This document discusses DNA fingerprinting and its uses in forensics and parental testing. It begins by providing a brief history of DNA fingerprinting and then describes the various hypervariable DNA sequences that are examined, including RFLPs, VNTRs, STRs, SNPs, mitochondrial DNA and Y chromosomal DNA. It discusses the methods used, including Southern blots and PCR, as well as statistical and technical considerations. It also mentions DNA databases and issues of privacy. Examples are provided to illustrate DNA fingerprinting techniques and how probabilities of a DNA match are determined.
Applications of biotechnology in forensic sciencesZahra Naz
Biotechnology tools have revolutionized forensic sciences by enabling analysis of biological evidence. Restriction fragment length polymorphism was an early technique using Southern blotting for DNA fingerprinting. Polymerase chain reaction is now preferred as it amplifies DNA, is sensitive, and requires less work. Other techniques profile mitochondrial DNA, Y-chromosomes, microsatellites, and Alu repeats to identify suspects, examine lineages, and study populations. Applications include sample analysis, lineage tracing, suspect identification, anthropology, and population genetics. Biotechnology continues advancing forensic sciences capabilities.
Recombinant DNA Technology, Forensic DNA Analysis and Human Genome ProjectNateneal Tamerat
Recombinant DNA technology involves joining DNA fragments from different organisms to produce new genetic combinations. It was developed in the 1970s using restriction enzymes, which cut DNA at specific sites. DNA is isolated, cut, and inserted into vectors like plasmids or bacteria, then inserted into host cells. Applications include forensic analysis by matching crime scene DNA to databases, agriculture, diagnosing genetic diseases, and the Human Genome Project, which sequenced the entire human genome in 2001 and revealed insights about human genetics and evolution.
Recombinant dna technology applicationsRamesh Gupta
Recombinant DNA technology has many applications in medicine including mapping genomes, producing proteins, diagnosing genetic diseases, and gene therapy. The human genome project mapped the entire human genome, finding it contains around 30,000 genes made up of 3.2 billion DNA base pairs. Recombinant DNA techniques allow mass production of human proteins like insulin to treat diseases. Genetic diseases can be diagnosed by analyzing changes in restriction fragment length patterns. DNA fingerprinting using variable tandem repeats is used in forensics and has helped solve criminal and parental identification cases. Gene therapy aims to treat genetic disorders by inserting normal genes to replace defective ones.
The document discusses biotechnology and its traditional and modern applications. It summarizes that biotechnology has traditionally involved techniques like using yeast to make beer/wine and selective breeding of plants and animals. Modern biotechnology focuses on genetic engineering using recombinant DNA technology to modify genes and achieve goals like understanding disease and improving agriculture. It also discusses techniques like polymerase chain reaction (PCR) and gel electrophoresis that are used in biotechnology and forensics.
Genetic engineering involves directly manipulating genes, often by adding a gene from another species to an organism's genome. This is done through recombinant DNA (rDNA) technology, which combines DNA sequences artificially. A key part of the process is using restriction enzymes to cut DNA at specific sites, then inserting the cut DNA fragment into a vector like a plasmid for replication in a host cell. The engineered DNA is then introduced into host cells, and cells containing the new DNA are identified and isolated through markers on the vector.
This document discusses host cells and vectors used in gene cloning. It describes various prokaryotic and eukaryotic host cells, including E. coli, yeast, and mammalian cells. It also discusses the key features and types of vectors, including plasmids, bacteriophages, cosmids, and phagemids. Plasmids are the most commonly used prokaryotic vectors and come in various types including low-copy and high-copy plasmids. Common plasmid vectors discussed include pBR322, pUC18, and commercially available vectors. Bacteriophages like lambda phage and M13 phage are also described as viral vectors.
DNA fingerprinting involves isolating DNA from a sample, cutting it into fragments using restriction enzymes, separating the fragments by size through gel electrophoresis, and comparing the unique band patterns to identify individuals. It has various forensic and medical uses such as identifying crime suspects by comparing DNA profiles, determining paternity in legal cases, and diagnosing inherited disorders. The chances of any two individuals having the exact same DNA profile are extremely low, making DNA fingerprinting a powerful tool for individual identification.
Applications of biotechnology in forensic sciencesZahra Naz
Biotechnology tools have revolutionized forensic sciences by enabling analysis of biological evidence. Restriction fragment length polymorphism was an early technique using Southern blotting for DNA fingerprinting. Polymerase chain reaction is now preferred as it amplifies DNA, is sensitive, and requires less work. Other techniques profile mitochondrial DNA, Y-chromosomes, microsatellites, and Alu repeats to identify suspects, examine lineages, and study populations. Applications include sample analysis, lineage tracing, suspect identification, anthropology, and population genetics. Biotechnology continues advancing forensic sciences capabilities.
Recombinant DNA Technology, Forensic DNA Analysis and Human Genome ProjectNateneal Tamerat
Recombinant DNA technology involves joining DNA fragments from different organisms to produce new genetic combinations. It was developed in the 1970s using restriction enzymes, which cut DNA at specific sites. DNA is isolated, cut, and inserted into vectors like plasmids or bacteria, then inserted into host cells. Applications include forensic analysis by matching crime scene DNA to databases, agriculture, diagnosing genetic diseases, and the Human Genome Project, which sequenced the entire human genome in 2001 and revealed insights about human genetics and evolution.
Recombinant dna technology applicationsRamesh Gupta
Recombinant DNA technology has many applications in medicine including mapping genomes, producing proteins, diagnosing genetic diseases, and gene therapy. The human genome project mapped the entire human genome, finding it contains around 30,000 genes made up of 3.2 billion DNA base pairs. Recombinant DNA techniques allow mass production of human proteins like insulin to treat diseases. Genetic diseases can be diagnosed by analyzing changes in restriction fragment length patterns. DNA fingerprinting using variable tandem repeats is used in forensics and has helped solve criminal and parental identification cases. Gene therapy aims to treat genetic disorders by inserting normal genes to replace defective ones.
The document discusses biotechnology and its traditional and modern applications. It summarizes that biotechnology has traditionally involved techniques like using yeast to make beer/wine and selective breeding of plants and animals. Modern biotechnology focuses on genetic engineering using recombinant DNA technology to modify genes and achieve goals like understanding disease and improving agriculture. It also discusses techniques like polymerase chain reaction (PCR) and gel electrophoresis that are used in biotechnology and forensics.
Genetic engineering involves directly manipulating genes, often by adding a gene from another species to an organism's genome. This is done through recombinant DNA (rDNA) technology, which combines DNA sequences artificially. A key part of the process is using restriction enzymes to cut DNA at specific sites, then inserting the cut DNA fragment into a vector like a plasmid for replication in a host cell. The engineered DNA is then introduced into host cells, and cells containing the new DNA are identified and isolated through markers on the vector.
This document discusses host cells and vectors used in gene cloning. It describes various prokaryotic and eukaryotic host cells, including E. coli, yeast, and mammalian cells. It also discusses the key features and types of vectors, including plasmids, bacteriophages, cosmids, and phagemids. Plasmids are the most commonly used prokaryotic vectors and come in various types including low-copy and high-copy plasmids. Common plasmid vectors discussed include pBR322, pUC18, and commercially available vectors. Bacteriophages like lambda phage and M13 phage are also described as viral vectors.
DNA fingerprinting involves isolating DNA from a sample, cutting it into fragments using restriction enzymes, separating the fragments by size through gel electrophoresis, and comparing the unique band patterns to identify individuals. It has various forensic and medical uses such as identifying crime suspects by comparing DNA profiles, determining paternity in legal cases, and diagnosing inherited disorders. The chances of any two individuals having the exact same DNA profile are extremely low, making DNA fingerprinting a powerful tool for individual identification.
This document summarizes key concepts from Chapter 20 of an AP Biology textbook. It discusses several topics:
1) Genomics is the study of genomes and how they are organized and regulated. Genome sequences provide insights into fundamental biological questions.
2) Computer analysis can identify protein-coding genes in DNA sequences by looking for start/stop signals and other features. With 25,000 genes in humans, this analysis is a huge undertaking without technology.
3) Genome sizes vary greatly between organisms, but size does not always correlate with complexity. Some plants have genomes much larger than humans despite fewer genes.
The Human Genome Project aimed to sequence the entire human genome and map all human genes. It used techniques like restriction fragment length polymorphisms, automated DNA sequencing, and polymerase chain reaction to isolate DNA, cut it into fragments using restriction enzymes, separate the fragments via gel electrophoresis, transfer them to membranes, and allow probes to hybridize and identify specific sequences through complementary base pairing. The goal was to discover the approximately 35,000 human genes and make their sequences available for further study.
This document provides an overview of DNA fingerprinting (also called DNA profiling). It discusses the stages of DNA fingerprinting including extraction, cutting, separation, transfer and analysis. The principle of DNA fingerprinting is that restriction enzymes cut DNA at unique sites, creating variable fragment patterns between individuals. Applications include determining paternity, criminal identification using DNA from crime scenes, and personal identification. Advantages are that DNA profiling can identify individuals with certainty, while limitations include samples being easily contaminated and complex patterns. The document also discusses uses in forensics, plants, centers that perform DNA fingerprinting, and concludes with an overview.
