The document discusses repetitive DNA elements in human chromosomes, focusing on tandem repeats classified as satellites, minisatellites, and microsatellites. It describes the characteristics of each type of repeat, including length, copy number, location, and uses. Variable number tandem repeats (VNTRs) are highlighted as being highly polymorphic due to variation in repeat number between individuals, making them useful for genetic analysis and forensic identification.

1. Akash Mahadev Iyer
S4 M.Sc Biochemistry
Department of Biochemistry
University of Kerala

2.  All human share about 99 % of their DNA.
 The remaining 1% accounts for variability between us- unless you are
an identical twin!.

3.  Repetitive DNA -two patterns of distribution in the chromosomes.
The two major classes of repetitive elements are
 Interspersed elements and
 Tandem arrays.

4. 1. Interspersed repeated elements are usually present as single copies
and distributed widely throughout the genome.
2. Tandemly-repeated DNA may be further classified according to the
length and copy number of the basic repeat units as well as its
genomic localization;
3 main types
 Satellite
 Minisatellite
 Microsatellite

5.  A satellite is a highly repetitive DNA sequence with each repeated
sequence ranging from a thousand to several thousand base pairs.
 The entire satellite can be up to 100 million base pairs long,
Occur in regions of heterochromatin.
Satellite DNA - clustered in discrete
areas such as centromere.

6.  Differ in density from the remaining chromosomal DNA and are separable as
minor band in CsCl Density Gradient Centrifugation, called as SATELLITE
DNA.

7.  A minisatellite is an array of tandem repeats, with each repeat ranging
from nine to 100 base pairs.
 The entire array is usually 500 to 30,000 base pairs long.
 Most commonly found in euchromatin regions of the chromosome.
 Like satellite DNA sequences, they are also not transcribed
 A microsatellite is an array of very short repeats
 2-6 base pairs each, with the entire array ranging from 10,000 to 100,000
base pairs in length.
 Found in the euchromatin regions of vertebrate, insect and plant
chromosomes. The number of repeats varies among individuals in a
population, making microsatellites particularly useful to the population
geneticist.

9.  Tandem repeats occur in DNA when a pattern of one or more nucleotides
is repeated and the repetitions are directly adjacent to each other.
 An example would be:
AATTTTCCGGCCCCAAAATTCCAATTTTCCGGCCCCAAAATTCCAATTTTCCGGCCCCAAAATTCC
 These can be found on many chromosomes, and often show variations in
length between individuals.
 The number of elements in a given region may vary, hence they are known
as variable number tandem repeats.
 Each variant acts as an inherited allele, allowing them to be used for
personal or parental identification.
 Scientists use polymorphic loci that are known to
contain VNTRs/STRs in order to differentiate people based on their DNA.
Variable Number Tandem Repeats

10.  In standard genetics, we often think of an allele as a variation
of gene that would result in a difference in a physical manifestation
of that gene.
 In the case of VNTRs, these alleles are simply a difference in
number of repeats.
 The length of DNA within this locus is either longer or shorter and gives
rise to many different alleles.
 A locus in a population is polymorphic if it has more than one allele.
 This is often used in forensic science or in maternity/paternity cases.
 Any variation of a locus is referred to as an allele.
• VNTR regions are not genes, and our interest in them is solely related to
their use for identifying individuals. We therefore refer to them
as markers.

11.  Because different alleles consist of different numbers of repeats, VNTR
alleles can be identified by their lengths.
 If DNA fragments of different lengths are placed on a semisolid medium
(gel) in an electric field, they migrate at different rates;
 Different-sized fragments can therefore be identified by the distance
they travel between electrodes in such a gel

12.  First human minisatellite was discovered in 1980 by A.R. Wyman and
R. White
 Alec Jeffreys coined the term ‘minisatellite’
 14-100 bp sequences which repeats 20-50 times
 Hypervariable minisatellites, highly polymorphic, contain 100-1000
repeats
 HVMS DNA sequences; Not transcribed (ex; MUC1 locus)
 The variability is not just limited to the number of repeat but also the
sequence of repeats can vary in different members of an array
 Of the 300 minisatellite families, which have been typed less than 10
are hypervariable

13.  Individual repeats can be removed from (or added to) the VNTR via
recombination or replication errors.
 Different individuals within a population may have different numbers of
repeats.
 For example, one person might carry 3 tandem repeats in a particular
gene, while another person might bear 15 repeats

14. • Due to the repetitive nature of the sequence have allowed further
increases/decreases in the number of repeats resulting in the
polymorphisms observed
 These can be isolated from an individual’s DNA and therefore relatively
easy to map.
VNTRs have a disadvantage as genetic markers:
 They tend to bunch together at the ends of chromosomes, leaving the
interiors of the chromosomes relatively devoid of markers.

16. While the repeated sequences
themselves are usually the same from
person to person, the number of times
they are repeated tends to vary.
In order to create a DNA fingerprint
that is unique to each person
scientists had to identify areas in the
genome that are highly variable.
VNTRs are highly polymorphic-
VNTRs tends to differ among different
people.
The number of times the sequence is repeated can differ
within and between individuals therefore making these
VNTRs a polymorphic entity.

