The polymerase chain reaction (PCR) can produce many copies of a specific segment of DNA. It works through a three-step cycle of heating, cooling, and replication that causes exponential growth in the number of DNA molecules matching the target sequence. PCR is a versatile technique for amplifying DNA sequences in vitro. It is sensitive, quick, easy to use, and robust.
PCR is a technique which is used to amplify the number of copies of a specific region of DNA, in order to produce enough DNA to be adequately tested.
Cell-free amplification for synthesizing multiple identical copies (billions) of any DNA of interest.
Basic tool for the molecular biologist.
The purpose of a PCR is to make a huge number of copies of a gene. As a result, it now becomes possible to analyze and characterize DNA fragments found in minute quantities in places like a drop of blood at a crime scene or a cell from an extinct dinosaur.
Like Xerox machine for gene copying.
PCR is a technique which is used to amplify the number of copies of a specific region of DNA, in order to produce enough DNA to be adequately tested.
Cell-free amplification for synthesizing multiple identical copies (billions) of any DNA of interest.
Basic tool for the molecular biologist.
The purpose of a PCR is to make a huge number of copies of a gene. As a result, it now becomes possible to analyze and characterize DNA fragments found in minute quantities in places like a drop of blood at a crime scene or a cell from an extinct dinosaur.
Like Xerox machine for gene copying.
PCR,polymerase chain reaction.Basic concept of PCR.naveed ul mushtaq
PCR.Basic concept of PCR. Steps in PCR.
Quantitative real time polymerase chain reaction.Fluorescent dyes and probes.
Advantages real-time PCR.
Real-time PCR primer
Primer design software
A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR). It monitors the amplification of a targeted DNA molecule during the PCR, i.e. in real-time, and not at its end, as in conventional PCR.
https://www.patreon.com/biotechlive
SUPPORT EDUCATION... SUPPORT US
published a DNA sequencing method in 1977 based on chemical modification of DNA and subsequent cleavage at specific bases. Also known as chemical sequencing, this method allowed purified samples of double-stranded DNA to be used without further cloning.
Maxam-Gilbert sequencing requires radioactive labeling at one 5' end of the DNA and purification of the DNA fragment to be sequenced. Chemical treatment then generates breaks at a small proportion of one or two of the four nucleotide bases in each of four reactions (G, A+G, C, C+T). The concentration of the modifying chemicals is controlled to introduce on average one modification per DNA molecule. Thus a series of labeled fragments is generated, from the radiolabeled end to the first "cut" site in each molecule. The fragments in the four reactions are electrophoresed side by side in denaturing acrylamide gels for size separation. To visualize the fragments, the gel is exposed to X-ray film for autoradiography, yielding a series of dark bands each corresponding to a radiolabeled DNA fragment, from which the sequence may be inferred.
PCR,polymerase chain reaction.Basic concept of PCR.naveed ul mushtaq
PCR.Basic concept of PCR. Steps in PCR.
Quantitative real time polymerase chain reaction.Fluorescent dyes and probes.
Advantages real-time PCR.
Real-time PCR primer
Primer design software
A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR). It monitors the amplification of a targeted DNA molecule during the PCR, i.e. in real-time, and not at its end, as in conventional PCR.
https://www.patreon.com/biotechlive
SUPPORT EDUCATION... SUPPORT US
published a DNA sequencing method in 1977 based on chemical modification of DNA and subsequent cleavage at specific bases. Also known as chemical sequencing, this method allowed purified samples of double-stranded DNA to be used without further cloning.
Maxam-Gilbert sequencing requires radioactive labeling at one 5' end of the DNA and purification of the DNA fragment to be sequenced. Chemical treatment then generates breaks at a small proportion of one or two of the four nucleotide bases in each of four reactions (G, A+G, C, C+T). The concentration of the modifying chemicals is controlled to introduce on average one modification per DNA molecule. Thus a series of labeled fragments is generated, from the radiolabeled end to the first "cut" site in each molecule. The fragments in the four reactions are electrophoresed side by side in denaturing acrylamide gels for size separation. To visualize the fragments, the gel is exposed to X-ray film for autoradiography, yielding a series of dark bands each corresponding to a radiolabeled DNA fragment, from which the sequence may be inferred.
this ppt contain about pcr technique and its three process,primers in pcr,dna polymerase in pcr,melting temp of dna in pcr and applications of pcr technology
What is PCR?