Genomics is the study of whole genomes. In the 1980s, scientists determined sequences of important genes. In the 1990s, the genome of H. influenzae was fully sequenced. The Human Genome Project, begun in 1990, fully sequenced the human genome ahead of schedule in 2003. The human genome contains 3.2 billion DNA base pairs and 30,000-40,000 genes. While genomics provides medical benefits, it also raises safety, ethical, and privacy concerns that remain open questions.
Dr. ladli kishore (microbial genetics and variation) (1)Drladlikishore2015
This document discusses the history and key concepts of microbial genetics and variation, including:
1. It outlines the history of genetics from Mendel's experiments in 1865 to the discovery of gene sequencing in the 1970s.
2. It defines genes, chromosomes, DNA, and how genetic information is stored and expressed through proteins.
3. It explains genetic processes like transcription, translation, mutation, and gene regulation, and how genetic material can be transferred between bacteria.
This document provides an overview of DNA analysis techniques used in biotechnology laboratories. It discusses how DNA can be extracted from cells and amplified through polymerase chain reaction. DNA sequencing and typing methods such as short tandem repeats are used to analyze DNA samples on gel electrophoresis. These foundational techniques allow scientists to identify individuals, solve crimes, and make many discoveries through DNA research.
Recombinant DNA technology involves combining DNA sequences from different species that would not normally occur together to create artificial DNA and alter the genetics of living cells. There are three main methods to create recombinant DNA - transformation, phage introduction, and non-bacterial transformation. Transformation involves selecting a DNA fragment, inserting it into a vector, and introducing the vector into a host cell like E. coli. Recombinant DNA technology has many applications, including producing proteins and hormones, disease diagnosis and treatment, genetically engineering plants, and forensic analysis.
The document discusses repetitive DNA elements in human chromosomes, focusing on tandem repeats classified as satellites, minisatellites, and microsatellites. It describes the characteristics of each type of repeat, including length, copy number, location, and uses. Variable number tandem repeats (VNTRs) are highlighted as being highly polymorphic due to variation in repeat number between individuals, making them useful for genetic analysis and forensic identification.
This document provides an overview of genomics, including its history, major research areas, and applications. Genomics is concerned with studying the genomes of organisms, including determining entire DNA sequences and genetic mapping. Major research areas discussed include bacteriophage, human, computational, and comparative genomics. Applications of genomics discussed include functional genomics, predictive medicine, metagenomics for medicine, biofuels and more. The first genomes sequenced were small viruses and mitochondria, while the human genome project aimed to map the entire human DNA sequence.
This document discusses recombinant DNA technology and its applications. It begins with an introduction to recombinant DNA technology and its history. It then describes the tools and enzymes used, including restriction enzymes, DNA ligase, reverse transcriptase, and DNA polymerase. Various vectors like bacterial plasmids and bacteriophages are also discussed. The document outlines several applications such as monoclonal antibody production, disease diagnosis, DNA fingerprinting, environmental uses, gene therapy, and xenotransplantation. In summary, the document provides an overview of the key concepts, techniques, and uses of recombinant DNA technology.
The document discusses the human genome project, which aimed to sequence the entire human genome and identify all human genes. It provides background on the human genome, describing its size, number of genes, and chromosomes. It details the goals and milestones of the human genome project from 1986 to 2003. Vectors like yeast artificial chromosomes and bacterial artificial chromosomes were used to clone large fragments of DNA for sequencing.
Recombinant DNA technology allows for the isolation, alteration, and reinsertion of genes. It involves isolating DNA segments, cutting them using restriction enzymes, joining DNA segments together, and amplifying the resulting recombinant DNA. Vectors like plasmids, lambda phages, and artificial chromosomes are used to carry foreign DNA into host cells. Techniques like PCR, gel electrophoresis, cloning libraries, and nucleic acid hybridization are used in rDNA technology. Applications include producing medicines like insulin, developing pest-resistant crops, and gene therapy to treat genetic diseases.
The document provides a history of genomics, beginning with Mendel's work in 1866 establishing the gene concept and laws of genetics. Key developments include the discovery of DNA in 1871, the chromosomal theory of inheritance in 1902, and the discovery of linkage in 1910. The structure of DNA was elucidated in the 1950s, leading to the development of recombinant DNA technology in the 1970s and DNA sequencing techniques in the 1970s-80s. The first whole genome of an organism was sequenced in 1995. More recent developments include next generation sequencing starting in 2005 and the advent of CRISPR/Cas9 genome editing in 2012. The document concludes with discussing the potential use of CRISPR to target genes in the diamondb
Assignment on Recombinant DNA Technology and Gene TherapyDeepak Kumar
Assignment on Recombinant DNA Technology and Gene Therapy Basic principles of recombinant DNA technology-Restriction enzymes, various types of vectors, Applications of recombinant DNA technology. Gene therapy- Various types of gene transfer techniques, clinical applications and recent advances in gene therapy
Feature story from the Garvan Institute of Medical Research's April 2013 issue of Breakthrough newsletter. More at https://www.garvan.org.au/news-events/newsletters
This document outlines the structure and content of a three-part lecture series on the human genome taking place from October 12-16, 2014. Part I will provide an introduction and overview of genome sequencing technologies. Part II will discuss the human genome project and sequencing methods. Part III will cover genome assembly, annotation, outcomes including the number of genes and functional categories, and applications such as SNP analysis and genome-wide association studies. The overall goals are to understand principles of genome analysis and the impacts of the human genome project.
This document describes a comparative analysis of the human gut microbiota of Koreans using barcoded pyrosequencing. It finds that the Korean gut microbiome has high diversity at the species and strain levels, with over 800 species-level phylotypes identified on average per individual. The analysis identifies 14 core genera that are consistently present across Korean guts, including Bacteroides, Prevotella, Clostridium, and Ruminococcus. The phylum-level diversity of the Korean gut microbiome is similar to other human populations.
The language of life (all the subtitles)first ppt 2 bimesterSofia Paz
1. Genes are segments of DNA that provide instructions for making proteins. DNA is packaged into chromosomes, and the complete set of human genes is called the genome.
2. Transcription is the process where DNA is copied into messenger RNA (mRNA), which carries the gene instructions out of the nucleus. The mRNA is then spliced to remove introns.
3. Translation occurs when the mRNA attaches to ribosomes and transfer RNA (tRNA) to produce a chain of amino acids or protein based on the mRNA codons, from start to stop codons. Each codon codes for a specific amino acid.
Genetic engineering principle, tools, techniques, types and applicationTarun Kapoor
Basic principles of genetic engineering.
Study of cloning vectors, restriction endonucleases and DNA ligase.
Recombinant DNA technology. Application of genetic engineering in medicine.
Application of r DNA technology and genetic engineering in the products:
a. Interferon
b. Vaccines- hepatitis- B
c. Hormones- Insulin.
Polymerase chain reaction
Brief introduction to PCR
Basic principles of PCR
Recombinant DNA technology allows DNA from different species to be isolated, cut with restriction enzymes, and spliced together to form new recombinant molecules. This involves extracting DNA, cutting it with restriction enzymes to form manageable fragments, inserting fragments into vectors like plasmids, introducing the recombinant vectors into host cells, and amplifying the DNA. Vectors often contain antibiotic resistance genes to select for host cells containing the recombinant DNA. This process allows scientists to isolate and multiply specific genes for study and modification.
DNA fingerprinting is a technique that analyzes variations in DNA sequences at specific locations in the genome to identify individuals. There are two main methods: RFLP (restriction fragment length polymorphism) and PCR (polymerase chain reaction). RFLP involves digesting DNA with restriction enzymes, separating fragments by size, and detecting with probes. PCR amplifies specific DNA regions defined by primer sequences. Short tandem repeats (STRs) are now commonly analyzed by PCR. DNA fingerprinting is used in criminal investigations to identify suspects or victims, and in resolving medical issues like paternity disputes. DNA databases help law enforcement match crime scene evidence to suspects.
This document summarizes key concepts from Chapter 20 of an AP Biology textbook. It discusses several topics:
1) Genomics is the study of genomes and how they are organized and regulated. Genome sequences provide insights into fundamental biological questions.
2) Computer analysis can identify protein-coding genes in DNA sequences by looking for start/stop signals and other features. With 25,000 genes in humans, this analysis is a huge undertaking without technology.
3) Genome sizes vary greatly between organisms, but size does not always correlate with complexity. Some plants have genomes much larger than humans despite fewer genes.
The Human Genome Project aimed to sequence the entire human genome and map all human genes. It used techniques like restriction fragment length polymorphisms, automated DNA sequencing, and polymerase chain reaction to isolate DNA, cut it into fragments using restriction enzymes, separate the fragments via gel electrophoresis, transfer them to membranes, and allow probes to hybridize and identify specific sequences through complementary base pairing. The goal was to discover the approximately 35,000 human genes and make their sequences available for further study.
This document provides an overview of DNA fingerprinting (also called DNA profiling). It discusses the stages of DNA fingerprinting including extraction, cutting, separation, transfer and analysis. The principle of DNA fingerprinting is that restriction enzymes cut DNA at unique sites, creating variable fragment patterns between individuals. Applications include determining paternity, criminal identification using DNA from crime scenes, and personal identification. Advantages are that DNA profiling can identify individuals with certainty, while limitations include samples being easily contaminated and complex patterns. The document also discusses uses in forensics, plants, centers that perform DNA fingerprinting, and concludes with an overview.
