :- MOLECULAR PLANT
PATHOLOGY
Published:- 2016
Objective:- potyvirus resistance
intransgene-free Arabidopsis plants
44
45. Materials and methods
Plant growth conditions
Guide RNA design and cloning
Plant transformation
BASTA selection
PCR conditions
T7 endonuclease assay
Sanger sequencing
Viral inoculations
Viral GFP imaging and RT-PCR/quantitative RT-PCR
45
Douglas et al. (2016)
46. As the mutations in the T1
generation occurred in somatic
cells, and so were not
heritable, and different
mutations were recovered in
the T2 generation because of
independent editing events in
the germline of T1.
Non-transgenic T2 plants,
which were homozygous for
either the mutated or wild-type
eIF(iso)4e alleles, were used
to produce T3 populations,
which were then tested for
viral resistance.
46
Douglas et al. (2016)
47. 47
polymerase chain reaction (PCR) was used to confirm the
presence/absence of the Cas9 transgene, using the constitutively
expressed house-keeping gene EF1a as a loading control.
A Cas9 transformant (T1 generation) and a non-transformed
wild-type plant were used as positive and negative controls for Cas9
amplification, respectively.
Samples #41–#49 are a representative selection of T2 progeny from
T1 plant number 1
Candidates #44 and #45 represent two of a total of 55 candidates
lacking the Cas9 transgene, which were selected by this method.
48. 48
Douglas et al. (2016)
Summary of CRISPR/Cas9-
induced eIF(iso)4E mutations.
(A)DNA sequence alignments for
the four homozygous eIF(iso)4E
mutants (#44, #65, #68, #98)
identified in the T2 generation,
together with a wild-type (WT)
control.
Lines #65, #68 and #98 exhibit
single-nucleotide insertions,
whereas line #44 has a single-
nucleotide deletion.
(B) Predicted amino acid sequence
alignments for the four
homozygous mutants and the
wild-type consensus. Each of the
mutant alleles codes for severely
truncated and disrupted proteins
49. 49
Douglas et al. (2016)
(A) Representative photographs of TuMV-
GFP virus-infected plants imaged
under UV light at 7 days post-infection.
A transposon-induced eIF(iso)4E
mutant (Tn) was used as a resistant
control.
(B) RT-PCR to detect the presence of
TuMV-GFP in leaves for each genotype.
• Amplicons of the TuMV coat
protein region (537 bp) and the
house-keeping gene EF1a (418 bp)
were PCR amplified separately
from the same cDNA,
• TuMV-specific amplicons are
clearly visible in each of the wild-
type (WT) samples, but completely
absent from any of the eIF(iso)4E
mutant samples.
(C) Quantitative RTPCRs were performed
with cDNA from a healthy plant (H) and
water (W) as negative controls (NC). Error
bars show the standard error of the mean
(SEM) of three biological replicates.
50. Back-inoculations of Nicotiana benthamiana plants using sap from TuMV-GFP
inoculated Arabidopsis.
Sap was prepared by pooling 20 systemic leaves from TuMV-GFP-inoculated
Arabidopsis.
Each quadrant shows an inoculated leaf (I) and systemic tissue (S) for two
replicate plants imaged under UV light.
50
Thomas et al. (2016)
51. 51
Box plots of dry weights (A) and flowering times (B) for the
CRISPR/Cas9-edited eIF(iso)4E mutants (lines #44, #65, #68
and #98) alongside a wild-type (WT) plant (#105)
52. Conclusion
In this study, we have showcased the utility of CRISPR/Cas9
technology for the generation of novel genetic resistance to TuMV
in Arabidopsis by the deletion of a host factor [eIF(iso)4E] which
is strictly required for viral survival.
52
Thomas et al. (2016)
53. Crop Gene Gene Function
Mutation
type
Editing
efficiency
(%)
Reason for
transformatio
n
Method of
Cas9 system
delivery
Reference
Rice (O.
sativa L.)
TMs5
TMS5 is
thermosensitive genic
male sterility
(TGMS) gene in
China which encodes
the endonuclease
RNase ZS1 in AnS-1
Single
nucleotide
insertions,
deletion and
substitutions
46.2 to
88.2
To develop
commercial
TGMS rice
lines
Agrobacteri
m mediated
delivery
method
.Zhou, H. et
al. (2016)
ALS
Encodes acetolactate
synthase, which is
involved in the
biosynthesis of the
branched amino acid
Point
mutations
Knock-in and
resistant
against
sulfonylurea
herbicides
Agrobacteri
m mediated
transformati
on method
Sun, Y. et al.