History of PCR
Components of PCR
Principles of PCR
Basic Requirements
Instrumentation
PCR Programme
Advantages of PCR
Applications of PCR
Conclusion
References
PCR is a revolutionary molecular biology technique used for enzymatically replicating DNA . This technique allows a small amount of DNA molecule to be amplified many times in an exponential manner . It is commonly used in medical and biological research labs for variety of tasks such as detection of hereditary disease , identification of genetic fingerprints diagnosis of infectious disease , cloning of genes and paternity testing .
Each reaction cycle doubles the amount of DNA – a standard PCR sequence of 30 cycles creates over 1 billion copies . The thermostability of DNA polymerases is defined by how long they remain active at the extreme range of temperatures used in PCR.
There have been various thermostable polymerases identified to date, each with its optimal temperature for activity and a unique half-life profile at temperatures greater than 95°C. For example, the half-life of Taq polymerase at 95°C is 40 minutes, whereas the half-life of the hyperthermophilic Deep Vent DNA polymerase extracted from the Pyrococcus species GB-D is several hours at 98–100°C. Polymerase processivity is defined as the number of consecutive nucleotides a single enzyme can incorporate before being dislodged from the DNA template.
At 75°C, native Taq polymerases can typically amplify DNA at a rate of 10–45 nucleotides per second - that’s approximately 2 kilobases per minute!
Some DNA polymerases have been engineered to improve their binding domain, thus making them more stable than conventional Taq. For example, KAPA2G polymerase has a speed of ~150 nucleotides per second - 3-fold higher than Taq. Direct PCR cloning methods include TA and GC cloning, as well as TOPO® Cloning, and enable direct cloning of PCR fragments. For example, the TA cloning approach takes advantage of the 3’ A overhang naturally added to products by Taq polymerase following PCR. The resulting sticky ends then enable recombination with DNA fragments containing 3’ T overhangs, such as linearized vectors.
During indirect PCR cloning, the PCR products are modified prior to recombination with other DNA sequences. For example, in restriction cloning, restriction sites are frequently introduced via PCR to enable restriction digestion and ligation with linearized vectors. PCR mutagenesis is a technique used to generate site-directed sequence changes such as base substitutions, inserts and deletions.
To insert a single point mutation via mutagenesis, for example, PCR primers are designed that contain the desired base change, usually in the middle of the primer sequence. PCR is then performed with the mutagenic primers and a high-fidelity DNA polymerase, which results in the incorporation of the desired mutation into the original sequence.Allele-specific PCR is used to detect sequence variations and ultimately determine the genotype of an organism.
For allele-specific PCR, primers are designed to flank the region of interest. The most common application of PCR is gene expression analysis
Polymerase chain reaction (abbreviated PCR) is a laboratory technique for rapidly producing (amplifying) millions to billions of copies of a specific segment of DNA, which can then be studied in greater detail. PCR involves using short synthetic DNA fragments called primers to select a segment of the genome to be amplified, and then multiple rounds of DNA synthesis to amplify that segment. This slides introduces pcr importances ,uses and steps of pcr.
Epistemic Interaction - tuning interfaces to provide information for AI supportAlan Dix
Paper presented at SYNERGY workshop at AVI 2024, Genoa, Italy. 3rd June 2024
https://alandix.com/academic/papers/synergy2024-epistemic/
As machine learning integrates deeper into human-computer interactions, the concept of epistemic interaction emerges, aiming to refine these interactions to enhance system adaptability. This approach encourages minor, intentional adjustments in user behaviour to enrich the data available for system learning. This paper introduces epistemic interaction within the context of human-system communication, illustrating how deliberate interaction design can improve system understanding and adaptation. Through concrete examples, we demonstrate the potential of epistemic interaction to significantly advance human-computer interaction by leveraging intuitive human communication strategies to inform system design and functionality, offering a novel pathway for enriching user-system engagements.
