The document discusses topics to be covered in an IICB course on 8th December 2012, including primer designing, restriction mapping, and gene prediction. It provides information and guidelines on these topics, such as the appropriate length and properties of primers, the four types of restriction enzymes, and methods for gene prediction including patterns, frame consistency, dicodon frequencies, position-specific scoring matrices, and coding potential. Relevant references and websites discussing these techniques are also listed.
This document discusses powder X-ray diffraction (XRD), including Miller indices for describing crystal planes, Bragg's law relating diffraction and plane spacing, systematic absences due to crystal structure, determining structure from XRD patterns, and applications and limitations of the technique. Key components of an XRD diffractometer are described. The process of indexing diffraction patterns to determine the unit cell type and parameters is outlined.
This document discusses various ethical issues in scientific research, including intellectual honesty, research integrity, scientific misconduct such as falsification and plagiarism. It addresses principles like duty to society, informed consent, and protecting research participants. Forms of problematic publishing are defined, like duplicate/overlapping publications and "salami slicing" research. Selective reporting or misrepresenting data to bias results undermines reproducibility. Upholding integrity requires monitoring at the individual researcher, work group and institutional levels.
COPE Asia-Pacific Workshop 2018 will feature an interactive cases workshop on publication ethics. The agenda includes an introduction to COPE, case presentations, table discussions of the cases, and a review of the cases. COPE promotes integrity in research and publication by assisting editors through policies and practices reflecting transparency and integrity principles. COPE describes its core practices for preserving scholarly integrity. The workshop will use real cases submitted to COPE's forum to demonstrate how editors can handle ethics issues like authorship disputes, plagiarism allegations, and data manipulation claims. Attendees will discuss potential responses to each case in small groups.
We generally face problem in differentiating b/w autodock 4 and vina, here I tried to compare both and also provided the reliable reference links for persual
1) The document discusses various methods for determining the 3D structure of proteins, including x-ray crystallography, NMR spectroscopy, and cryo-electron microscopy.
2) X-ray crystallography involves purifying the protein, crystallizing it, collecting diffraction data from x-rays hitting the crystal, using this data to determine phases and calculate an electron density map, and building an atomic model through refinement.
3) NMR spectroscopy involves dissolving the purified protein and using nuclear magnetic resonance to measure distances between atomic nuclei, allowing the structure to be calculated.
This is a presentation I gave to the Research Coordinators in the Federal Ministry of Health, Sudan (04.03.2015).
It included the following topics:
• Overview on the Knowledge Management Cycle and how research fits in it
• Brief historical background on research ethics
• What makes research ethical?
• Definition and examples of scientific misconduct
• How to make your research ethical and avoid scientific misconduct?
Computer-aided drug design (CADD) uses computational methods to simulate drug-receptor interactions and has reduced drug research duration by at least 5 years. CADD techniques rely on bioinformatics tools, databases, and applications. Quantitative structure-activity relationship (QSAR) modeling correlates compound structural properties with biological activities and has provided a basis for optimizing ligand molecules to improve activity. CADD approaches include structure-based modeling using protein-ligand docking and ligand-based modeling analyzing statistical relationships between ligand structural groups and biological effects.
This document provides information about Bragg's law, which was introduced by Sir W. H. Bragg and his son Sir W. L. Bragg. Bragg's law correlates the X-ray wavelength, interplanar spacing of a crystal lattice, and reflection angle, stating that diffraction will occur when the path difference between reflected waves is equal to an integer multiple of the wavelength. The key equation is given as nλ = 2d sinθ, where n is a positive integer, λ is the X-ray wavelength, d is the distance between lattice planes, and θ is the incident angle. Examples are provided of how Bragg's law applies to cubic crystals.
This document discusses powder X-ray diffraction (XRD), including Miller indices for describing crystal planes, Bragg's law relating diffraction and plane spacing, systematic absences due to crystal structure, determining structure from XRD patterns, and applications and limitations of the technique. Key components of an XRD diffractometer are described. The process of indexing diffraction patterns to determine the unit cell type and parameters is outlined.
