Role of CRISPR/Cas9 in plant pathology Production of disease resistance cultivars by editing the genome which is responsible for susceptibility factor for fungal and bacterial diseases. By editing the genome which governs host pathogen interaction we can obtain incompatible interaction between host pathogen. To improve the efficacy of bio control agents. By editing the genome responsible for virus multiplication and virulence we can obtain virus free resistance cultivars.

2. Seminar In-charge
Dr. Arjun Lal Yadav
Assistant Professor
Plant Pathology
Presented By
Anand Choudhary
Ph.D. Research Scholar
Plant Pathology
Department of plant Pathology
College of Agriculture, BiKaner
SKRAU, Bikaner (RAJ.)

3. Introduction
Importance of CRISPR Cas9 technique
Terminology
Origin of CRISPER Cas9 technique
Mechanism of CRISPER Cas9 technique
Uses of CRISPER Cas9 technique in plant pathology
Case studies of CRISPER Cas9 technique in plant disease management
Issues
Future prospect

4. CRISPER - Clustered Regularly Interspaced Short Palindromic Repeats.
Cas9 - CRISPR ASsociated protein 9
CRISPER Cas9- is a unique technology that enables geneticists and medical
researchers to edit parts of the genome by removing, adding or altering sections of
the DNA sequence.
It is currently the simplest, most versatile and precise method of genetic manipulation
and is therefore causing a buzz in the science world.

5. Importance
 The CRISPR/Cas9 is considered a highly promising genome-editing method in crops because if its high degree
of flexibility and accuracy in cutting, multiple-gene editing, limited off-target impact, greater output and
simplicity
 One of the reason for its popularity is that it makes is possible to carry out genetic engineering on an
unprecedented scale at a very low cost.
 How it differs from previous technique, is that it allows for the introduction or removal of more than one
gene at a time, reducing the process from taking a number of year to a matter of weeks.
 Its not species- specific, so can be used an organism previously resistant to genetic engineering.
 In agriculture, it could help in the design of new grains, roots & fruits making the disease resistance cultivar.
Within the context of health it could pave the way to the development of new treatment for rare metabolic
disorders & genetic disease.

6. CRISPR……... …..is complicated.
But we are going to
make it simple

7. Inflammation (Figure 22.6)
1 4
3
2
Formation of
exudate and “washing”
of infected area
Exudate
Increase in fluid
uptake by lymphatic
capillaries
Delivery of
plasma
proteins
Diapedesis
Chemotaxis
Chemical
gradient
Injured
tissue
Bacteria
Release of inflamatory
and chemotactic factors
Mast cells
Neutrophil
CAMs
Lymphatic capillary
Lymph
Basophil
Recruitment of
immune cells
• Margination
• Diapedesis
• Chemotaxis
Vascular changes
include
• Vasodilation of
arterioles
• Increase in capillary
permeability
• Display of CAMs
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Margination

8. Clustered Regularly Interspaced Short Palindromic Repeats
Repeat Repeat
Repeat
Repeat Repeat
Repeat
Phage
CRISPR region
Phage genes
1 2
Repeat Repeat
Repeat
Repeat Repeat
Repeat
Phage
CRISPR region
Phage genes
Transcription
CRISPR RNAs

9. Clustered Regularly Interspaced Short Palindromic Repeats
Repeat Repeat
Repeat
Repeat Repeat
Repeat
Phage
CRISPR region
Phage genes
1 2
Repeat Repeat
Repeat
Repeat Repeat
Repeat
Phage
CRISPR region
Phage genes
Transcription
CRISPR RNAs

10. Clustered Regularly Interspaced Short Palindromic
Repeats
Bacteriophage
Repeat Spacer Spacer Spacer

11. • Palindromic Sequence - A palindromic sequence is a nucleic acid
sequence in a double-stranded DNA or RNA molecule whereby reading in a
certain direction on one strand is identical to the sequence in the same
direction on the complementary strand.

12. Genome - A genome is the complete set of genetic information in an organism.
 It provides all the information which the organism requires to function. In living organisms, the
genome is stored in long molecules of DNA called chromosomes.
The study and analysis of genomes is called genomics.

13. • Spacer DNA – Non coding DNA that separates one
gene from another. Spacers are short segments (26 to
72 bp) of sequence that are homologous to phage or
plasmid DNA.
• Cr RNA / CRISPER RNA- The crRNA is
complementary to the viral spacer that was stored after
the original infection.
• tracrRNA – Trans active RNA that bind with crRNA
form active complex.
• Sg RNA- Single guide RNA is a combination of tracer
RNA & cr RNA.