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered QualityInflectra
In this insightful webinar, Inflectra explores how artificial intelligence (AI) is transforming software development and testing. Discover how AI-powered tools are revolutionizing every stage of the software development lifecycle (SDLC), from design and prototyping to testing, deployment, and monitoring.
Learn about:
• The Future of Testing: How AI is shifting testing towards verification, analysis, and higher-level skills, while reducing repetitive tasks.
• Test Automation: How AI-powered test case generation, optimization, and self-healing tests are making testing more efficient and effective.
• Visual Testing: Explore the emerging capabilities of AI in visual testing and how it's set to revolutionize UI verification.
• Inflectra's AI Solutions: See demonstrations of Inflectra's cutting-edge AI tools like the ChatGPT plugin and Azure Open AI platform, designed to streamline your testing process.
Whether you're a developer, tester, or QA professional, this webinar will give you valuable insights into how AI is shaping the future of software delivery.
The Art of the Pitch: WordPress Relationships and SalesLaura Byrne
Clients don’t know what they don’t know. What web solutions are right for them? How does WordPress come into the picture? How do you make sure you understand scope and timeline? What do you do if sometime changes?
All these questions and more will be explored as we talk about matching clients’ needs with what your agency offers without pulling teeth or pulling your hair out. Practical tips, and strategies for successful relationship building that leads to closing the deal.
Securing your Kubernetes cluster_ a step-by-step guide to success !KatiaHIMEUR1
Today, after several years of existence, an extremely active community and an ultra-dynamic ecosystem, Kubernetes has established itself as the de facto standard in container orchestration. Thanks to a wide range of managed services, it has never been so easy to set up a ready-to-use Kubernetes cluster.
However, this ease of use means that the subject of security in Kubernetes is often left for later, or even neglected. This exposes companies to significant risks.
In this talk, I'll show you step-by-step how to secure your Kubernetes cluster for greater peace of mind and reliability.
Generating a custom Ruby SDK for your web service or Rails API using Smithyg2nightmarescribd
Have you ever wanted a Ruby client API to communicate with your web service? Smithy is a protocol-agnostic language for defining services and SDKs. Smithy Ruby is an implementation of Smithy that generates a Ruby SDK using a Smithy model. In this talk, we will explore Smithy and Smithy Ruby to learn how to generate custom feature-rich SDKs that can communicate with any web service, such as a Rails JSON API.
Essentials of Automations: Optimizing FME Workflows with ParametersSafe Software
Are you looking to streamline your workflows and boost your projects’ efficiency? Do you find yourself searching for ways to add flexibility and control over your FME workflows? If so, you’re in the right place.
Join us for an insightful dive into the world of FME parameters, a critical element in optimizing workflow efficiency. This webinar marks the beginning of our three-part “Essentials of Automation” series. This first webinar is designed to equip you with the knowledge and skills to utilize parameters effectively: enhancing the flexibility, maintainability, and user control of your FME projects.
Here’s what you’ll gain:
- Essentials of FME Parameters: Understand the pivotal role of parameters, including Reader/Writer, Transformer, User, and FME Flow categories. Discover how they are the key to unlocking automation and optimization within your workflows.
- Practical Applications in FME Form: Delve into key user parameter types including choice, connections, and file URLs. Allow users to control how a workflow runs, making your workflows more reusable. Learn to import values and deliver the best user experience for your workflows while enhancing accuracy.
- Optimization Strategies in FME Flow: Explore the creation and strategic deployment of parameters in FME Flow, including the use of deployment and geometry parameters, to maximize workflow efficiency.
- Pro Tips for Success: Gain insights on parameterizing connections and leveraging new features like Conditional Visibility for clarity and simplicity.
We’ll wrap up with a glimpse into future webinars, followed by a Q&A session to address your specific questions surrounding this topic.