This document discusses various ethical issues in scientific research, including intellectual honesty, research integrity, scientific misconduct such as falsification and plagiarism. It addresses principles like duty to society, informed consent, and protecting research participants. Forms of problematic publishing are defined, like duplicate/overlapping publications and "salami slicing" research. Selective reporting or misrepresenting data to bias results undermines reproducibility. Upholding integrity requires monitoring at the individual researcher, work group and institutional levels.
COPE Asia-Pacific Workshop 2018 will feature an interactive cases workshop on publication ethics. The agenda includes an introduction to COPE, case presentations, table discussions of the cases, and a review of the cases. COPE promotes integrity in research and publication by assisting editors through policies and practices reflecting transparency and integrity principles. COPE describes its core practices for preserving scholarly integrity. The workshop will use real cases submitted to COPE's forum to demonstrate how editors can handle ethics issues like authorship disputes, plagiarism allegations, and data manipulation claims. Attendees will discuss potential responses to each case in small groups.
We generally face problem in differentiating b/w autodock 4 and vina, here I tried to compare both and also provided the reliable reference links for persual
1) The document discusses various methods for determining the 3D structure of proteins, including x-ray crystallography, NMR spectroscopy, and cryo-electron microscopy.
2) X-ray crystallography involves purifying the protein, crystallizing it, collecting diffraction data from x-rays hitting the crystal, using this data to determine phases and calculate an electron density map, and building an atomic model through refinement.
3) NMR spectroscopy involves dissolving the purified protein and using nuclear magnetic resonance to measure distances between atomic nuclei, allowing the structure to be calculated.
This is a presentation I gave to the Research Coordinators in the Federal Ministry of Health, Sudan (04.03.2015).
It included the following topics:
• Overview on the Knowledge Management Cycle and how research fits in it
• Brief historical background on research ethics
• What makes research ethical?
• Definition and examples of scientific misconduct
• How to make your research ethical and avoid scientific misconduct?
Computer-aided drug design (CADD) uses computational methods to simulate drug-receptor interactions and has reduced drug research duration by at least 5 years. CADD techniques rely on bioinformatics tools, databases, and applications. Quantitative structure-activity relationship (QSAR) modeling correlates compound structural properties with biological activities and has provided a basis for optimizing ligand molecules to improve activity. CADD approaches include structure-based modeling using protein-ligand docking and ligand-based modeling analyzing statistical relationships between ligand structural groups and biological effects.
This document provides information about Bragg's law, which was introduced by Sir W. H. Bragg and his son Sir W. L. Bragg. Bragg's law correlates the X-ray wavelength, interplanar spacing of a crystal lattice, and reflection angle, stating that diffraction will occur when the path difference between reflected waves is equal to an integer multiple of the wavelength. The key equation is given as nλ = 2d sinθ, where n is a positive integer, λ is the X-ray wavelength, d is the distance between lattice planes, and θ is the incident angle. Examples are provided of how Bragg's law applies to cubic crystals.
RESEARCH METRICS
It is the quantitative analysis of scientific and scholarly outputs and their impacts. Research Metrics measure impact and provide insight into the influence of specific journal publications, individual articles, and authors.
Rmc0001 research publications & ethics - module 3 (5)KURMAIAHA20PHD1086
This document discusses publication ethics and responsible research practices. It provides definitions and guidelines around topics like plagiarism, authorship, peer review, and conflicts of interest. It also describes organizations that establish standards and best practices for publication, such as the Committee on Publication Ethics and the World Association of Medical Editors. Finally, it discusses issues like misconduct, causes of unethical behavior, and predatory publishers.
Investigator: A person responsible for the conduct of the study at the trial site.
Investigator is a person responsible for the rights, health and welfare of the study subjects.
Good Clinical Practice (GCP) establishes standards for clinical trials involving human subjects. It aims to protect subjects' rights and ensure quality data. Key documents like the Nuremberg Code, Declaration of Helsinki, and Belmont Report established ethical foundations. The International Conference on Harmonisation further harmonized GCP standards globally. FDA regulations implement GCP and ICH guidelines for medical device research in the US.
Dr. Vinay Kumar discusses the issues of predatory publishing and journals. He defines predatory journals as those that exploit scholars' need to publish by failing to uphold proper editorial and peer review standards while charging publication fees. This corrupts the literature and can damage researchers' careers. Warning signs of predatory journals include lack of transparency, poor English, and inclusion on blacklists. Efforts to combat predatory journals include creating white and blacklists, improving publication literacy, and the HRD ministry removing bogus journals from India's UGC list.