15. • PAM sequence - Each Cas nuclease binds
to its target sequence only in presence of a
specific sequence, called protospacer
adjacent motif (PAM), on the non-targeted
DNA strand.
• The PAM is a component of the invading
virus or plasmid, but is not found in the
bacterial host genome
• The nuclease cuts 3-4 nucleotides upstream
of the PAM sequence.

16. Who discovered CRISPR?
How
Rearrange
letters
CRISPR discovered?
Flip Words
insert
was
How was CRISPR discovered?

17. 342 | NATURE | VOL 535 | 21 JULY 2016
18 Cell 164, January 14, 2016

18. Jennifer
Doudna
Emmanuelle
Charpentier
Feng Zhang

19. Feng Zhang’s group at MIT.
Where is the boss?

21. In the last paragraph of the Discussion…..
This is how science often happens…….

22. In 1987 a Japanese team of scientists at osaka university noticed a new pattern of DNA sequence in a gene
belonging to E.coil
It appeared that the gene had five short repeating segments of DNA separated by short non spacer DNA
sequence. All five repeating segments had identical sequences composed of 29 bases, the building block of
DNA. By contrast each of the spacer sequence had their own unique sequence composed of 32 bases.
Microbiologists had never seen such a pattern before. By end of the 1990s however they had begun to
discover, with the aid new improvement of DNA sequencing.
That this pattern was prevalent in many different microbe species so common was the pattern that it was given
its own name, clustered regularly inter spaced short palindromic repeat

23. GGAGTTCTACCGCAGAGGCGGGGGAACTCCAAGTGATATCCATCATCGCATCCAGTGCGCC
CGGTTTATCCCCGCTGATGCGGGGAACACCAGCGTCAGGCGTGAAATCTCACCGTCGTTGC
CGGTTTATCCCTGCTGGCGCGGGGAACTCTCGGTTCAGGCGTTGCAAACCTGGCTACCGGG
CGGTTTATCCCCGCTAACGCGGGGAACTCGTAGTCCATCATTCCACCTATGTCTGAACTCC
CGGTTTATCCCCGCTGGCGCGGGGAACTCG
Clustered Regularly Interspersed Palindromic Repeats
CRISPR repeats (29) Spacer sequences (32)
(later shown to be foreign DNA)
29 29 29
29
32 32 32 32

24. • In 2002, noted that another set of sequence always accompanied the CRISPR sequence. The Cas genes appeared
to code for enzyme that cut DNA.
• By 2005 three scientific teams had independently worked out that the spacer. Sequence between the crispr
sequence shared similarities with the DNA of viruses and hypothesised that it could be tool in the defense
mechanism of bacteria.
• Knowledge about how the CRISPR Cas9 system worked was opened up by some experiments conducted in 2007
by scientists at Danisco.
• The team infected a milk fermenting microbe Streptococcuss thermophilius, with two virus strains. Many of them
bacteria were killed by the virus, but some survived and went on to produce offspring also resistant to the viruses.
On further investigation it appeared that the microbes were inserting DNA fragment from the virus into their
spacer sequence and they lost resistance whenever new spacer were cut out.

25. • In Aug 2012, a small team of scientists led by Dr.
Jennifer Doudna (Right in image) and Dr. Emmanuel
Charpentier (left in image) published a paper in the
Science Journal, showing how to harness the natural
crispr cas9 system as a tool to cut any DNA strand in a
test tube.
• It wasn’t until 2020 - well after it had been adopted in
labs around the world - that Doudna and Charpentier
won the Nobel prize in Chemistry for their discovery,
becoming the first all-female team to do so.

27. CRISPR Mechanism: How Does It Work?
The CRISPR-Cas9 system consists of two key molecules that introduce a change
(mutation) into the DNA. These are:
I. An enzyme called Cas9 which acts as a pair of molecular scissors that can cut the two
strands of DNA at a specific location in the genome so that bits of DNA can then be added
or removed.
II. A piece of RNA called guide RNA (g RNA) that consists of a small piece of predesigned
RNA sequence (about 20 bases pair long) located within a longer RNA scaffold.
The pre-designed sequence guides' the Cas9 to the right part of the genome. This makes
sure that the Cas9 enzyme cuts at the right point in the genome.
 At this stage the cell recognises that the DNA is damaged and tries to repair it.
Scientists can use the DNA repair machinery to introduce changes to one or more genes in
the genome of a cell of interest.