Genomics is the study of whole genomes. In the 1980s, scientists determined sequences of important genes. In the 1990s, the genome of H. influenzae was fully sequenced. The Human Genome Project, begun in 1990, fully sequenced the human genome ahead of schedule in 2003. The human genome contains 3.2 billion DNA base pairs and 30,000-40,000 genes. While genomics provides medical benefits, it also raises safety, ethical, and privacy concerns that remain open questions.
Dr. ladli kishore (microbial genetics and variation) (1)Drladlikishore2015
This document discusses the history and key concepts of microbial genetics and variation, including:
1. It outlines the history of genetics from Mendel's experiments in 1865 to the discovery of gene sequencing in the 1970s.
2. It defines genes, chromosomes, DNA, and how genetic information is stored and expressed through proteins.
3. It explains genetic processes like transcription, translation, mutation, and gene regulation, and how genetic material can be transferred between bacteria.
This document provides an overview of DNA analysis techniques used in biotechnology laboratories. It discusses how DNA can be extracted from cells and amplified through polymerase chain reaction. DNA sequencing and typing methods such as short tandem repeats are used to analyze DNA samples on gel electrophoresis. These foundational techniques allow scientists to identify individuals, solve crimes, and make many discoveries through DNA research.
Recombinant DNA technology involves combining DNA sequences from different species that would not normally occur together to create artificial DNA and alter the genetics of living cells. There are three main methods to create recombinant DNA - transformation, phage introduction, and non-bacterial transformation. Transformation involves selecting a DNA fragment, inserting it into a vector, and introducing the vector into a host cell like E. coli. Recombinant DNA technology has many applications, including producing proteins and hormones, disease diagnosis and treatment, genetically engineering plants, and forensic analysis.
The document discusses repetitive DNA elements in human chromosomes, focusing on tandem repeats classified as satellites, minisatellites, and microsatellites. It describes the characteristics of each type of repeat, including length, copy number, location, and uses. Variable number tandem repeats (VNTRs) are highlighted as being highly polymorphic due to variation in repeat number between individuals, making them useful for genetic analysis and forensic identification.
This document provides an overview of genomics, including its history, major research areas, and applications. Genomics is concerned with studying the genomes of organisms, including determining entire DNA sequences and genetic mapping. Major research areas discussed include bacteriophage, human, computational, and comparative genomics. Applications of genomics discussed include functional genomics, predictive medicine, metagenomics for medicine, biofuels and more. The first genomes sequenced were small viruses and mitochondria, while the human genome project aimed to map the entire human DNA sequence.
This document discusses recombinant DNA technology and its applications. It begins with an introduction to recombinant DNA technology and its history. It then describes the tools and enzymes used, including restriction enzymes, DNA ligase, reverse transcriptase, and DNA polymerase. Various vectors like bacterial plasmids and bacteriophages are also discussed. The document outlines several applications such as monoclonal antibody production, disease diagnosis, DNA fingerprinting, environmental uses, gene therapy, and xenotransplantation. In summary, the document provides an overview of the key concepts, techniques, and uses of recombinant DNA technology.
The document discusses the human genome project, which aimed to sequence the entire human genome and identify all human genes. It provides background on the human genome, describing its size, number of genes, and chromosomes. It details the goals and milestones of the human genome project from 1986 to 2003. Vectors like yeast artificial chromosomes and bacterial artificial chromosomes were used to clone large fragments of DNA for sequencing.
Recombinant DNA technology allows for the isolation, alteration, and reinsertion of genes. It involves isolating DNA segments, cutting them using restriction enzymes, joining DNA segments together, and amplifying the resulting recombinant DNA. Vectors like plasmids, lambda phages, and artificial chromosomes are used to carry foreign DNA into host cells. Techniques like PCR, gel electrophoresis, cloning libraries, and nucleic acid hybridization are used in rDNA technology. Applications include producing medicines like insulin, developing pest-resistant crops, and gene therapy to treat genetic diseases.
The document provides a history of genomics, beginning with Mendel's work in 1866 establishing the gene concept and laws of genetics. Key developments include the discovery of DNA in 1871, the chromosomal theory of inheritance in 1902, and the discovery of linkage in 1910. The structure of DNA was elucidated in the 1950s, leading to the development of recombinant DNA technology in the 1970s and DNA sequencing techniques in the 1970s-80s. The first whole genome of an organism was sequenced in 1995. More recent developments include next generation sequencing starting in 2005 and the advent of CRISPR/Cas9 genome editing in 2012. The document concludes with discussing the potential use of CRISPR to target genes in the diamondb
Assignment on Recombinant DNA Technology and Gene TherapyDeepak Kumar
Assignment on Recombinant DNA Technology and Gene Therapy Basic principles of recombinant DNA technology-Restriction enzymes, various types of vectors, Applications of recombinant DNA technology. Gene therapy- Various types of gene transfer techniques, clinical applications and recent advances in gene therapy
Feature story from the Garvan Institute of Medical Research's April 2013 issue of Breakthrough newsletter. More at https://www.garvan.org.au/news-events/newsletters
This document outlines the structure and content of a three-part lecture series on the human genome taking place from October 12-16, 2014. Part I will provide an introduction and overview of genome sequencing technologies. Part II will discuss the human genome project and sequencing methods. Part III will cover genome assembly, annotation, outcomes including the number of genes and functional categories, and applications such as SNP analysis and genome-wide association studies. The overall goals are to understand principles of genome analysis and the impacts of the human genome project.
This document describes a comparative analysis of the human gut microbiota of Koreans using barcoded pyrosequencing. It finds that the Korean gut microbiome has high diversity at the species and strain levels, with over 800 species-level phylotypes identified on average per individual. The analysis identifies 14 core genera that are consistently present across Korean guts, including Bacteroides, Prevotella, Clostridium, and Ruminococcus. The phylum-level diversity of the Korean gut microbiome is similar to other human populations.
The language of life (all the subtitles)first ppt 2 bimesterSofia Paz
1. Genes are segments of DNA that provide instructions for making proteins. DNA is packaged into chromosomes, and the complete set of human genes is called the genome.
2. Transcription is the process where DNA is copied into messenger RNA (mRNA), which carries the gene instructions out of the nucleus. The mRNA is then spliced to remove introns.
3. Translation occurs when the mRNA attaches to ribosomes and transfer RNA (tRNA) to produce a chain of amino acids or protein based on the mRNA codons, from start to stop codons. Each codon codes for a specific amino acid.
Genetic engineering principle, tools, techniques, types and applicationTarun Kapoor
Basic principles of genetic engineering.
Study of cloning vectors, restriction endonucleases and DNA ligase.
Recombinant DNA technology. Application of genetic engineering in medicine.
Application of r DNA technology and genetic engineering in the products:
a. Interferon
b. Vaccines- hepatitis- B
c. Hormones- Insulin.
Polymerase chain reaction
Brief introduction to PCR
Basic principles of PCR
Recombinant DNA technology allows DNA from different species to be isolated, cut with restriction enzymes, and spliced together to form new recombinant molecules. This involves extracting DNA, cutting it with restriction enzymes to form manageable fragments, inserting fragments into vectors like plasmids, introducing the recombinant vectors into host cells, and amplifying the DNA. Vectors often contain antibiotic resistance genes to select for host cells containing the recombinant DNA. This process allows scientists to isolate and multiply specific genes for study and modification.
DNA fingerprinting is a technique that analyzes variations in DNA sequences at specific locations in the genome to identify individuals. There are two main methods: RFLP (restriction fragment length polymorphism) and PCR (polymerase chain reaction). RFLP involves digesting DNA with restriction enzymes, separating fragments by size, and detecting with probes. PCR amplifies specific DNA regions defined by primer sequences. Short tandem repeats (STRs) are now commonly analyzed by PCR. DNA fingerprinting is used in criminal investigations to identify suspects or victims, and in resolving medical issues like paternity disputes. DNA databases help law enforcement match crime scene evidence to suspects.
The document discusses applications of DNA technology including the Human Genome Project. The Human Genome Project was a 13-year international project completed in 2003 that mapped and sequenced the entire human genome. Its goals were to identify all human genes, determine the sequence of DNA's 3 billion base pairs, store this information in databases, improve analysis tools, and address ethical issues arising from the research. The project used genetic mapping, physical mapping, and DNA sequencing approaches.
DNA is contained within the nucleus of cells. It is composed of nucleotides, which each contain a phosphate group, a sugar (deoxyribose), and one of four nitrogenous bases (adenine, guanine, cytosine, thymine). The bases bond together in pairs - adenine bonds with thymine, and cytosine bonds with guanine. Millions of these paired nucleotides bond together to form the signature double helix structure of DNA, with the bases on the inside and the sugar-phosphate backbones on the outside. This double helix structure allows DNA to be tightly packed inside cells.
The document discusses the Human Genome Project, which aimed to sequence and map all of the genes in the human genome. It explains that the project sought to determine the exact sequence of DNA bases (A, C, G, T) in order to understand how genes are passed down and how DNA works. The project also aimed to identify genes associated with genetic disorders and diseases. The summary provides key details about the timeline and contributors to the project, including Craig Venter and his company Celera, which helped accelerate the sequencing process.
Role of biomarkers and dna fingerprinting in herbal drug standardisationRoshni Ann
1. DNA contains the genetic instructions that determine an organism's characteristics. DNA is organized into genes located on chromosomes within cells.