Violation of publication ethics can take several forms, including data manipulation, duplicate publication, simultaneous submission, plagiarism, and salami slicing. Upholding publication ethics is important to establish the integrity and credibility of scholarly research. It is the responsibility of authors to avoid fabricating or manipulating data, plagiarizing, submitting manuscripts to multiple journals simultaneously, or including guest authors who did not meaningfully contribute. Organizations like COPE and ICMJE provide guidelines to help authors, editors, and reviewers maintain high standards of ethical publication practices.
This document discusses various plagiarism detection software tools, including Turnitin, Urkund, and other open source options. It provides brief overviews of 15 popular plagiarism checking tools, focusing on their key features. The tools discussed can check documents for duplicated or copied content, often scanning billions of web pages. They generate originality reports and identify sources of non-original content to varying degrees of precision and language support. Many are available for free or at low costs.
Protein NMR spectroscopy is a technique that uses the magnetic properties of atomic nuclei to determine the physical and chemical properties of molecules. It provides detailed information about molecular structure, dynamics, reaction state, and chemical environment. NMR spectroscopy is commonly used by chemists and biochemists to investigate organic molecules. It involves placing a sample in a strong magnetic field and exposing it to radiofrequency pulses to determine the number and types of atoms in the molecule. NMR has applications in chemistry for studying chemical bonds and in medicine for imaging tissues and detecting diseases.
This document discusses constraint-based modeling of metabolic networks. It begins with an introduction to metabolism and metabolic networks. It then outlines constraint-based modeling and describes the mathematical formulation using linear programming. The research focuses on integrating metabolic and regulatory networks to model tissue-specific metabolic behavior in humans. It presents steady-state regulatory flux balance analysis as a method to find consistent metabolic and regulatory states.
X-ray diffraction spectroscopy is presented. Key points include:
- X-rays were discovered by Röntgen in 1895 and have short wavelengths produced during electron transitions.
- Bragg's law describes the conditions under which x-ray diffraction occurs from lattice planes of a crystal.
- X-ray diffraction methods like rotating crystal and powder methods are used to determine structure like lattice constants and parameters. Applications include pharmaceuticals and determining protein structure.
X-ray diffraction is a technique used to analyze the crystal structure of materials. X-rays are produced when high-energy electrons strike a metal target and are filtered and collimated to produce a monochromatic beam. When the beam hits a crystalline material, it diffracts off the planes of the crystal lattice according to Bragg's law. The diffraction pattern is unique to each material and can be used to identify unknown compounds. A diffractometer directs the x-ray beam at the sample and detects the diffracted beams to measure intensities and angles.
Computer-Aided Drug Designing (CADD) is a specialized discipline that uses computational methods to simulate drug-receptor interactions
CADD methods are heavily dependent on bioinformatics tools, applications, and databases
X-ray crystallography is a technique that uses X-ray diffraction from a crystalline sample to determine its atomic structure. Crystals cause an incident X-ray beam to diffract into specific directions, and by measuring the angles and intensities of these diffracted beams, the electron density and positions of atoms in the crystal can be deduced. Key aspects of X-ray crystallography covered include the production of X-rays, the use of crystals to fix molecular conformations, different X-ray methods like diffraction, and applications like determining the structures of proteins and DNA.
Patient safety has always been the industry’s focus during clinical trials. However, a recent spate of well-publicized patient safety issues have increased public scrutiny and the biotechnology, pharmaceutical and CRO industries' desire to improve study quality, resulting in larger, longer, more expensive trials. In this Q&A, James T. Gourzis, M.D., Ph.D., discusses issues affecting patient safety, including factors that have launched safety to the forefront; what to look for in evaluating CRO excellence; unique oncology considerations and the ramifications of the rare toxicity; optimizing the Data Monitoring Committee; budget decisions that affect patient safety and the evolution/future of FDA requirements.
1. Bioinformatics uses computer science and information technology to analyze biological data and assist with drug discovery. It helps identify drug targets and design drug candidates.
2. The drug design process involves identifying a disease target, studying compounds of interest, detecting molecular disease bases, rational drug design, refinement, and testing. Bioinformatics tools assist with each step.