Don’t miss this opportunity to elevate your FME expertise and drive your projects to new heights of efficiency.
Elevating Tactical DDD Patterns Through Object CalisthenicsDorra BARTAGUIZ
After immersing yourself in the blue book and its red counterpart, attending DDD-focused conferences, and applying tactical patterns, you're left with a crucial question: How do I ensure my design is effective? Tactical patterns within Domain-Driven Design (DDD) serve as guiding principles for creating clear and manageable domain models. However, achieving success with these patterns requires additional guidance. Interestingly, we've observed that a set of constraints initially designed for training purposes remarkably aligns with effective pattern implementation, offering a more ‘mechanical’ approach. Let's explore together how Object Calisthenics can elevate the design of your tactical DDD patterns, offering concrete help for those venturing into DDD for the first time!
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024Tobias Schneck
As AI technology is pushing into IT I was wondering myself, as an “infrastructure container kubernetes guy”, how get this fancy AI technology get managed from an infrastructure operational view? Is it possible to apply our lovely cloud native principals as well? What benefit’s both technologies could bring to each other?
Let me take this questions and provide you a short journey through existing deployment models and use cases for AI software. On practical examples, we discuss what cloud/on-premise strategy we may need for applying it to our own infrastructure to get it to work from an enterprise perspective. I want to give an overview about infrastructure requirements and technologies, what could be beneficial or limiting your AI use cases in an enterprise environment. An interactive Demo will give you some insides, what approaches I got already working for real.
Connector Corner: Automate dynamic content and events by pushing a buttonDianaGray10
Here is something new! In our next Connector Corner webinar, we will demonstrate how you can use a single workflow to:
Create a campaign using Mailchimp with merge tags/fields
Send an interactive Slack channel message (using buttons)
Have the message received by managers and peers along with a test email for review
But there’s more:
In a second workflow supporting the same use case, you’ll see:
Your campaign sent to target colleagues for approval
If the “Approve” button is clicked, a Jira/Zendesk ticket is created for the marketing design team
But—if the “Reject” button is pushed, colleagues will be alerted via Slack message
Join us to learn more about this new, human-in-the-loop capability, brought to you by Integration Service connectors.
And...
Speakers:
Akshay Agnihotri, Product Manager
Charlie Greenberg, Host
GraphRAG is All You need? LLM & Knowledge GraphGuy Korland
Guy Korland, CEO and Co-founder of FalkorDB, will review two articles on the integration of language models with knowledge graphs.
1. Unifying Large Language Models and Knowledge Graphs: A Roadmap.
https://arxiv.org/abs/2306.08302
2. Microsoft Research's GraphRAG paper and a review paper on various uses of knowledge graphs:
https://www.microsoft.com/en-us/research/blog/graphrag-unlocking-llm-discovery-on-narrative-private-data/
Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...Ramesh Iyer
In today's fast-changing business world, Companies that adapt and embrace new ideas often need help to keep up with the competition. However, fostering a culture of innovation takes much work. It takes vision, leadership and willingness to take risks in the right proportion. Sachin Dev Duggal, co-founder of Builder.ai, has perfected the art of this balance, creating a company culture where creativity and growth are nurtured at each stage.
2. Amplifying DNA in Vitro: The
Polymerase Chain Reaction (PCR)
The polymerase chain reaction, PCR, can
produce many copies of a specific target
segment of DNA
A three-step cycle—heating, cooling, and
replication—brings about a chain reaction that
produces an exponentially growing population
of identical DNA molecules
3. Polymerase chain reaction
a.k.a. DNA amplification
in vitro method to specifically amplify nucleic acid
sequences
A most important and versatile technique
Very sensitive
Quick
Easy
robust
http://highered.mcgraw-hill.com/sites/0073031208/
4. Amplification by replicating
a specific sequence of DNA
many times
From one…
…to billions
of copies
Brock Biology of the Microorganism
10. DNA Amplification = DNA replication
Same requirements !