2. The document discusses several techniques used for DNA fingerprinting, including microsatellites, restriction fragment length polymorphisms, amplified fragment length polymorphism, and random amplified polymorphic DNA.
3. DNA fingerprinting can be used to identify plant species and strains, helping to standardize herbal drugs and ensure quality. It has applications in forensics, ancestry tracing, and tracing the evolution of plants and microorganisms.
1) Gene cloning involves inserting foreign DNA into plasmids which are then inserted into bacterial cells. The bacterial cells rapidly multiply, producing multiple copies of the gene of interest.
2) Restriction enzymes and DNA ligase are used to cut and join DNA fragments to create recombinant DNA. Probes are used to screen libraries and identify clones containing genes of interest.
3) Cloned genes can be expressed in bacterial or eukaryotic cells to produce large quantities of the gene's protein product. This allows researchers to study protein function.
Bacteria are useful hosts for genetic engineering and recombinant DNA technology because they are easy and cheap to grow, grow quickly, and can be easily manipulated in the laboratory. Their natural plasmids and viruses can act as vectors to insert recombinant DNA. Plasmids are small, circular pieces of DNA that are not essential for bacterial survival but can contain genes that confer traits like antibiotic resistance and mechanisms for genetic transfer between bacteria. Molecular biologists have engineered plasmids with restriction sites to allow insertion of foreign DNA fragments and propagation of those genes within bacteria.
This document discusses ethical issues relating to transgenic animals. It begins by defining transgenesis as the addition of DNA from one organism to another, resulting in creatures that blur species lines. It then discusses various methods for producing transgenic animals, both natural and artificial. It explores applications of transgenic animals like protein production but also problems with low efficiency and health issues in the animals. The document raises ethical concerns about modifying animal genetics without knowing effects, treating animals as commodities, and creating diseased animals. It examines both religious views for and against genetic engineering of animals. Finally, it outlines principles from the 1995 Banner Report regarding the justification and minimization of animal harm in research.
A bacterial plasmid is a short, usually circular, and double-stranded segment of DNA that is found in the cytoplasm separate from the main bacterial chromosome. This presentation contains plasmid features, replication, classification and its uses.
The analysis of all transcripts within a cell is of essential importance. Molecular biology provides many approaches to clone RNA transcripts into cDNA. Large cDNA collections are in the public domain to serve the research community. Today, however, new high-speed sequencing methods allow a much deeper view into transcriptomes than possible by classical cloning.
Identification of polymorphism by dna fingerprinting using rapd 2sachin subba
This document describes a study that aimed to identify polymorphism in different chilli varieties using DNA fingerprinting with RAPD. Seven chilli varieties were collected and genomic DNA was isolated from them using a CTAB method. Quality PCR was performed and DNA was amplified using RAPD. The PCR products were separated using urea polyacrylamide gel electrophoresis and visualized using silver staining. The study examined techniques for detecting genetic variation in chilli varieties at the DNA level.
This document provides an overview of recombinant DNA technology. It begins by describing the central dogma of molecular biology - DNA is transcribed into RNA which is translated into protein. It then discusses various applications of recombinant DNA technology, including gene isolation, sequencing, PCR, gene therapy, and genetically modified crops. The document goes on to describe common techniques used in recombinant DNA, including restriction enzymes, vectors, transformation of host cells, and plasmid cloning. It provides examples of commonly used plasmid and phage vectors.
Antiviral Drugs, Vaccines and Gene TherapyBiakhan72
Vaccines work by exposing the immune system to a harmless form of a pathogen to stimulate antibody production against that pathogen. Some key events in vaccine development include Jenner discovering vaccination using cowpox to immunize against smallpox in 1796 and the eradication of smallpox in 1980. Vaccines produce either humoral immunity involving B cell and antibody responses or cell-mediated immunity involving T cell responses.
The document discusses DNA cloning techniques. It describes how DNA cloning allows for the mass amplification and stable propagation of specific DNA sequences. The key steps involve using restriction enzymes to cut DNA fragments and plasmids, ligating the DNA fragment into the plasmid, transforming host cells with the recombinant plasmid, and selecting for transformed cells. Plasmids are commonly used as cloning vectors due to their small size, circular structure, and ability to replicate independently of the host cell genome.
The document describes the process of 454-pyrosequencing for next generation sequencing. It involves the following main steps: 1) obtaining a sample and fragmenting its DNA library, 2) preparing the library with adapters and denaturing, 3) annealing fragments to beads in an emulsion to clonally amplify each fragment, 4) breaking the emulsion and loading beads onto a picotiter plate for sequencing, 5) performing pyrosequencing chemistry using enzymes and cameras to detect light signals from nucleotide washes to determine sequences. The data is then processed and analyzed for assembly, mapping, and variant detection.
Different methods of gene sequencing durgesh sirohiD. Sirohi
The document discusses various methods of gene sequencing. It begins with classical methods like Maxam-Gilbert chemical degradation and Sanger dideoxy chain termination. It then covers advanced methods such as shotgun sequencing and bridge PCR. The document also describes several new generation sequencing techniques, including sequencing by synthesis, pyrosequencing, nanopore sequencing, ion torrent sequencing, and Illumina sequencing. It provides details on the principles and procedures of many of these sequencing methods.
Genetic engineering,recombinant DNA technology..ganeshbond
1) In 1996, scientists in Edinburgh announced the creation of Dolly the sheep, the first mammal cloned from an adult cell.
2) Dolly's birth sparked debate around the controversial technique of cloning and its potential application to humans.
3) In 2001, scientists in Texas cloned the world's first kitten, named Cc, using a cell from an adult tortoiseshell cat. The kitten was unveiled in 2002.
B.Tech Biotechnology II Elements of Biotechnology Unit 4 DNA FingerprintingRai University
DNA fingerprinting is a technique used to identify individuals by analyzing their DNA sequences. It focuses on analyzing 0.1-1.0% of human DNA that is unique between individuals, which resides in hypervariable sequences like VNTRs, STRs, and SNPs. DNA fingerprinting was first described in 1985 and can be used for various applications like identifying criminals, determining paternity, and identifying human remains. It involves obtaining a DNA sample, amplifying certain regions of DNA via PCR or Southern blotting, and comparing the results to DNA databases to determine if a match exists.
DNA recombinant technology on insulin modificationaulia624292
This document provides information on various biotechnology tools and techniques, including:
- Restriction enzymes, gel electrophoresis, PCR, vectors, gene libraries, and DNA sequencing which were used in the Human Genome Project to map the human genome.
- Genetic engineering techniques like DNA cloning, transformation, and applications like disease diagnosis, gene therapy, and GMOs.
- Stem cell types and their potential medical uses.
- Genome sizes of various organisms and comparisons.
- Advantages and disadvantages of genetic modification in plants, animals, and medicine.
Microarrays allow researchers to study gene expression across thousands of genes at once. They work by immobilizing DNA probes on a solid surface, then exposing the surface to fluorescently labeled cDNA or cRNA from samples. The microarray is then scanned to see which probes fluoresce, indicating gene expression. Microarrays have many applications including disease diagnosis, drug discovery, and toxicology. While powerful, they also have limitations like expense and complexity of data analysis. Standards are being developed to allow use of microarray data in regulatory decision making.
Molecular techniques for pathology research - MDX .pdfsabyabby
This document discusses molecular techniques used in pathology research such as PCR, microarrays, next generation sequencing, immunohistochemistry, ELISA, and Western blotting. It provides details on each technique including the basic principles, applications in research, and examples of uses in studies of gene expression, cancer, bone disease, and growth retardation. The learning outcomes are to understand these techniques and their uses in basic and clinical research.
DNA fingerprint methods. • The locations for genes for specific traits such as egg number, body weight or carcass quality can be identified using markers and then they can be selected directly.
diagnosis of cancer, bioluminescent detection, diagnosis of cancer, haplotype mapping, imaging gene expression in vivo, types of cancer diagnosis method, ultrasound imaging
This document provides an overview of bioinformatics and computational genomics. It discusses key topics including DNA structure and function, genetic code, DNA replication, mutations, epigenetics, chromatin structure, histone modifications, DNA methylation, cancer stem cells, personalized medicine using biomarkers, and molecular profiling. The document contains diagrams explaining concepts like DNA packaging into chromatin, basic epigenetic mechanisms involving histone modifications and DNA methylation, and how epigenetic changes can alter chromatin structure and regulate gene expression.
1. DNA fingerprinting is a technique that analyzes variations in DNA sequences to identify individuals uniquely, except for identical twins. It begins by isolating DNA from samples and amplifying it using the polymerase chain reaction if needed.
2. The amplified DNA is then cut by restriction enzymes into different fragments depending on an individual's DNA sequence. These fragments are analyzed through gel electrophoresis, which separates the fragments by size.
3. The fragment pattern produced is unique to each individual and serves as their DNA fingerprint that can be used to identify the person or determine biological relationships.
Recombinant DNA technology involves manipulating genetic material to achieve goals such as producing proteins. Key aspects include molecular tools like restriction enzymes, host cells like E. coli, vectors like plasmids, and gene transfer methods. DNA from any source can be cloned by isolation, cutting with enzymes, ligation into a vector, transformation into host cells, selection of recombinants, and screening to obtain the desired product. Applications include disease diagnosis, gene therapy, protein production, and transgenic organisms.