3. CADD uses computational methods to simulate drug-receptor interactions and is heavily dependent on bioinformatics tools and databases. It supports techniques like virtual screening, sequence analysis, homology modeling, and physicochemical modeling to aid drug development.
This document discusses the key steps in the drug discovery process, including target identification and validation, lead identification, and lead optimization. It describes how identifying the biological target of a disease is the first step, followed by validating that target. Leads are then identified, which are compounds that show desired biological activity against the validated target. The leads undergo optimization to improve properties like potency. Methods for target identification, lead identification, and lead optimization are also outlined.
In this presentation, the speaker has covered following topics:
What is scientific conduct?
What do we mean by ethics in research? – scientific temperament –
What is Ethical behavior in research?
How to practice Ethics in publication?
On Research Metrics -
Author level metrics to journal level metrics
Research Profile Digital Platforms.
The document summarizes the contemporary method of chemically synthesizing DNA, known as the phosphoramidite method. It describes how this method works by adding nucleotides one by one in an automated DNA synthesizer using a 3' to 5' direction, opposite of natural DNA synthesis. The phosphoramidite method is widely used due to its high yield, purity, and adaptability to automated machines. Single-stranded DNA fragments are synthesized separately and then joined and ligated together to form the full length synthetic gene of interest.
Differences in DNA occur within genes, the differences have the potential to affect the function of the
gene and hence the phenotype of the individual. Genetic markers which have been used a lot in the past
include blood groups and polymorphic enzymes. We have relatively few such markers, but this has been
overcome with the advent of new types of markers. However, most molecular markers are not associated
with a visible phenotype.
RESEARCH METRICS
It is the quantitative analysis of scientific and scholarly outputs and their impacts. Research Metrics measure impact and provide insight into the influence of specific journal publications, individual articles, and authors.
Rmc0001 research publications & ethics - module 3 (5)KURMAIAHA20PHD1086
This document discusses publication ethics and responsible research practices. It provides definitions and guidelines around topics like plagiarism, authorship, peer review, and conflicts of interest. It also describes organizations that establish standards and best practices for publication, such as the Committee on Publication Ethics and the World Association of Medical Editors. Finally, it discusses issues like misconduct, causes of unethical behavior, and predatory publishers.
Investigator: A person responsible for the conduct of the study at the trial site.
Investigator is a person responsible for the rights, health and welfare of the study subjects.
Good Clinical Practice (GCP) establishes standards for clinical trials involving human subjects. It aims to protect subjects' rights and ensure quality data. Key documents like the Nuremberg Code, Declaration of Helsinki, and Belmont Report established ethical foundations. The International Conference on Harmonisation further harmonized GCP standards globally. FDA regulations implement GCP and ICH guidelines for medical device research in the US.
Dr. Vinay Kumar discusses the issues of predatory publishing and journals. He defines predatory journals as those that exploit scholars' need to publish by failing to uphold proper editorial and peer review standards while charging publication fees. This corrupts the literature and can damage researchers' careers. Warning signs of predatory journals include lack of transparency, poor English, and inclusion on blacklists. Efforts to combat predatory journals include creating white and blacklists, improving publication literacy, and the HRD ministry removing bogus journals from India's UGC list.
Violation of publication ethics can take several forms, including data manipulation, duplicate publication, simultaneous submission, plagiarism, and salami slicing. Upholding publication ethics is important to establish the integrity and credibility of scholarly research. It is the responsibility of authors to avoid fabricating or manipulating data, plagiarizing, submitting manuscripts to multiple journals simultaneously, or including guest authors who did not meaningfully contribute. Organizations like COPE and ICMJE provide guidelines to help authors, editors, and reviewers maintain high standards of ethical publication practices.
This document discusses various plagiarism detection software tools, including Turnitin, Urkund, and other open source options. It provides brief overviews of 15 popular plagiarism checking tools, focusing on their key features. The tools discussed can check documents for duplicated or copied content, often scanning billions of web pages. They generate originality reports and identify sources of non-original content to varying degrees of precision and language support. Many are available for free or at low costs.