17.  VNTR loci tend to be hypermutable through an insertion/deletion of
short nucleotide repeat sequences.
 They are classified a hypermutable only when their mean mutation
frequency is greater than 0.5%
 Mutation frequency is defined as the frequency at which a specific kind
of mutation is found in a population of cells
 Great variation can be generated –as the mutation rates thousands-
millions, of times faster than the rest of the genome
 Short arrays of repeats can be stable over millions of years, while long
alleles can have an extremely high frequency of mutational changes (up
to 15%).

18.  The most highly mutable minisatellite locus described so
far is CEB1 (D2S90)- 13% mutation rate in the male
germline (Vergnaud et.al)
Organellar location;
 Minisatellites are not just restricted to nuclear DNA, they are
also present in mtDNA, cpDNA
VNTRs are thought to have arisen due to
 Slippages during DNA replication or
 As a consequence of Unequal crossing-over,

19.  During replication the DNA polymerase copies the template and sometimes
stutters in areas where tandem repeats are located.
 As a result the number of repeats increases. This is called backward
replication slippage.

20.  If a tandem repeat region contains many repeats a mechanism called
forward replication slippage may occur.
 During replication when the DNA is single stranded, the repeat region
forms loops.
 The DNA polymerase may accidentally skip this looped region and as a
result the replicated stand contains a decreased number of tandem
repeats.

21. VNTRs are very rarely found in polypeptide encoding DNA.
 Exception; MUC1 locus at 1q21 encodes a highly polymorphic glycoproteins-
mucins
 Mucins are HMW GPs
 Found in several epithelial tissues, mucous membranes and body
fluids(maintains integrity and differentiation of EC, promotes tumor cell
proliferation and metastasis)
 Mucins can be either secretory (MUC2, MUC6, MUC7) or membrane bound
(MUC1, MUC12, MUC13)
 The extracellular portion of mucins contain large no of TR repeats of similar
amino acids- 20 aa (Ser, Thr; O-linked glycosylation sites)

23. Variation at the insulin gene variable number of tandem
repeats (INS VNTR)
 Minisatellite has been shown to influence pancreatic insulin gene
transcription, both in the fetus and in adulthood
 The 5’ regulatory region of INS contains a variable number of tandem repeat
(VNTR) locus that has been associated with T1D.
 A(C/T)AGGGGT(G/C)C(G/C/T)(G/A/T)(G/A/T)G(G/C/T);
 14-15 bp consensus sequence situated at the 5’region of INS gene
 The VNTR lies 596 bp upstream of the insulin gene on chromosome
11p15.5, and has been suggested to influence transcription rate of these
genes.
 Known as Insulin gene minisatellite or ILPR- Insulin linked polymorphic
region
 No of repeats in the alleles ranges from 26 to >200

24. Three classes of alleles identified on the basis of overall size;
 Class I (26-63 repeats- associated with IDDM suscepibility)
 Class ll (80 repeats)
 Class lll (140-200 repeats)- cause transcription of INS gene in
developing thymus, thus increases efficiency of deletion of insulin-
reactive T-cell clones during development of immune system, reducing
risk of autoimmune attack
Low thymic insulin- hampered negative selection

25. Insulin Gene (INS)
Class I VNTR
26-63 repeats
21 alleles
Predisposing
Insulin Gene (INS)
Class III VNTR
140-200 repeats
15 alleles
Protective
VNTR = Variable Number of Tandem Repeats

26. Applications
 VNTR fingerprinting has been applied for subtyping of Salmonella
typhi and S.typhimurium
 VNTR typing as the next gold standard in the molecular
epidemiology of tuberculosis - Genotyping for early diagnosis of
M. tuberculosis super-infection or mixed infection
 Used as genetic markers in linkage analysis and population studies
 Highly valuable new tool in population ecology
 Fingerprinting
 Conservation biology
 Parentage
 Forensics
 Genetic identity

27. Importance in human genome
 Minisatellites have been found in association with important features of
human genome biology such as gene regulation, chromosomal fragile
sites, and imprinting
 Some are part of an open reading frame, which may or may not display
polymorphism in the human population
 Minisatellites located in the 5′ region of genes participate in the
regulation of transcription.
 Others located within introns interfere with splicing
 Minisatellites at imprinted loci are thought to play a role in the imprint
control
 Finally, minisatellites may constitute chromosome fragile sites and
have been found in the vicinity of a number of recurrent translocation
breakpoints and in the switch recombination site in immunoglobulin
heavy chain genes

28. References
 Human Molecular Genetics, Tom Strachan, 3rd edition, Garland
Science
 Molecular Markers and Plant Biotechnology-By Rukam S. Tomar,
New India Publishing
 Computational Systems-Biology and Bioinformatics- edited by
Jonathan H. Chan,
 Human Molecular Biology Laboratory Manual- by Stefan
Surzycki, Wiley
 Mini- and Microsatellites by Claes Ramel, Stockholm University
 Slideshare
 NCBI