PCR (polymerase chain reaction) is used to create millions of copies of DNA fragments through repeated cycles of heating and cooling, allowing DNA to be amplified. The document discusses several applications of PCR including genetic engineering, bioremediation, detecting genetically modified organisms, diagnosing genetic diseases and infectious diseases, forensic analysis, evolutionary studies, and medical research. Specifically, PCR can be used to insert cloned DNA fragments into organisms, detect mutations, screen for genetic diseases before birth, detect pathogens in water supplies, and identify criminals through DNA fingerprinting.
A molecular marker is a fragment of DNA associated with a specific location in the genome that is used to identify a particular DNA sequence. An ideal molecular marker is highly polymorphic, codominantly inherited, frequently distributed throughout the genome, easy to detect, reproducible, and allows for easy exchange of data between laboratories. Molecular markers like SSRs have various applications including genetic diversity analysis, cultivar identification, phylogenetic analysis, gene mapping, marker-assisted selection, and sex determination in plants.
The document discusses various topics related to molecular profiling and personalized medicine. It describes first generation molecular profiling techniques like gene sequencing, microarrays, and PCR. It then covers next generation sequencing technologies like Roche 454, Illumina, and ABI SOLID. It also discusses second generation techniques for DNA and RNA profiling including exome sequencing, ChIP-seq, and RNA-seq. Finally, it briefly mentions third generation sequencing and epigenetic profiling.
Pharmacogenomics is the study of how genetic factors affect individual responses to medications. The document discusses basic concepts like genes and alleles. It also covers the human genome project, genetic variation, gene mapping, cloning disease genes, and applications of various "omics" fields like pharmacogenomics. Pharmacogenomics aims to develop individualized drug treatments based on a person's genetic makeup.
Genomics is the study of genomes and includes determining entire DNA sequences, genetic mapping, and studying intragenomic phenomena. It allows determining an ideal genotype. Genomics and bioinformatics provide benefits like improved crop productivity, stress tolerance, and nutritional quality. Proteomics studies proteins in cells. Bioinformatics handles large genomic and proteomic data using algorithms. Structural genomics constructs sequence data and maps genes. Functional genomics studies gene function. Comparative genomics compares sequences to find relationships.
Gene mapping involves identifying the location of genes on chromosomes. It can help identify genes associated with inherited diseases. There are two main types of gene mapping: linkage mapping, which determines the relative distances between genes on a chromosome, and physical mapping, which measures distances in nucleotide bases. Gene mapping is done using various genetic markers, such as single nucleotide polymorphisms, microsatellites, and restriction fragment length polymorphisms. The goal is to better understand gene expression and regulation to help develop treatments and cures for genetic disorders.
This document discusses genomics and the usage and effects of mutations in genomics. It begins by defining genomics and the different types including structural, functional, comparative, and mutation genomics. It then describes different types of mutations that can occur at the DNA level like transitions, transversions, deletions, and insertions. It also discusses how mutations can affect proteins by being neutral, silent, missense, nonsense, or causing frameshifts. The document outlines several ways mutation genomics is used, including determining gene function, demonstrating metabolic pathways, and understanding metabolic regulation. It concludes by covering applications of genomics in crop improvement like predicting gene-phenotype relationships and improving drought, salt, and disease tolerance.
DNA microarrays contain thousands of DNA probes attached to a solid surface that allow for the simultaneous analysis of gene expression across many genes. The core principle is based on DNA hybridization, where fluorescently labeled cDNA or RNA samples are hybridized to complementary probes on the array. By detecting which probes light up after hybridization and washing, researchers can determine which genes are expressed or detect genetic variations in the sample. Microarrays have numerous applications, including gene expression analysis, disease diagnosis, drug discovery, and toxicology research. They provide a fast way to study thousands of genes but results require further validation and correlations do not necessarily indicate causation.
Applications of Genomic and Proteomic ToolsRaju Paudel
This document provides an overview of genomic and proteomic tools. It discusses topics like genomics, which is the study of genomes including structural and functional genomics. Proteomics is defined as the large-scale study of proteins, their structures and functions. Several techniques are described briefly, including DNA gel electrophoresis, polymerase chain reaction (PCR), real-time PCR, DNA sequencing, microarray technology, enzyme-linked immunosorbent assay (ELISA), and blotting techniques like Southern blotting, Northern blotting and Western blotting. Applications of these various tools are also mentioned.
Recombinant Dna technology, Restriction Endonucleas and Vector Dr. Priti D. Diwan
Recombinant DNA technology allows DNA from different sources to be combined to form artificial DNA molecules. This is done by cutting the DNA with restriction enzymes and joining the pieces together with DNA ligase. The artificial DNA can then be inserted into host cells where it is replicated. This technology was developed in 1973 and has many important applications, including producing human insulin in bacteria to treat diabetes, creating genetically modified crops with desirable traits, and producing other proteins and vaccines. The basic steps involve isolating DNA, cutting it with restriction enzymes, ligating the pieces, introducing the DNA into host cells, replicating the DNA within the cells, and identifying cells containing the recombinant DNA.
1. Recombinant DNA technology involves manipulating genetic material from different sources to create chimeric DNA molecules. This is done using various tools like restriction enzymes, DNA ligase, cloning, and gene transfer methods.
2. Medical biotechnology applies recombinant DNA technology to research and produce pharmaceuticals and diagnostic products to treat and prevent human diseases. This includes producing insulin, growth hormones, antibodies, and vaccines.
3. Techniques like PCR, blotting, hybridization, and DNA sequencing are used in recombinant DNA technology applications such as gene mapping, understanding disease mechanisms, DNA-based diagnostics, forensics, and gene therapy.
Similar to B.Tech Biotechnology II Elements of Biotechnology Unit 4 DNA Fingerprinting (20)
Rai University provides high quality education for MSc, Law, Mechanical Engineering, BBA, MSc, Computer Science, Microbiology, Hospital Management, Health Management and IT Engineering.
The document discusses various types of retailers including specialty stores, department stores, supermarkets, convenience stores, and discount stores. It then covers marketing decisions for retailers related to target markets, product assortment, store services, pricing, promotion, and store location. The document also discusses wholesaling, including the functions of wholesalers, types of wholesalers, and marketing decisions faced by wholesalers.
This document discusses marketing channels and channel management. It defines marketing channels as sets of interdependent organizations that make a product available for use. Channels perform important functions like information gathering, stimulating purchases, negotiating prices, ordering, financing inventory, storage, and payment. Channel design considers customer expectations, objectives, constraints, alternatives that are evaluated. Channel management includes selecting, training, motivating, and evaluating channel members. Channels are dynamic and can involve vertical, horizontal, and multi-channel systems. Conflicts between channels must be managed to balance cooperation and competition.
The document discusses integrated marketing communication and its various elements. It defines integrated marketing communication as combining different communication modes like advertising, sales promotion, public relations, personal selling, and direct marketing to provide a complete communication portfolio to audiences. It also discusses the communication process and how each element of the marketing mix communicates to customers. The document provides details on the key components of an integrated marketing communication mix and how it can be used to build brand equity.
Pricing is a key element in determining the profitability and success of a business. The price must be set correctly - if too high, demand may decrease and the product may be priced out of the market, but if too low, revenue may not cover costs. Pricing strategies should consider the product lifecycle stage, costs, competitors, and demand factors. Common pricing methods include penetration pricing for new products, market skimming for premium products, value pricing based on perceived worth, and cost-plus pricing which adds a markup to costs. Price affects demand through price elasticity, with elastic demand more sensitive to price changes.
The document discusses various aspects of branding such as definitions of a brand, brand positioning, brand name selection, brand sponsorship, brand development strategies like line extensions and brand extensions, challenges in branding, importance of packaging, labeling, and universal product codes. It provides examples of well-known brands and analyzes their branding strategies. The key points covered are creating emotional value for customers, building relationships and loyalty, using brands to project aspirational lifestyles and values to command premium prices.
This document outlines the key stages in the new product development (NPD) process. It begins with generating ideas for new products, which can come from internal or external sources. Ideas are then screened using criteria like market size and development costs. Successful concepts are developed and test marketed to customers. If testing goes well, the product proceeds to commercialization with a full market launch. The NPD process helps companies focus their resources on projects most likely to be rewarding and brings new products to market more quickly. It describes common challenges in NPD like defining specifications and managing resources and timelines, and how to overcome them through planning and cross-functional involvement.
A product is an item offered for sale that can be physical or virtual. It has a life cycle and may need to be adapted over time to remain relevant. A product needs to serve a purpose, function well, and be effectively communicated to users. It also requires a name to help it stand out.
A product hierarchy has multiple levels from core needs down to specific items. These include the need, product family, class, line, type, and item or stock keeping unit.
Products go through a life cycle with stages of development, introduction, growth, maturity, and decline. Marketing strategies must adapt to each stage such as heavy promotion and price changes in introduction and maturity.
This document discusses barriers between marketing researchers and managerial decision makers. It identifies three types of barriers: behavioral, process, and organizational. Specific behavioral barriers discussed include confirmatory bias, the difficulty balancing creativity and data, and the newcomer syndrome. Process barriers include unsuccessful problem definition and research rigidity. Organizational barriers include misuse of information asymmetries. The document also discusses ethical issues in marketing research such as deceptive practices, invasion of privacy, and breaches of confidentiality.