Double helix must unwind
Primers
Deoxynucleotides (dNTPs)
Polymerase
Brock Biology of the Microorganism
15. Important to understand :
PCR is specific
because of the primers
we design the primers to anneal to specific sequences
That means, we must know what we want to amplify
The sequence between the two primers is amplified
other parts of the DNA will not be amplified
Amplification is exponential
the newly synthesised DNA served as templates for further
rounds of amplification
16. The power of PCR
e.g. detection of viral /bacterial pathogens
Current technology
-
-
culture the pathogen
Run biochemical/ immunological test
Time consuming
Some viruses & bacteria cannot yet be cultured
Delay diagnosis, wrong diagnosis, or not specific
enough
e.g. SARS, bird flu
17. With PCR
Go straight for the DNA
No need to culture, biochemical test etc.
e.g Bacillus anthracis
First, we must be able to identify a gene/DNA sequence that is
unique to the anthrax bacteria
This gene or sequence must be present only in the B.anthracis
DNA, and not the DNA of any other organism, virus etc.
18. Then, we need to know a bit of the DNA sequence of this
anthrax gene (the ‘target’)
So that we can design specific primers that only anneals
to the target anthrax DNA
and not any other DNA
19. Then we do a PCR using these anthrax-specific primers
and DNA extracted from patient’s blood
Only a very small amount of blood is required < 0.1 ml
http://nobelprize.org/chemistry/laureates/1993/illpres/pcr.gif
20. +ve sample
Primers
anneal to
target DNA
anthrax
gene is
amplified
-ve sample
No amplification
Because
primers cannot
anneal with any
other DNA
22. PCR offers many advantages :
no need to isolate/culture the pathogens – extract DNA from soil and
other samples
Very sensitive – amplify from only one copy of target (well, in
theory), so requires very little sample
Highly specific – can even identify different species or strains
accurately
Fast – a few hours
Allows for diagnosis before disease develops
This is only one of the many applications of PCR, we will discuss
may more later
24. PCR reaction requires
Target DNA – a tiny bit will do
Specific primers - most crucial
Must know sequence
Must be correctly designed
DNA polymerase - heat stable
Thermocycler - machine to heat
and cool
dNTPs – building blocks for new
DNA synthesis
Buffer – to provide correct conditions
for the enzyme to work
26. Buffer & MgCl2
Always use buffer that comes with enzyme
(unless you’re one of those who knows better!)
MgCl2 - affects specificity and yield
usually about 2 mM
High [MgCl] - more product but less specific
Low [MgCl] – less product but more specific
Optimise !
27. dNTPs
premade & premix – just buy them
Use 50 to 500 mM each
50 mM enough to make 6 ug of products
28. Primers
Most crucial
Primers are designed by you and synthesized on a machine
Occasionally primers fail for apparently no reason, so don’t feel bad
Ensure quality of primers – get a good supplier
Guidelines
Check orientation of primers
20 to 30 base pair long
Go for 40 to 50% GC content
Avoid internal structure
Avoid complimentarity between primers, esp at 3’ end
Avoid extensive GC’s at 3’ end
29. Orientation of primers
CTTATTAGTTTACTAT
5’CTTATTAGTTTACTATAAAGGAGTCGAAAGAGAAGTACCAAAGAT 3’
3’GAATAATCAAATGATATTTCCTCAGCTTTCTCTTCATGGTTTCTA 5’
.
CTCTTCATGGTTTCTA
.
Forward primer = 5’CTTATTAGTTTACTAT 3’
Reverse primer = 5’ATCTTTGGTACTTCTC 3’
5’CTTATTAGTTTACTATAAAGGAGTCGAAAGAGAAGTACCAAAGAT 3’
3’CTCTTCATGGTTTCTA 5’
5’CTTATTAGTTTACTAT 3’
3’GAATAATCAAATGATATTTCCTCAGCTTTCTCTTCATGGTTTCTA 5’
30. Correct primers amplification
One wrong primer no amplification
Two wrong primers no amplification
31. Things to avoid
Internal structures
cattgccgacggcttaatcgta
a
g=c
c=g
c=g
cattg=cttaatcgta
a ‘loop out’
Complementary 3’ ends
5’ cgtacgtactggttacctacgc 3’
‘primer dimer’
| | | | | | |
3’ ggatgcgaattagactgacgc 5’
32. Polymerase
Taq polymerase from Thermus aquaticus
thermophilic - works at 72C
Others – Vent, Deepvent, TaKaRa, etc.