(2016)
Wheat
(T.
aestivum
L.)
TaMLO
homologs
Involved to inhibit
resistance pathway to
powdery mildew
Insertion and
deletion
mutations
23–38
To increase
resistance
against
powdery
mildew in
wheat
Particle
bombardmen
t method
Wang, Y. et
al. (2014)
TaGW2
TaGW2 gene plays a
vital role in grain
weight control
Insertion and
deletion
mutations
41.2
For efficient
and specific
genome editing
Cas9-
RNPmediate
d GE method
Liang, Z. et
al. (2017)
Upland
cotton
(G.
hirsutum
L.)
GhCLA1
(Chloroplast
s alterados
1)
Nucleotide
insertion and
substitution
47.6–81.8
For targeted
mutagenesis of
cotton genome
Agrobacteriu
m mediated
transformati
on method
Chen, X. et
al. (2017)
53
54. Crop Gene Gene Function Mutation type
Editing
efficiency
(%)
Reason for
transformation
Method of
Cas9 system
delivery
Reference
Upland
cotton (G.
hirsutum
L.)
GhVP (vacuolar
H+ -
pyrophosphatase)
Nucleotide
deletion and
substitution
47.6–81.8
For targeted
mutagenesis of
cotton genome
Agrobacteriu
m mediated
transformati
on method
Chen, X. et
al. (2017)
An endogenous
gene GhCLA1
and DsRed2
(Discosoma red
fluorescent
protein2)
AtCLA1 is involved
in the development
of chloroplast.
DsRed2 protein is
utilized as a reporter
due to its different
benefits over other
report proteins
Nucleotide
insertions and
deletions
66.7–100
For targeted
mutagenesis of
cotton genome
Agrobacteriu
m mediated
transformati
on and
somatic
embryogene
sis method
Wang, P. et
al. (2018)
GhMYB 25-like
GhMYB25-like is
involved in the
development of
cotton fiber
Nucleotide
insertion and
deletion
mutations
100 and
98.8
For efficient and
specific genome
editing
Agrobacteriu
m mediated
transformati
on and
somatic
embryogene
sis method
Li, C. et al.
(2017)
Maize (Z.
mays L.)
ZmAgo18a and
ZmAgo18b
(Argonaute 18)
and
Dihydroflavonol
4- reductase or
anthocyaninless
(a1 and a4)
Involved in the
biosynthesis of 24-
nt phasiRNA in
anthers
Showed monoor
diallelic
mutations of one
locus and
various allelic
variations of two
loci
70
For mutagenesis
frequency and
heritability
Agrobacteriu
m mediated
transformati
on method
Char, S.N. et
al. (2017)
54
55. Crop Gene Gene Function
Mutation
type
Editing
efficiency
(%)
Reason for
transformati
on
Method of
Cas9 system
delivery
Reference
Soybean
(G. max
L. Merr.)
GmPPD1
and
GmPPD2
PPD protein is
involved in the
transcriptional
regulation of cell
division in Arabidopsis
Heterozygou
s and
chimeric
mutations
68 in
GmPPD1
and 88 in
GmPPD2
Inheritable
sitedirected
mutagenesis
Agrobacteriu
m mediated
transformatio
n method
Kanazashi,
Y. et al.
(2018)
GmFT2a
GmFT2a is an
integrator in the
photoperiod flowering
pathway
Site-directed
and insertion
and deletion
(indels)
mutations
48, 53 and
37
To induce
targeted
mutagenesis
of GmFT2a
Agrobacteriu
m
tumefaciensm
ediated
transformatio
n method
Cai, Y. et al.
(2018)
Tomato
(S.
lycopersi
cum L.)
SlPDS
(phytoene
desaturase)
and SlPIF4
(phytochrom
e interacting
factor)
SlPDS are involved in
carotenoid
biosynthesis. The
SlPIF4 is a
homologous gene of
Arabidopsis PIF4,
which belongs to the
basic helix-loophelix
multigene family
Insertions
and
deletions
(indels)
83.56
For targeted
mutagenesis
in tomato
plants
Agrobacteriu
m
tumefaciensm
ediated
transformatio
n method
Pan, C. et
al. (2016)
SlIAA9
(auxininduce
d 9)
SlIAA9 is a key gene
controlling
parthenocarpy
Insertions
and
deletions
(indels)
100
To generate
parthenocarpi
c tomato
plants
Agrobacteriu
m
tumefaciensm
ediated
transformatio
n method
Ueta, R. et
al. (2017)
55
56. Crop Gene Gene Function Mutation type
Editing
efficiency
(%)
Reason for
transformation
Method of
Cas9 system
delivery
Reference
Barley
(Hordeum
vulgare
L.)