The document discusses best practices for organizing, writing, and presenting a marketing research report. It provides guidance on structuring the report with appropriate headings, formatting the introduction and conclusion/recommendation sections, effectively utilizing visuals like tables and graphs, and tips for an ethical and impactful oral presentation of the findings. The goal is to clearly communicate the research results and insights to the client to inform their decision-making.
This document discusses marketing research and its key steps and methods. Marketing research involves collecting, analyzing and communicating information to make informed marketing decisions. There are 5 key steps in marketing research: 1) define the problem, 2) collect data, 3) analyze and interpret data, 4) reach a conclusion, 5) implement the research. Common data collection methods include interviews, surveys, observations, and experiments. The data is then analyzed using statistical techniques like frequency, percentages, and means to interpret the findings and their implications for marketing decisions.
Bdft ii, tmt, unit-iii, dyeing & types of dyeing,Rai University
Dyeing is a method of imparting color to textiles by applying dyes. There are two major types of dyes - natural dyes extracted from plants/animals/minerals and synthetic dyes made in a laboratory. Dyes can be applied at different stages of textile production from fibers to yarns to fabrics to finished garments. Common dyeing methods include stock dyeing, yarn dyeing, piece dyeing, and garment dyeing. Proper dye and method selection are needed for good colorfastness.
Bsc agri 2 pae u-4.4 publicrevenue-presentation-130208082149-phpapp02Rai University
The government requires public revenue to fund its political, social, and economic activities. There are three main sources of public revenue: tax revenue, non-tax revenue, and capital receipts. Tax revenue is collected through direct taxes like income tax, which are paid directly to the government, and indirect taxes like sales tax, where the burden can be shifted to other parties. Non-tax revenue sources include profits from public enterprises, railways, postal services, and the Reserve Bank of India. While taxes provide wide coverage and influence production, they can also reduce incentives to work and increase inequality.
Public expenditure has increasingly grown over time to fulfill three main roles: protecting society, protecting individuals, and funding public works. The growth can be attributed to several causes like increased income, welfare state ideology, effects of war, increased resources and ability to finance expenditures, inflation, and effects of democracy, socialism, and development. There are also canons that govern public spending like benefits, economy, and approval by authorities. The effects of public expenditure include impacts on consumption, production through efficiency, incentives and allocation, and distribution of resources.
Public finance involves the taxing and spending activities of government. It focuses on the microeconomic functions of government and examines taxes and spending. Government ideology can view the community or individual as most important. In the US, the federal government has more spending flexibility than states. Government spending has increased significantly as a percentage of GDP from 1929 to 2001. Major items of federal spending have shifted from defense to entitlements like Social Security and Medicare. Revenues mainly come from individual income taxes, payroll taxes, and corporate taxes at the federal level and property, sales, and income taxes at the state and local levels.
This document provides an overview of public finance. It defines public finance as the study of how governments raise money through taxes and spending, and how these activities affect the economy. It discusses why public finance is needed to provide public goods and services, redistribute wealth, and correct issues like pollution. The key aspects of public finance covered are government spending, revenue sources like income taxes, and how fiscal policy around spending and taxation can influence economic performance.
The document discusses the classical theory of inflation and how it relates to money supply. It states that inflation is defined as a rise in the overall price level in an economy. The quantity theory of money explains that inflation is primarily caused by increases in the money supply as controlled by the central bank. When the money supply grows faster than the amount of goods and services, it leads to too much money chasing too few goods and a rise in prices, or inflation. The document also notes that hyperinflation, which is a very high rate of inflation, can occur when governments print too much money to fund spending.
Bsc agri 2 pae u-3.2 introduction to macro economicsRai University
This document provides an introduction to macroeconomics. It defines macroeconomics as the study of national economies and the policies that governments use to affect economic performance. It discusses key issues macroeconomists address such as economic growth, business cycles, unemployment, inflation, international trade, and macroeconomic policies. It also outlines different macroeconomic theories including classical, Keynesian, and unified approaches.
Market structure identifies how a market is composed in terms of the number of firms, nature of products, degree of monopoly power, and barriers to entry. Markets range from perfect competition to pure monopoly based on imperfections. The level of competition affects consumer benefits and firm behavior. While models simplify reality, they provide benchmarks to analyze real world situations, where regulation may influence firm actions.
This document discusses the concept of perfect competition in economics. It defines perfect competition as a market with many small firms, identical products, free entry and exit of firms, and complete information. The document outlines the key features of perfect competition including: a large number of buyers and sellers, homogeneous products, no barriers to entry or exit, and profit maximization by firms. It also discusses the short run and long run equilibrium of a perfectly competitive firm, including cases where firms experience super normal profits, normal profits, or losses.
2. DNA Fingerprinting & Forensics
• History
• Uses of DNA Profiling
• Hypervariable DNA sequences examined (RFLPs, VNTRs,
STRs, SNPs, mitochondrial DNA, Y chromosomal DNA)
• Methods (Southerns & PCR)
• Statistical considerations
• Technical considerations
• Databases and Privacy
2
3. DNA Fingerprinting
• You're 99.9% identical
• But of course, you are unique--in a genome of three
billion letters, even a 0.1 % difference translates into
three million differences.
• These differences (or polymorphisms) reside in
several places in the genome, often in microsatellites
• Examples of such polymorphisms include VNTRs,
STRs, RFLPs and SNPs
3
4. DNA Fingerprinting
• Focuses on the 0.1-1.0% of human DNA that is
unique
• First described in 1985 by Dr. Alec Jeffreys in England
• DNA evidence is admissible in courts
• Labs such as Cellmark Diagnostics and Lifecodes
Corporation are examples of companies which
provide such DNA evidence to courts, but states and
many U.S. cities have labs for DNA fingerprinting
• Have any of you worked in a crime lab?
4
5. Uses of DNA fingerprinting
• Paternity testing
• Identification of criminals (e.g. murderers, rapists,
letter bombers)
• Immigration disputes (family relationships)
• Identification of deceased individuals with mutilated
or decomposed bodies (e.g., the military, 9/11 victims)
• Identifying the sperm donor who “decorated” Monica
Lewinsky’s blue dress
5
6. How is DNA fingerprinting done?
• DNA obtained from hair, semen, blood, sweat, saliva,
bone or any other tissue (often found at a crime scene)
• Can be done by southern blotting with an appropriate
probe or by a PCR method using appropriate primers
• Can use single locus probes/primers or multilocus
probes/primers
• DNA can be resolved on a gel or by a capillary
electrophoresis system
6
7. Sequences examined in DNA fingerprinting
• VNTRs-variable number tandem repeats; composed of 8-
80 bp repeat units (e.g., [GCGCAATG]n) which are
tandemly repeated so that the overall length is 1-30 kb
• STRs-short tandem repeats; composed of 2-7 bp repeat
units (e.g., [AC]n) which are tandemly repeated so that
the overall length is less than 1 kb
• RFLPs-restriction fragment length polymorphisms
• SNPs-single nucleotide polymorphisms
• Mitochondrial DNA-maternal inheritance, tends to be
more stable than nuclear DNA
• Y chromosome DNA- passed from father to son
7
8. DNA fingerprinting: an example
• D1S80, a VNTR located on human chromosome 1,
contains a 16 bp repeat unit
• The number of repeats varies from one individual to the
next, and is known to range from 14-41
8
9. Some examples of DNA fingerprinting
• Paternity cases
• Crime scenes
9
10. Determining the probability of a match
• Relies on statistics
• Analysis depends upon your ethic background
(i.e. African American, Caucasian, Hispanic
Asian, etc.)
10
12. Technical Considerations
• Preserve the integrity of DNA sample
• Avoid DNA contamination & degradation
• Avoid incomplete digestions if REs are used
• Use standard hybridization conditions
• Use standard PCR primers and procedures
• Gel analysis is less reproducible than capillary
electrophoresis of PCR products
• Difficulties in interpreting bands on a gel or X-ray film
12
13. DNA databases
• Already in place in the FBI for convicted felons (i.e.,
CODIS-COmbined DNA Index System, involves 13 STR
loci) and the Dept. of Defense for armed service
personnel and the Virginia saliva and blood bank of
convicted felons
• A national DNA database has been suggested. What
do you think?
• Could current or potential employers or insurance
companies base decisions they make on this kind of
data?
13
14. Fig. 9.18 Random Amplified Polymorphic DNA (RAPD)
• Use of arbitrary oligonucleotide primers,
usually 9-10 nucleotides long, in a PCR of total
DNA to distinguish plant cultivars, animal
varieties, and microbe isolates
• A PCR product will be produced whenever two
of the oligonucleotide primers face one
another and are 100-3,000 bp apart
Chromosomal DNA Region of amplified DNA
14
15. Fig. 9.20 Real Time PCR
• A way to quantitate
DNA in a PCR
• Involves the use of
SYBR green dye
• SYBR green only
binds to and
fluoresces with
dsDNA
15
16. Fig. 9.16 Bacterial biosensors
• One example involves using Pseudomonas
fluorescens (genetically engineered for
bioluminescence) to monitor pollutants
• If pollutants are present in a sample, then cell
death occurs and “the light goes out”
lux genes in the
chromosomal DNA
16
17. Fig. 9.5 Bacterial biosensors (another example)
• Green fluorescent protein (GFP) can be used a
reporter gene under the control of some inducible
promoter (e.g., one that responds to some
environmental signal such as a toxin)
• If the signal is present GFP will be produced
17
21. Genetically Modified Organism-GMO
• A genetically modified organism (GMO) is any
organism whose genetic material has been
altered using genetic engineering techniques.