Protein NMR spectroscopy is a technique that uses the magnetic properties of atomic nuclei to determine the physical and chemical properties of molecules. It provides detailed information about molecular structure, dynamics, reaction state, and chemical environment. NMR spectroscopy is commonly used by chemists and biochemists to investigate organic molecules. It involves placing a sample in a strong magnetic field and exposing it to radiofrequency pulses to determine the number and types of atoms in the molecule. NMR has applications in chemistry for studying chemical bonds and in medicine for imaging tissues and detecting diseases.
This document discusses constraint-based modeling of metabolic networks. It begins with an introduction to metabolism and metabolic networks. It then outlines constraint-based modeling and describes the mathematical formulation using linear programming. The research focuses on integrating metabolic and regulatory networks to model tissue-specific metabolic behavior in humans. It presents steady-state regulatory flux balance analysis as a method to find consistent metabolic and regulatory states.
X-ray diffraction spectroscopy is presented. Key points include:
- X-rays were discovered by Röntgen in 1895 and have short wavelengths produced during electron transitions.
- Bragg's law describes the conditions under which x-ray diffraction occurs from lattice planes of a crystal.
- X-ray diffraction methods like rotating crystal and powder methods are used to determine structure like lattice constants and parameters. Applications include pharmaceuticals and determining protein structure.
X-ray diffraction is a technique used to analyze the crystal structure of materials. X-rays are produced when high-energy electrons strike a metal target and are filtered and collimated to produce a monochromatic beam. When the beam hits a crystalline material, it diffracts off the planes of the crystal lattice according to Bragg's law. The diffraction pattern is unique to each material and can be used to identify unknown compounds. A diffractometer directs the x-ray beam at the sample and detects the diffracted beams to measure intensities and angles.
Computer-Aided Drug Designing (CADD) is a specialized discipline that uses computational methods to simulate drug-receptor interactions
CADD methods are heavily dependent on bioinformatics tools, applications, and databases
X-ray crystallography is a technique that uses X-ray diffraction from a crystalline sample to determine its atomic structure. Crystals cause an incident X-ray beam to diffract into specific directions, and by measuring the angles and intensities of these diffracted beams, the electron density and positions of atoms in the crystal can be deduced. Key aspects of X-ray crystallography covered include the production of X-rays, the use of crystals to fix molecular conformations, different X-ray methods like diffraction, and applications like determining the structures of proteins and DNA.
Patient safety has always been the industry’s focus during clinical trials. However, a recent spate of well-publicized patient safety issues have increased public scrutiny and the biotechnology, pharmaceutical and CRO industries' desire to improve study quality, resulting in larger, longer, more expensive trials. In this Q&A, James T. Gourzis, M.D., Ph.D., discusses issues affecting patient safety, including factors that have launched safety to the forefront; what to look for in evaluating CRO excellence; unique oncology considerations and the ramifications of the rare toxicity; optimizing the Data Monitoring Committee; budget decisions that affect patient safety and the evolution/future of FDA requirements.
1. Bioinformatics uses computer science and information technology to analyze biological data and assist with drug discovery. It helps identify drug targets and design drug candidates.
2. The drug design process involves identifying a disease target, studying compounds of interest, detecting molecular disease bases, rational drug design, refinement, and testing. Bioinformatics tools assist with each step.
3. CADD uses computational methods to simulate drug-receptor interactions and is heavily dependent on bioinformatics tools and databases. It supports techniques like virtual screening, sequence analysis, homology modeling, and physicochemical modeling to aid drug development.
This document discusses the key steps in the drug discovery process, including target identification and validation, lead identification, and lead optimization. It describes how identifying the biological target of a disease is the first step, followed by validating that target. Leads are then identified, which are compounds that show desired biological activity against the validated target. The leads undergo optimization to improve properties like potency. Methods for target identification, lead identification, and lead optimization are also outlined.
In this presentation, the speaker has covered following topics:
What is scientific conduct?
What do we mean by ethics in research? – scientific temperament –
What is Ethical behavior in research?
How to practice Ethics in publication?
On Research Metrics -
Author level metrics to journal level metrics
Research Profile Digital Platforms.
The document summarizes the contemporary method of chemically synthesizing DNA, known as the phosphoramidite method. It describes how this method works by adding nucleotides one by one in an automated DNA synthesizer using a 3' to 5' direction, opposite of natural DNA synthesis. The phosphoramidite method is widely used due to its high yield, purity, and adaptability to automated machines. Single-stranded DNA fragments are synthesized separately and then joined and ligated together to form the full length synthetic gene of interest.