HvPM19
HvPM19 encodes an
ABA-inducible plasma
membrane protein that is
involved in the positive
regulation of grain
dormancy in wheat
Insertion and
deletion
(indels)
mutations
23 and 10
To induce
targeted
mutagenesis of
barley genes
Agrobacteriu
m mediated
transformatio
n method
Lawrenson,
T. et al.
(2015)
Sorghum
(S. bicolor
L.
Moench)
Whole k1C
gene family
Kafirins are proteins that
are used as storage in
Sorghum grains and form
protein bodies with poor
digestibility
Insertion and
deletion
(indels)
mutations
92.4
To create kafirin
variants for the
improvement of
protein
digestibility and
quality
A.
tumefaciensm
ediated
transformatio
n method
Li, A. et al.
(2018)
Rapeseed
(Brassica
napus L.)
RGAs, FULs,
DAs, and
A2.DA2
RGAs act as a master
repressor in gibberellic
signaling. The BnaFULs
are involved in the
regulation of silique
dehiscence during flower
development. The da2
and da1 are serving as
negative regulators of
organ size
Homozygotes,
bialleles, and
heterozygotes
65.3
To induce
targeted genome
modifications at
multiple loci
Agrobacteriu
m mediated
transformatio
n method
Yang, H. et
al. (2017)
Rapeseed
SPL3
homologous
gene copies
SPL3 is key floral
activator which acts
upstream of AP1 in
Arabidopsis
Insertion and
deletion
(indels)
mutations
96.8–100
To rapidly
generate and
identify
simultaneously
mutagenesis of
multiple gene
homologs
Li, C. et al.
(2018)
56
57. Crop Gene Gene Function
Mutation
type
Editing
efficiency
(%)
Reason for
transformat
ion
Method of
Cas9
system
delivery
Reference
Brassica
oleracea
BolC.GA4.
a
GA4 is involved in the
gibberellin
biosynthesis pathway
Insertion and
deletion
(indels)
mutations
10
To induce
targeted
mutagenesis
of B.
oleracea
genes
Agrobacter
ium
mediated
transformat
ion method
Lawrenson, T.
et al. (2015)
Potato
(Solanum
tuberosu
m)
GBSS
(granulebou
nd starch
synthase)
GBSS is responsible
for the synthesis of
amylose
Mutation is
alleles, small
insertions,
and/ or
deletions
(indels)
mutations
Up to 67
In order to
alter the
starch
quality
Transient
transfectio
n and
regeneratio
n from
isolated
protoplasts
Andersson, M.
et al. (2017)
Cucumber
(Cucumis
sativus
L.)
eIF4E
(eukaryotic
translation
initiation
factor 4E)
gene
eIF4E is a plant
cellular translation
factor which plays the
crucial role in the
Potyviridae life cycle
Small
deletions and
single
nucleotide
polymorphis
ms (SNPs)
In order to
enhance
tolerance
against the
virus in
cucumber
A.
tumefacien
smediated
transformat
ion method
.
Chandrasekara
n, J. et al.
(2016)
Watermel
on
ClPDS
(phytoene
desaturase)
ClPDS introduces
obvious albino
phenotype
Insertions or
deletions
100
To
effectively
create
knockout
mutations in
watermelon
Agrobacter
iummediat
ed
transformat
ion method
Tian, S. et al.
(2017)
57
58. Enhancing Abiotic Stress Tolerance In Plant
Crop Gene
Symbol
(gene/QTL)
Target trait References
Rice
calcium-dependent lipid binding annexing OsAnn3 Cold Shen et al. (2017)
Oryza sativa ethylene response factor (ERF) gene
(OsDERF1)
Oryza sativa photo-period sensitive male sterile
(OsPMS3)
OsDERF1,
OsPMS3,
OsEPSPS,
OsMSH1,
OsMYB5
Drought
Zhang et al.
(2014)
osmotic stress/ABA–activated protein kinase 2 OsSAPK2 Drought Lou et al. (2017)
NAM, ATAF and CUC (NAC) transcription factors OsNAC041 Salinity Bo et al. (2019)
Mitogen-activated protein kinase
OsMPK2,
OsDEP1
Yield under
stress
Shan et al. (2014)
Wheat Dehydration responsive element binding
TaDREB2,
TaERF3
Abiotic
stress
Kim et al. (2018)
Tomato
C-repeat-binding factor CBF1
Chilling
tolerance
Li et al. (2018)
Stable tomato non expresser of pathogenesis-related
gene 1
SlNPR1 Drought
Acetolactate synthase
SlALS1,
SlALS2
Herbicide
Veillet et al.