28. CRISPR Mechanism: How Does It Work?
• Step 1. FORMATION OF THE EDITING COMPLEX
Case 9 enzyme pair with guide RNA, which carriers a sequence matching that
of the target gene.

29. CRISPR Mechanism: How Does It Work?
Step 2. PAIRING WITH THE TARGET GENE
The complex (Case9 g RNA and the complimentary sequence) binds precisely
to the target gene in the genome at PAM sites such as NGG, respectively in the
homologue sequence of host gene.

30. CRISPR Mechanism: How Does It Work?
Step 3. CUTTING THE TARGET DNA
• The transcrRNA pairs with pre-crRNA sequence to generate double stranded
RNA followed by cleaving with RNase III which produces mature crRNA.
• Case9 enzyme cuts the target gene on the genome.

31. QUESTION: What happens after the cut?
ANSWER: The cell tries to repair the damage!
Two Options
-----------------------------------------------------------------------------------------------------------------------------------------
( Error-prone)
Non-Homologous End Joining
Gene Knock-Out
or
(Requires a homologous donor DNA)
Homology Directed Repair
Gene Replacement
Neither outcome warrants the use of the word “editing”.
ATTGCCAGTCAGATCAGAGGTAA CTTACGGTGCATGACATTACTAGT
TAACGGTCAGTCTAGTCTCCATT GAATGCCACGTACTGTAATGATCT
?

32. Non-Homologous End Joining
Random bases added or deleted
Knock out = disrupt gene
X
Error prone DNA repair (NHEJ)
X
knock out = disrupt gene

33. CRISPR gene knockout
NHEJ is error-prone, and it usually results in insertions and deletions (indels) in the region
being repaired. When indels occur within the coding region of a gene and result in a
frameshift mutation, the gene becomes non-functional. This is known as a gene knockout.

34. 2nd option -Homology Directed Repair
DNA repair using a template (HR)
Repair instructions
Cell uses template to repair DNA
Alter the sequence to change function
Alter sequence to change function

35. CRISPR Mechanism: How Does It Work?
Step 4. INSERTING A NEW GENE
• A short fragment of DNA or the desired gene with a specific function is then
inserted to fill the gap and replace the original gene.

36. CRISPR knock-in
In the presence of a homology directed repair (DSB) induced by Cas9, cells can also repair
themselves via HDR, and this pathway offers an opportunity for researchers to insert a new
piece of DNA or an entire gene. This method is known as a gene knock-in.

37. CRISPR Mechanism: How Does It Work?
Step 5. PRODUCTION OF DESIRED PROTEIN
• The new gene is now ready to produce the desired protein in the cell or in a
test tube.

38. Role of CRISPR/Cas9 in plant pathology
Production of disease resistance cultivars by editing the genome which is
responsible for susceptibility factor for fungal and bacterial diseases.
By editing the genome which governs host pathogen interaction we can
obtain incompatible interaction between host pathogen.
To improve the efficacy of bio control agents.
By editing the genome responsible for virus multiplication and virulence
we can obtain virus free resistance cultivars.

39. The Genome-editing Era: State of The Art and Perspectives for the
Management of Plant Diseases
 There are several strategies for researching plant disease resistance via the CRISPR/Cas
system:
i. knock-out of susceptibility factor encoding genes.
ii. deletion, modification, or introduction of cis-elements in promoters .
iii. introducing specific mutations in coding regions.
iv. alteration of amino acids in plant surface receptor proteins for evasion of secreted pathogen
effectors.
v. knock-out of negative regulators of plant defence responses.
vi. modification of central regulators of defense response .

40. Virus Resistance via CRISPR/Cas
 The virus genome is replicated through a rolling-circle amplification mechanism via a dsDNA replicative form (Hanley-
Bowdoin et al., 2013).
 Two recent works have also employed a CRISPR/Cas9 approach for achieving resistance to begomoviruses (Ali et al., 2015,
2016). The strategy of expressing the CRISPR/Cas9 system in the host cell nucleus to target and cleave the virus genome
during replication.
 Protection against RNA viruses has seemed more difficult to achieve, since the classical SpCas9 from Streptococcus pyogenes
only recognizes dsDNA. However, the search for and characterization of related nucleases has led to the discovery of enzymes
that can bind to and cut RNA, such as FnCas9 from Francisella novicida.
 The researchers have generated CRISPR mediated editing of host susceptible genes for developing viral resistance in plants. The
viral protein of potyviruses directly binds to eIF4E and completes its life cycle. Mutated eIF4E diminish the viral ability to
interact with host proteins and arrest the translation of the viral genome.
 Site-specific DSB through CRISPR/Cas has opened up new dimension in targeting eIF4E for achieving complete resistance
against RNA based turnip mosaic virus (TuMV) in Arabidopsis (Pyott et al., 2016).