34. Taq – no proof-reading activity – doesn’t correct error
Also add an extra base – A – at the ends
A
A
Error rate can be as high as one mistake in 1000
New generation of ‘proof reading enzymes’ –
e.g. Pfu, Pfx, Pwo
has 3’exonuclease and proofreading activity
Extra A at the end – can be used in T/A cloning systems
35. Applications of PCR
Medical
Forensics (CSI)
Detection of infectious agents
Viral infections
Bioweapons
Difficult-to-culture organism or slow growing
36. Forensic Evidence and Genetic
Profiles
An individual’s unique DNA sequence, or genetic
profile, can be obtained by analysis of tissue or body
fluids
Genetic profiles can be used to provide evidence in
criminal and paternity cases and to identify human
remains
Genetic profiles can be analyzed using RFLP analysis
by Southern blotting
37. Even more sensitive is the use of genetic
markers called short tandem repeats (STRs),
which are variations in the number of repeats
of specific DNA sequences
PCR and gel electrophoresis are used to
amplify and then identify STRs of different
lengths
The probability that two people who are not
identical twins have the same STR markers is
exceptionally small
38. Fig. 20-24
(a) This photo shows Earl
Washington just before
his release in 2001,
after 17 years in prison.
Source of
sample
STR
marker 1
STR
marker 2
STR
marker 3
Semen on victim
17, 19
13, 16
12, 12
Earl Washington
16, 18
14, 15
11, 12
Kenneth Tinsley
17, 19
13, 16
12, 12
(b) These and other STR data exonerated Washington and
led Tinsley to plead guilty to the murder.
40. Reverse Transcriptase PCR for the detection of RNA viruses
(almost all of the most nasty viruses have RNA genomes –Ebola,
dengue, nipah, SARS – you name it)
- before PCR – reverse transcribed viral RNA to cDNA first
Brock Biology of the Microorganism
43. VNTRs - variable number of tandem repeats – a.k.a minisatellites
– natural polymorphisms in the human genome
Different numbers of a short, repeated sequence
Each repeat 15 – 100 bp long;
Repeated in tandem arrays up to 40 kb long
SSTR – simple sequence tandem repeats – a.k.a microsatellites
Repeats of 2 to 4 nucleotides
e.g.
CAGCAGCAGCAGCAGCAGCAG
daddy
CAGCAGCAGCAG
mommy
daddy
mommy
VNTRs are hypervariable – can be very different between individuals
44. Many different types of VNTRs
-can be found at many loci in the genome
-two individual may have similar VNTRs at one loci
-But the chances of two individuals having the same pattern of VNTRs
at several loci is very small
45. The DNA sequences next to VNTRs are usually highly conserved
(very similar in every individual)
So we can design PCR primer to target these flanking sequences
Using these primers, we can amplify the VNTR regions
The VNTR amplification products will have different sizes, and can
be separated on an agarose or polyacrylamide gel
46. By using PCR to amplify all three regions, a unique
fingerprint can be generated for each individual
53. Real time PCR – the next evolution
Monitoring of amplification reaction in real time
Quantitative
Rapid - results-as-you –wait
Close system – minimal cross contamination
Much more expensive…………..
54. Detection of GMO’s
Most genetically modified plants contain the 35S promoter of
cauliflower mosaic virus (CaMV)
and the 3’ untranslated region (terminator) ofthe nopaline
synthase (NOS) gene of Agrobacterium tumefaciens.
Can be detected using specific primers
55. Detection using SYBRO Green or fluorescence molecular beacons
SYBRO Green fluoresces when bind to double stranded DNA only