(2019a) 58
59. Conclusion
CRISPR is the most powerful tool of
biotechnology.
With the help of this technology we design the
crop as per our need by modifying the genome
of the crop.
59
Thank You………..
60. Literature Cited
Andersson, M. et al. (2017) Efficient targeted multiallelic mutagenesis in tetraploidpotato (Solanum
tuberosum) by transient CRISPR-Cas9 expression in protoplasts. Plant Cell Rep. 36,
117–128
Anjanabha Bhattacharya Vilas Parkhi Bharat Char (2020) Editors CRISPR/Cas Genome Editing
book Springer
Babar Usman 1 , Gul Nawaz 1 , Neng Zhao 1 , Shanyue Liao 1 , Baoxiang Qin 1 , Fang Liu 1 ,
Yaoguang Liu 2,* and Rongbai Li 1,* (2021) Programmed Editing of Rice (Oryza sativa L.)
OsSPL16 Gene Using CRISPR/Cas9 Improves Grain Yield by Modulating the Expression of
Pyruvate Enzymes and Cell Cycle Proteins Int. J. Mol. Sci., 22, 249
Bo W, Zhaohui Z, Huanhuan Z, Xia W, Binglin L, Lijia Y, Xiangyan H, Deshui Y, Xuelian Z,
Chunguo W (2019) Targeted mutagenesis of NAC transcription factor gene, OsNAC041,
leading to salt sensitivity in rice. Rice Sci 26:98–108
Cai, Y. et al. (2018) CRISPR/Cas9-mediated targeted mutagenesis of GmFT2a delays flowering time
in soya bean. Plant Biotechnol. J. 16, 176–185
Chandrasekaran, J. et al. (2016) Development of broad virus resistance in non-transgenic
cucumber using CRISPR/Cas9 technology. Mol. Plant Pathol. 17, 1140–1153
Char, S.N. et al. (2017) An Agrobacterium-delivered CRISPR/Cas9 system for high-frequency
targeted mutagenesis in maize. Plant Biotechnol. J. 15, 257–268
Chen, X. et al. (2017) Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/
Cas9 system. Sci. Rep. 7, 44304
60
61. 61
Deepa Jaganathan*, Karthikeyan Ramasamy, Gothandapani Sellamuthu, Shilpha Jayabalan and
Gayatri Venkataraman* (2018) CRISPR for Crop Improvement: An Update Review. Front.
Plant Sci. 9:985.
Hakim Manghwar,1,3 Keith Lindsey,2 Xianlong Zhang,1,3, * and Shuangxia Jin1,3, * (2019)
CRISPR/Cas System: Recent Advances and Future Prospects for Genome Editing Trends in
Plant Science, Vol. 24, No. 12 https://doi.org/10.1016/j.tplants.2019.09.006
Kaoutar El-Mounadi 1 , María Luisa Morales-Floriano2,3 and Hernan Garcia-Ruiz 3* Principles,
Applications, and Biosafety of Plant Genome Editing Using CRISPR-Cas9(2020) Front.
Plant Sci. 11:56.