41. Resistance to Fungi Through CRISPR/Cas
Several strategies have been evolved to enhance fungal resistance in plant species based on the
current knowledge of molecular mechanisms implicated in plant-pathogen interaction. Potential
candidate genes and gene products involved in plant resistance against fungi have been described,
and nowadays these are prime targets for editing through the CRISPR/Cas9 approach.
Fister et al., (2018) reported for the first time the introduction of CRISPR/Cas9 components into
cacao leaves targeting the Non-Expressor of Pathogenesis-Related 3 (NPR3) gene, a suppressor
of the immune system, and obtained leaves with increased resistance to Phytophthora tropicalis.
1map mutants of F. graminearum showed two-fold reduction of mycotoxin production and were
unable to produce perithecia as well as to penetrate in wheat tissues (Urban et al., 2003).

42. Resistance to Bacteria Through CRISPR/Cas

48. • CRISPR mediated transgene free ‘Tomelo’ generated by deleting 48 bp
region from SlMLO1 locus and the resulted plants acquired resistance to
powdery mildew pathogen Oidium neolycopersici without affecting
phenotypic features and yield parameters (Nekrasov et al., 2017).
Leaves of tomato plants inoculated with Oidium neolycopersici (5 weeks post inoculation)

50. Case Study

56. Fusarium head blight losses yield derives from sterility of infected florets,
grain quality reduction is mainly due to the accumulation of
trichothecenes—coded by the fungal tri genes cluster—highly toxic for
humans and animals.
 In this studied, the author knocked-out 1tri5 and 1tri6 mutants of F.
graminearum were unable to spread the disease to the adjacent spikelets and
grains on wheat and corn, respectively, and also induced plant defense
responses.

58. The technology faces two major issues
The first issues is a philosophical dilemma. Its centres on the extent to which CRISPR Cas
should be used to alter germ line cells eggs & sperm which is responsible for passing genes
to the next generation. While it will take many year before the technology will be viable to
use to create design babies. So great is the fear that some scientist, including some who
helped pioneers CRISPR Cas9, have called for a moratorium on its use in germ-line cells.
 The second issue is one of safety. One of the major problems is that the technology is still
needs a lot of work to increase its accuracy and make sure that changes made in one part of
the genome do not introduce changes elsewhere which could have unforeseen
consequence.

59. Another critical issues is that once an organism such as a plant or insect, is
modified they are difficult to distinguish from the wild type and one released
into the environment could endanger biodiversity.
In another study, the CRISPR mediated MLO mutation in barley exhibited
resistance to powdery mildew (Blumeria graminis f. sp. hordei) but it
enhanced the susceptibility to rice blast fungus M. grisea.

60. Future prospects
 In an era marked by political and societal pressure to reduce the use of pesticides, crop protection by genetic improvement
provides a promising alternative with no obvious impact on human health or the environment
 The availability of novel or the improvement of known techniques that are safer for people and the environment is of
outmost importance to guarantee food safety and security especially in those countries where famine is still an important
issue (Vurro et al., 2010).
 A novel technique that allows the production of precise knock-out mutants without the insertion of foreign DNA in a
saprotrophic/pathogenic fungus opens new possibilities of controlling plant pathogens.
 The use of such edited fungal strains needs a correct strategy to minimize possible risks.
 CRISPR tool can revolutionize the next generation agriculture by exploring the possibilities of the targeted crop species,
boost its resistance towards vulnerable pests, pathogens, consistency of productivity, abiotic stress tolerance, and enhance
nutritional efficiency (Ahmad et al., 2020). This technology may become next generation disease management tool for
sustainable crop improvement and next green revolution.

61. Acknowledgements
I would like to express my special thanks of gratitude to
Dr. A. L. Yadav Sir for their able guidance and support
and my classmate for provide internet service in complete
my presentation.
I gratefully acknowledge the use of some very important
information and photographs given in different review
paper written by Lander, E. S., 2016 ; Borrelli et al., 2018
and Munoz et al., 2019 and other researchers.