• GMOs are the source of genetically modified
foods and are also widely used in scientific
research and to produce goods other than
food.
21
22. • Genetic modification involves the mutation, insertion, or deletion
of genes. Inserted genes usually come from a different species in a
form of horizontal gene-transfer. In nature this can occur when
exogenous DNA penetrates the cell membrane for any reason. To
do this artificially may require:
• attaching the genes to a virus
• physically inserting the extra DNA into the nucleus of the intended
host with a very small syringe
• with the use of electroporation (that is, introducing DNA from one
organism into the cell of another by use of an electric pulse)
• with very small particles fired from a gene gun.
• Other methods exploit natural forms of gene transfer, such as the
ability of Agrobacterium to transfer genetic material to plants, or
the ability of lentiviruses to transfer genes to animal cells.
22
23. Uses of GMO
• GMOs are used in biological and medical research, production of
pharmaceutical drugs, experimental medicine (e.g. gene therapy),
and agriculture (e.g. golden rice, resistance to herbicides).
• The term "genetically modified organism" does not always imply,
but can include, targeted insertions of genes from one species into
another. For example, a gene from a jellyfish, encoding a
fluorescent protein called GFP, can be physically linked and thus co-
expressed with mammalian genes to identify the location of the
protein encoded by the GFP-tagged gene in the mammalian cell.
• Such methods are useful tools for biologists in many areas of
research, including those who study the mechanisms of human and
other diseases or fundamental biological processes in eukaryotic or
prokaryotic cells.
23
25. Background
Bt Brinjal, India’s (and the world’s) first genetically
modified food crop has been temporarily stopped
in India, thanks to a massive grassroots campaign.
Bt Cotton, however, is being cultivated in many
parts of India. Benefits are doubtful, though
Doubts exist about its productivity, and has been
implicated with negative effects, like resistant
test, high water consumption, farmer suicides,
etc.
25
26. Definition
What does Bt stand for?
Bt stands for Bacillus thuringiensis, which is a
natural soil bacteria, which secretes a toxin
that is deadly to two pests - fruit and shoot
borer (FSB, Leucinodes orbonalis) and fruit
borer (Helicoverpa armigera).
Eggplant
borer :
Helicoverpa
armigera
Cotton
bollworm:
Leucinodes
orbonalis 26
27. Definition
What is a genetic modification?
Insertion of
Bt gene in the
Brinjal
genetic code
Produce the
Bt Toxin to
kill the pest
But is only the gene introduced? No, a
PROMOTER and an antibiotic resistance MARKER
GENE are also introduced! 27
28. Definition
Protein production occurs at specific times and places
GENE EXPRESSION: A gene creates proteins only
at specific times and locations in an organism,
and in very tightly regulated amounts.
Example: Pancreatic cells have genes for
producing the insulin protein, and so do cells
in the eye.
Specific
location
Specific
amount
Specific
time
Expression is tightly regulated 28
29. Definition
Regulation
How does regulation occur?
For a gene to be expressed, specific chemical
factors need to bind to a PROMOTER region
and other regulatory region in the genetic
code upstream of the gene.
AAACCGGTATAATCCCCTGAGTTTGCCGTTAGTAG
Factor
binds
promoter
Factor binds
regulatory
region Promoter
GeneRegulatory
region
29
30. Definition
Regulatory region
Therefore a gene is expressed only when specific
agents bind to promoter and regulatory
regions at specific time and at specific cell
types (eye cell vs pancreatic cell).
Though promoter sequence are known,
information about regulatory regions and
what factors binds to them is mostly
unknown.
30
31. Definition
BT Gene insertion
A BT modified brinjal has a BT gene inserted,
along with a promoter element(Cauliflower
Mosaic Virus (CaMV) promoter)
The promoter is so powerful that it keeps the BT
gene expression turned on at full volume at all
times in BT Brinjal!
This could lead to metabolic stress as the plant
has to keep producing this toxin despite the
external conditions.
31
32. Definition
BT Gene insertion
A BT modified brinjal has a BT gene inserted,
along with a promoter element(Cauliflower
Mosaic Virus (CaMV) promoter)
ACTGTCTATGTA + TACGTATAATGGTAGATTTATATGGG
TAACTGTCTATGTACGTATAATGGTAGATTTATATGGG
Gene
Promoter
BT Gene
BT Gene
Promoter
Insertion point
32
33. The insertion is carried out using an mobile
microbial DNA which infects the host cell (for
dicotyledons like lugumes, or by a gene gun
(gold pellets carrying fragments of DNA),
either which performs the random insertion in
some of the target cells.
Target
cell
Target
cellTarget
cell
Microbial
Vector
Gene
gun
Definition
Insertion process
Create primary
transformant
33
34. Definition
BT Gene insertion
Microbial Vector has the genetic sequence of
toxin present in a part of an insertion
sequence.
AACCGTGGTGGGTCCCAATTAGGGTTACCGGGG
Gold Pellet
AACGTTCCGTT
The gene gun shoots gold pellets having the sequence of interest
34
37. Definition
Result of insertion process
Target
cell
Target
cellTarget
cell
Antibiotic
Target
cell
Only target cells
survive based on
resistance to
antibiotics
37
38. Definition
Create final hybrid variety
Primary
transformant
bacterial plasmid
DNA
(pMON10518)
Hybrid variety
MHB 4, 9, 10,
80, 99
Backcross
Final variety
Bt MHB
Final variety needs high amounts water and
fertilisers . 38
39. Effects
Random
insertion
Transformation-induced “unexpected” changes might
lead to unexpected production of toxins, allergens,
carcinogens (rotenone – Parkinson’s) or teratogens in
the transformed cells.
Domingo, J.L., Toxicity Studies of Genetically Modified
Plants, Critical Rev Food Sc and Nutrition 47: 721-33
(2007)
Antibiotic
marker
Can confer antibiotic resistance to gut bacteria and
other organisms.
Jumping
gene
(plants)
Transgene-vector recombinant DNA had the capacity of
‘jumping into' alien species, it could also ‘jump out' of a
transgenic crop and ‘jump into' another species causing
gene contamination.
Jumping
gene
(animals)
Evidences are now available that show that DNA from
GM plants can survive in the human gastrointestinal
tract.
Netherwood,T. et al Nature Biotechnology 22, 204 - 209 (2004)
39
40. Advantages?
Yield not shown to
increase in Bt
Cotton or GM Soy
Increased use of
water for Bt cotton
Increase use of
pesticides
Mahyco admits
unable to control
pests in Gujarat
with Bt Cotton
40
42. Evidence
Long terms lab
tests on rats have
all shown ill-
effects
Monsanto /
Mahyco uses their
own datasets to
show yield
increase
Long term human
tests not done
Monsanto made
tests only on few
rats (10) for only 3
months
42
43. Evidence
Non-target effects of GM food crops
•21 reported harmful environmental effects;
•44 reported unexpected changes in plant physiology;
•20 reported unpredicted changes in plant morphology;
•6 reported a decrease in the food or feed quality
•4 reported scrambling of both the transgene and host DNA
Effect on animals
(a) Arpad Putszai paper in the Lancet, showed the unpredicted changes
(b) in the gastro-intestinal mucosa of rats fed with GM potato;
(c) A 90-day internal company study on rats fed with MON863 Bt-maize showed
decreased body-weight and severe toxic effects in the liver and kidneys;
(c) a 20-week feeding study by the Austrian Federal Ministry of Health revealed
lower fertility and reduced birth weight in mice fed with Bt-maize;
(d) a study carried out in the Italian government’s National Institute of Research on
Food and Nutrition showed that very young and old mice fed with Bt-maize
(MON810) for 90 days were immunologically compromised
43
44. Future Directions
Do we really need this?
We already have
varieties
Benefit to
corporations
Danger to
consumers
Negative effects on
farmers
44
45. Future Directions
Tissue specific
expressions
(instead everywhere
like root)
Chloroplast
transformation
(instead of nuclear
transformation)
Use safer
promoters
(CaMV promoter
aggressive, similarity
to HIV)
Site-directed, non-
random insertion
(Gene stacking
Golden rice)
45
46. Future Directions
GM potato,
tomato, rice,
everything in the
waiting
BRAI act will make
it illegal for ‘non-
scientists’ to
question GM
Loss of diversity
will make crops
susceptible
Control of food for
the world
46
48. What was Dolly?
• In 1997 Dolly the sheep became the first
vertebrate cloned from the cell of an adult
animal. Not only was this a remarkable
scientific breakthrough but it immediately
gained interest and concern from around the
world on the future of cloning technology as it
would effect humans.
48
49. • Dolly the sheep was successfully cloned in Britain in 1996 by the scientist
“Ian Wilmut” and was put down in February 2003 after developing a lung
infection and arthritis.
• Dolly was a genetic copy of the Finn Dorset ewe.
• Her birth, more than 10 years ago showed that nuclei from specialized
adult cells can be reprogrammed into all the cells of an organism.
• The technique that led to Dolly is called
• somatic cell nuclear transfer and has
• remained essentially unchanged over
• the last decade.
Dolly: The Cloning of a Sheep
49
2
50. Topics of Discussion
• What is cloning?