Kah-Yung Bernard Leong, Yee-Han Chan, Wan Muhamad Asrul Nizam Wan Abdullah, Swee-Hua
Erin Lim and Kok-Song Lai(2018) The CRISPR/Cas9 System for Crop Improvement:
Progress and Prospects IntechOpen (http://creativecommons.org/licenses/by/3.0)
Kanazashi, Y. et al. (2018) Simultaneous sitedirected mutagenesis of duplicated loci in soybean using
a single guide RNA. Plant Cell Rep. 37, 553–563
Kim D, Alptekin B, Budak H (2018) CRISPR/Cas9 genome editing in wheat. Funct Integr
Genomics 18:31–41
Lawrenson, T. et al. (2015) Induction of targeted, heritable mutations in barley and Brassica
oleracea using RNA-guided Cas9 nuclease. Genome Biol. 16, 258
Liang, Z. et al. (2017) Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9
ribonucleoprotein complexes. Nat. Commun. 8, 14261
Li R, Zhang L, Wang L, Chen L, Zhao R, Sheng J, Shen L (2018) Reduction of tomato-plant
chilling tolerance by CRISPR–Cas9-mediated SlCBF1 mutagenesis. J Agric Food Chem
66:9042–9051
Li, C. et al. (2017) A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in cotton
(Gossypium hirsutum L.). Sci. Rep. 7, 43902
62. 62
Li, A. et al. (2018) Editing of an alpha-kafirin gene family increases, digestibility and protein
quality in Sorghum. Plant Physiol. 177, 1425–1438
Li, C. et al. (2018) An efficient CRISPR/Cas9 platform for rapidly generating simultaneous
mutagenesis of multiple gene homoeologs in allotetraploid oilseed rape. Front. Plant
Sci. 9, 442
Lou D, Wang H, Liang G, Yu D (2017) OsSAPK2 confers abscisic acid sensitivity and
tolerance to drought stress in rice. Front Plant Sci 8:993
Pan, C. et al. (2016) CRISPR/Cas9-mediated efficient and heritable targeted mutagenesis in
tomato plants in the first and later generations. Sci. Rep. 6, 24765
Sapna Badhan, Andrew S. Ball and Nitin Mantri * (2021) First Report of CRISPR/Cas9
Mediated DNA-Free Editing of 4CL and RVE7 Genes in Chickpea Protoplasts Int. J.
Mol. Sci., 22, 396.
Shan Q, Wang Y, Li J, Gao C (2014) Genome editing in rice and wheat using the CRISPR/Cas
system. Nat Protoc 9:2395
Shen C, Que Z, Xia Y, Tang N, Li D, He R, Cao M (2017) Knock out of the annexin gene
OsAnn3 via CRISPR/Cas9-mediated genome editing decreased cold tolerance in rice.
J Plant Biol 60:539–547
Sun, Y. et al. (2016) Engineering herbicide-resistant rice plants through CRISPR/Cas9-mediated
homologous recombination of acetolactate synthase. Mol. Plant 9, 628–631
Tian, S. et al. (2017) Efficient CRISPR/Cas9-based gene knockout in watermelon. Plant Cell
Rep. 36, 399–406
Thomas B Jacobs1,3,5*, Peter R LaFayette2,3, Robert J Schmitz4 and Wayne A Parrott1,2,3
(2015) Targeted genome modifications in soybean with CRISPR/Cas9 BMC
Biotechnology15:16 DOI 10.1186/s12896-015-0131-2
63. 63
Ueta, R. et al. (2017) Rapid breeding of parthenocarpic tomato plants using CRISPR/Cas9. Sci.
Rep. 7, 507
Veillet F, Chauvin L, Kermarrec M-P, Sevestre F, Merrer M, Terret Z, Szydlowski N, Devaux P,
Gallois J-L, Chauvin J-E (2019a) The Solanum tuberosum GBSSI gene: a target for
assessing gene and base editing in tetraploid potato. Plant Cell Rep 1–16
Wang, P. et al. (2018) High efficient multisites genome editing in allotetraploid cotton (Gossypium
hirsutum) using CRISPR/Cas9 system. Plant Biotechnol J. 16, 137–150
Wang, Y. et al. (2014) Simultaneous editing of three homoeoalleles in hexaploid bread wheat
confers heritable resistance to powdery mildew. Nat. Biotechnol. 32, 947–951
Yang, H. et al. (2017) CRISPR/Cas9-mediated genome editing efficiently creates specific
mutations at multiple loci using one sgRNA in Brassica napus. Sci. Rep. 7, 7489
Zhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, Mao Y, Yang L, Zhang H, Xu N (2014) The
CRISPR/C as9 system produces specific and homozygous targeted gene editing in rice in
one generation. Plant Biotechnol J 12:797–807
Zhou, H. et al. (2016) Development of commercial thermo-sensitive genic male sterile rice
accelerates hybrid rice breeding using the CRISPR/Cas9- mediated TMS5 editing system.
Sci. Rep. 6, 37395
Editor's Notes
Spacer DNA Noncoding DNA that separates one gene from another gene.
PAM 2-6 base pair DNA sequence immediately downstream to the DNA sequence targeted by the Cas9 nuclease in CRISPR bacterial adaptive immune system
Detection of on- and off target efficiency of CRISPR/Cas9-mutated plants by T7E1.
Amplicon product of amplification
SAM- Shoot apical meristem, FB-Flower bud, FOF-fully opened flower, YP-Young pod
1% agarose gel
inoculated (left) and systemic (right) leaves inoculated (I) and systemic (S) a 2% agarose gel