Differences in DNA occur within genes, the differences have the potential to affect the function of the
gene and hence the phenotype of the individual. Genetic markers which have been used a lot in the past
include blood groups and polymorphic enzymes. We have relatively few such markers, but this has been
overcome with the advent of new types of markers. However, most molecular markers are not associated
with a visible phenotype.
This document discusses genetic markers and their uses. It defines a genetic marker as any phenotypic difference controlled by genes that can be used to study inheritance or selection of a target gene. The document lists three main types of genetic markers: morphological, biochemical, and chromosomal. It provides examples and shortcomings of each type. Genetic markers are pieces of DNA that are associated with traits and can be used to compare individuals by detecting allelic variations on chromosomes.
Pyrosequencing is a sequencing by synthesis technique that uses a luciferase enzyme system to monitor DNA synthesis. It works by adding DNA polymerase and a single nucleotide to the DNA fragments, generating pyrophosphate that is converted to light. The light is detected and identifies the nucleotide incorporated. Pyrosequencing has applications in cDNA analysis, mutation detection, re-sequencing of disease genes, and identifying single nucleotide polymorphisms and typing bacteria and viruses.
This document discusses Restriction Fragment Length Polymorphism (RFLP) analysis, which is a technique used to differentiate organisms by analyzing patterns in their DNA after digestion with restriction enzymes. RFLP analysis can be used for various applications like determining paternity, detecting mutations, and genetic mapping. The process involves digesting DNA with restriction enzymes, running the fragments on a gel, transferring the DNA to a membrane, and using probes to detect polymorphisms and produce an autoradiogram showing differences in fragment patterns. As an example, the document describes using PCR-RFLP to rapidly screen for a BRCA2 mutation by taking advantage of a restriction site change caused by the mutation.
This document discusses RFLP and VNTR analysis techniques. RFLP detects differences in DNA sequences by analyzing fragment length variations after restriction enzyme digestion. VNTRs are locations with variable numbers of short repeated sequences that can differ between individuals. The document outlines the basic methods for both, which involve restriction digestion, gel electrophoresis, and probing. It also lists their applications, which include DNA fingerprinting, genetic mapping, disease detection, and forensic analysis.
Southern, Northern, and Western blotting are techniques to detect specific biomolecules separated by gel electrophoresis. Southern blotting detects DNA using DNA probes, Northern blotting detects RNA using RNA or DNA probes, and Western blotting detects proteins using antibodies. All three techniques involve transferring the separated biomolecules from a gel to a membrane, probing with a labeled detection molecule, washing unbound probes, and detecting signals.
This document provides information about molecular marker techniques RFLP (restriction fragment length polymorphism) and RAPD (random amplified polymorphic DNA). RFLP is a non-PCR based technique that involves digesting genomic DNA with restriction enzymes, separating fragments via gel electrophoresis, and detecting variations. RAPD is a PCR-based technique that uses random primers to amplify random DNA segments, which are then separated and visualized. Both techniques can be used for genetic mapping, germplasm characterization, and other applications. Key differences between the two techniques include RFLP detecting fewer loci but being more reliable, requiring larger DNA quantities, and using species-specific probes.
A restriction map is a map of known restriction sites within a sequence of DNA. Restriction mapping requires the use of restriction enzymes. In molecular biology, restriction maps are used as a reference to engineer plasmids or other relatively short pieces of DNA, and sometimes for longer genomic DNA. There are other ways of mapping features on DNA for longer length DNA molecules, such as mapping by transduction (Bitner, Kuempel 1981).
Restriction mapping is a useful way to characterise a particular DNA molecule. It enables us to locate and isolate DNA fragments for further study and manipulation. The relative location of different restriction enzyme sites to each other are determined by enzymatic digest of the DNA with different restriction enzymes, alone and in various combinations.The digested DNA is separated by gel electrophoresis and the fragment sizes that have been generated are used to build the 'map' of sites of the fragment. The map lets us know 'where we are' in the linear DNA macromolecule.