• Methods of cloning
• Dolly in detail
• Dolly’s probability
• Today’s legality
• The future of cloning
• Ethical final questions
50
51. What is cloning?
• Reproductive cloning- The entire animal is produced
from a single cell by asexual reproduction. This would
allow for the creation of a human being who is
genetically identical to another.
• Therapeutic cloning- Broader use of the term “cloning.”
Does not create a new genetically identical individual.
Research includes therapy for human mitochondria
disease and others that could replace damaged or
diseased tissues without the risk of rejecting another’s
tissue. Could create new skin tissue for burn patients.
51
52. Other types of cloning
– Multiple copies of genes or gene fragments,
repeating nucleotide sequences
– Single cell organisms, like bacteria and fungi. This
includes fermentation processes for production of
bread, beer, and wine.
– Entire plant asexual replication
– Natural cloning occurs in sexual reproduction,
when the embryo splits in two to produce twins.
52
53. Methods of cloning
– Embryo splitting- Artificially splitting a single
embryo at a very early stage of development. In
the natural process this would create twins.
However, because this is done at an early stage
and there are usually less than eight cells you can
only make a few clones. Both the nuclear genes
and mitochondria genes would be identical.
53
54. Methods of cloning
– Nuclear replacement- Genetic material (nucleus from
embryonic, fetal, or adult cell) is removed and placed
into an unfertilized egg or embryo, whose nucleus has
been removed. In this case the nuclear genes remain
the same but the mitochondria DNA would be
different. This has the potential to create the clone of
an adult organism as well as many clones at once.
54
55. Dolly in detail
– Dolly was cloned using the nuclear replacement method. Again
the nucleus with chromosome sets is fused with an unfertilized
egg whose nucleus has been removed.
– Motivating factor was that it could help to improve certain
qualities in livestock.
– Dolly was not the first sheep to be created from nuclear
replacement. Two genetically identical sheep, Megan and
Morag were born in 1996 using the technique. The difference
was that Dolly was derived from an adult sheep, and Megan and
Morag were from a sheep embryo.
55
56. Dolly’s probability
– Cells taken from a six-year-old Finnish Dorset ewe and
cultured in a lab.
– 277 cells then fused with 277 unfertilized eggs (each
with the nucleus removed)
– 29 viable reconstructed eggs survived and were
implanted in surrogate Blackface ewes.
– 1 gave birth to Dolly
– 0.361% chance at onset, 3.4482% once implanted. In
nature between 33-50% of fertilized eggs develop.
56
57. Cloning Dolly
• Enucleate the eggs produced by Scottish Blackface
ewes (female sheep).
– Treat the ewes with gonadotropin-releasing hormone
(GnRH) to cause them to produce oocytes ready
to be fertilized. Like all mammals, these are
arrested at metaphase of the second meiotic
division (meiosis II).
– Plunge a micropipette into the egg over the polar
body and suck out not only the polar body but the
haploid pronucleus within the egg.
57
58. • Fuse each enucleated egg with a diploid cell growing in
culture.
– Cells from the mammary gland of an adult Finn Dorset ewe (they have
white faces) are grown in tissue culture.
– Five days before use, the nutrient level in the culture is reduced so
that the cells stop dividing and enter G0 of the cell cycle.
– Donor cells and enucleated recipient cells are placed together in
culture.
– The cultures are exposed to pulses of electricity to
• cause their respective plasma membranes to fuse;
• stimulate the resulting cell to begin mitosis (by mimicking the stimulus of
fertilization).
58
59. • Culture the cells until they have grown into a morula
(solid mass of cells) or even into a blastocyst (6 days).
• Transfer several of these into the uterus of each (of
13, in this case) Scottish Blackface ewes (previously
treated with GnRH to prepare them for implantation.
• Wait (with your fingers crossed).
• The result: one ewe gave birth (148 days later) to
Dolly.
59
61. How do we know that Dolly is not the
progeny of an unsuspected mating of the
foster mother?
• She has a white face and the foster mother is
a Scottish Blackface
• DNA fingerprinting reveals bands found in
Finn Dorset sheep (the breed that supplied
the mammary cells), not those of Scottish
Blackface sheep
61
62. What about Dolly's telomeres?
• It turns out that her telomeres are only 80% as long
as those in a normal one-year-old sheep.
• The examination of DNA from Dolly's cells revealed
that her telomeres were abnormally short.
• It is known that telomeres are sequences located at
the end of each chromosome. These sequences
protect DNA from degradation by exonucleases. In
fact, telomeres are constantly degraded and
restored.
62
63. • The balance becomes negative as the cells age,
• leading to a degradation of chromosomes and to cell
death after about 50 multiplications.
• Dolly's telomeres were short but this was also the
case for the donor cell line, which was derived from
an old sheep and was cultured over a long period of
time.
63
64. • It was prematurely suggested that cloning
might generate old newborns.
• In all the cloned animals obtained after
Dolly and in which DNA was examined, the
length of telomeres was normal or longer
than normal.
• This was also true for clones derived from a
17-yearold bull.
• It is also interesting to note that the two
lambs born after Dolly was naturally
fertilized have normal telomeres.
64
65. What about Dolly's mitochondria?
• Although her nuclear genome came from the
Finn Dorset ewe, her mitochondria came from
cytoplasm of the Scottish Blackface ewe.
Mitochondria carry their own genome and so
with respect to the genes in mitochondrial
DNA, she is not a clone of the Finn Dorset
parent.
65
67. • Golden rice is a variety of Oryza sativa
rice produced from genetic engineering
• Biofortification-noun. The creation of
plants that make or accumulate
micronutrients
• Main purpose is to provide pro-vitamin
A to third world, developing, countries
where malnutrition and vitamin A
deficiency are common
Introduction
3
68. Classification of Oryza sativa
• Common Name: Asian Rice
• Kingdom: Plantae
• Phylum: Anthophyta
– Monocot
• Class: Commelinids
• Order: Poales
• Family: Poaceae
• Genus: Oryza
• Species: O. sativa
• Binomial Nomenclature: Oryza sativa
69. Why Rice?
• Other plants, such as sweet potatoes have varieties that are either
rich (orange-fleshed) or poor (white fleshed) in pro-vitamin A
• Carrots were originally white or purple in the 1600’s. A Dutch
horticulturist mutated the carrot to produce carotenes to symbolize
the color of the Dutch Royal House of Orange
• Global staple food. Cultivated for
over 10,000 years
• Rice provides as much as 80
percent or more of the daily caloric
intake of 3 billion people, which is
half the world’s population
70. Who Began the Golden
Rice Project?
• Started in 1982 by Ingo Potrykus-Professor emeritus of the Institute for Plant
Sciences
• Peter Beyer-Professor of Centre for Applied Biosciences, Uni. Of Freiburg,
Germany
• Funded by the Rockefeller Foundation, the Swiss Federal Institute of
Technology, and Syngenta, a crop protection company.
• Golden Rice Humanitarian Board-
responsible for the global development,
introduction and free distribution of Golden
Rice to target countries.
71. Effects of Malnutrition
• Symptoms of vitamin A deficiency (VAD) include;
night blindness, increased susceptibility to infection
and cancer, anemia (lack of red blood cells or
hemoglobin), deterioration of the eye tissue, and
cardiovascular disease
• Nearly 9 million children die from malnutrition each
year. A large proportion of those children die from
common illnesses that could have been avoided
through adequate nutrition
• The reduced immune competence increases the
morbidity and mortality rates of children
72. Goals: More is What We Aim For
• Mutate rice plants to produce carotenoids, or organic
pigments, specifically β-carotene (pro-vitamin A) in
the endosperm, the edible part of the grain
• Make Golden Rice accessible locally, free of charge to
farmers, who are able to grow, save, consume,
replant and locally sell Golden Rice
Vitamin A
(Retinol)
73. How Does It Work?
• The addition of 2 genes in the rice genome will complete the
biosynthetic pathway
– 1. Phytoene synthase (psy) – derived from daffodils
(Narcissus pseudonarcissus)
– (Phytoene synthase is a transferase enzyme involved in
the biosynthesis of carotenoids. It catalyzes the conversion
of geranylgerany pyrophosphate to phytoene.)
– 2. Lycopene cyclase (crt1) – from soil bacteria Erwinia
uredovora
• Produces enzymes and catalysts for the biosynthesis of
carotenoids (β-carotene) in the endosperm
74. • The end product of the engineered pathway
is lycopene, but if the plant accumulated
lycopene, the rice would be red.
• Recent analysis has shown the plant's
endogenous enzymes process the lycopene
to beta-carotene in the endosperm, giving
the rice the distinctive yellow color for which
it is named. The original golden rice was
called SGR1, and under greenhouse
conditions it produced 1.6 µg/g of
carotenoids.
4
75. ADVANTAGE
• Golden rice give more quantity vitamin-A
• Easy distribution when released to needy
• Cheaper option to supply vitamin A requirement compared to other
supplementary measures
• Sustainable option as once released for common cultivation can be
cultivated every growing season by farmer saved seeds, therefore no
need of yearly budgetary investment for distribution
76. • Health
– May cause allergies or fail to perform desired effect
– Supply does not provide a substantial quantity as the
recommended daily intake
• Environment
– Loss of Biodiversity. May become a gregarious weed and
endanger the existence of natural rice plants
– Genetic contamination of natural, global staple foods
• Culture
– Some people prefer to cultivate and eat only white rice
based on traditional values and spiritual beliefs
DISADVANTAGE