The document describes a seminar on Random Amplified Polymorphic DNA (RAPD) markers. It defines RAPD as a type of PCR reaction that amplifies random segments of DNA using short arbitrary nucleotide primers. The document outlines the history, principle, procedure, applications, advantages, and limitations of RAPD analysis. It compares RAPD to other molecular marker techniques and concludes that RAPD is a lab technique used to amplify unknown DNA segments for analysis.
This document discusses various methods for structural annotation and gene prediction, including:
- Using patterns like dicodon frequencies, position-specific weight matrices, and coding potential to identify coding regions and translation starts.
- Scoring donor and acceptor sites of potential exons based on models of conserved motifs near splice sites.
- Calculating multiple scores like coding potential, donor score, and acceptor score for potential exons and using classifiers to distinguish true exons from non-exons.
This document discusses structural annotation and gene finding. It begins with an overview of gene prediction including coding region prediction, translation start prediction, and splice junction prediction for eukaryotic genomes. It then discusses how multiple pieces of information can be combined for gene prediction. Popular gene prediction programs are also listed. The document goes on to discuss the basic ideas of pattern recognition as they apply to gene finding through learning coding versus non-coding regions. It describes gene structures such as open reading frames and reading frame consistency. The use of codon and dicodon frequencies is also covered. The prediction of translation starts, splice sites, and exons is explained in detail. The challenges of gene finding are listed at the end.
The document discusses various topics related to gene prediction including primer designing, restriction mapping, and gene prediction. It provides guidelines for primer designing such as avoiding non-specific binding and dimer formation between primers. It also discusses key concepts in gene prediction such as reading frame consistency between exons, codon and dicodon frequencies that can help distinguish coding from non-coding regions, and position specific scoring matrices to predict translation start sites.
The document describes the karyotype and chromosomal analysis of the stump-tailed macaque (Macaca arctoides). It finds that stump-tailed macaques have 2n=42 chromosomes, including 6 large metacentric, 8 large submetacentric, etc. chromosomes. G-banding analysis identified 273 bands and chromosome markers. Comparisons with human chromosomes found similarities between some stump-tailed macaque and human chromosomes. The analysis improves understanding of stump-tailed macaque chromosomes and their relationship to human chromosomes.
DNA microarrays, also known as DNA chips, allow simultaneous measurement of gene expression levels for every gene in a genome. Microarrays detect messenger RNA (mRNA) or complementary DNA (cDNA). They are manufactured by amplifying individual genes using PCR and spotting them on a medium like a glass slide. When fluorescently labeled cDNA from two samples are hybridized to the array, the level of fluorescence indicates gene expression differences between the samples. Microarray data is analyzed to identify genes that are up-regulated or down-regulated under different experimental conditions.
This document appears to be summarizing survey data from 2008-2009 about the employment status of people in different regions of Mongolia.
The data is broken down by percentages of people who are employed, unemployed, or not in the labor force in each region for each year. Unemployment decreased from 2008 to 2009 in most regions. The percentage of people employed increased over this period in most regions as well.
The document contains detailed employment statistics for 14 different topics, with breakdowns by region and year.
The document discusses analyzing RNA backbone conformations using torsion angle calculations. While most residues fall within published conformer ranges, some outliers are found near structural motifs like bulges and loops. The authors aim to classify these outliers and expand the set of known conformers to better model important RNA structural features and functions.
This document summarizes novel statistical methods for genetic association studies, including those that account for population structure. It describes methods for detecting gene-gene interactions and inferring copy number variations. For interactions, it proposes using graphics processing units to efficiently search large model spaces. For copy number analysis, it presents a hidden Markov model approach to deconvolve tumor profiles from normal cell contamination. Speedups of over 100x were achieved by parallelizing the model training on a GPU.
The document discusses control charts, which are statistical tools used to detect variability, consistency, and process improvement. Control charts can observe, detect, and prevent changes in a process's behavior over time. The document includes a table of sample data consisting of measurements from 11 variables (X1-X11) taken over 30 time periods. It also includes calculations of the mean and standard deviation for each variable.
The document contains a word search puzzle with terms related to microscopes hidden within it. It also includes a "Make-A-Word" challenge to find as many words as possible from the phrase "Microscope Mania", excluding plural words formed by adding "s". The answer key reveals the hidden terms in the word search include items like "objective lenses", "stage", and "light source".
This document provides an overview of a final project report on automatically classifying different geometries of drusen in patients with age-related macular degeneration. The goal of the project was to create a graphical user interface (GUI) to automatically segment drusen and categorize the different types of drusen. The scope was to help eye examiners more quickly find and categorize drusen to speed up retinal examinations. Different methods were attempted and evaluated using a dataset of unsegmented images, and resources including literature, source code, and websites were referenced.
The document discusses several topics:
1. It outlines a multi-section structure with various subsections.
2. It presents technical information and concepts in a foreign language across many paragraphs.
3. The overall content and purpose of the document cannot be determined from the limited information provided in the summary.
The document discusses several topics:
1. It outlines a multi-section structure with numbered points and subpoints.
2. Several sections provide details on specific topics, referencing other sections and including technical terms and formulas.
3. The document has a clear organizational structure but covers complex technical concepts that would require further context to fully understand.
International Association for Food Protection Presentation PosterBenjamin Alonzo
This document describes a study that evaluated a new multiplex quantitative PCR (qPCR) assay for detecting Yersinia pestis in meat products. The study artificially contaminated hot dogs, baby food, and ground beef with low and high levels of Y. pestis. Samples were tested using both the new qPCR assay and culture methods. The qPCR assay detected Y. pestis in all samples at high levels, while detecting it in more samples at low levels compared to culture. The qPCR assay showed potential for rapid detection of Y. pestis in difficult food matrices.
Here are the steps to solve indirect proportion problems:
1) If A is indirectly proportional to B and when A = 5, B = 6:
a) k = 5/6
b) A = k/B
c) A = 5/6 when B = 3 => A = 5/18
d) A = 5/6 when B = 15 => A = 1/15
e) B = 6 when A = 1 => B = 6
f) B = -6 when A = -3 => B = -6
2) If A is indirectly proportional to B and when A = 7, B = 12:
a) k = 7/12
b) A
The PRISM semantic integration approach aims to integrate diverse datasets from The Cancer Imaging Archive by representing data using shared ontologies. This removes obstacles to combining data about the same individuals from different sources. The Arkansas Image Enterprise System (ARIES) is an instance of PRISM that integrates imaging, clinical, and cognitive data from three Parkinson's disease cohorts. Semantic representation allows linking image volumes to cognitive assessments across cohorts. Ongoing work expands data integration and develops semantic query tools.
The document describes a study that used a cognitive diagnostic model to examine the grammatical knowledge of remedial Japanese university students. 548 students took a 55-item grammar test before and after remedial or non-remedial instruction. Item analysis showed 53 items were effective diagnostically, and the test was highly reliable. While the remedial group improved their score by 6 points, the non-remedial group's score dropped by 6 points. Analysis of mastery probabilities indicated the remedial group best mastered passive voice, while the non-remedial group's mastery of comparatives did not decrease significantly.
Lee et al. (2016) Measurement and application of 3D ear images for earphone design. In Proceedings of the Human Factors and Ergonomics Society (HFES) 60th Annual Meeting.
This document contains tables of critical values for various statistical tests including the z-distribution, t-distribution, chi-square distribution, and F-distribution. The z-distribution table lists critical values for the z-test across different levels of significance. Similarly, the other tables provide critical values for t-tests, chi-square tests, ANOVA, and other statistical analyses across different degrees of freedom and significance levels.
This document describes Genome Annotator light (GAL), a tool for genome analysis and visualization. GAL integrates genome annotation, comparative genomics, and visualization features into a single virtual machine. It uses a MySQL database with a schema based on the Genome Unified Schema. The front end is built with Perl, CGI, GD, PHP, JavaScript, and Ajax. GAL can annotate genomes with varying levels of data, from simple fasta files to fully annotated genomes. It visualizes genomes through features like a genome browser, gene details pages, and synteny viewers. GAL has been implemented on oomycete and cyanobacterial genomes.
This document summarizes the assembly of the Phytophthora ramorum genome using PacBio long reads. It describes the error correction and assembly process for two P. ramorum strains, Pr102 and ND886. For Pr102, multiple assembly versions (V1-V5) were generated using different error correction and assembly protocols. The V5 assembly resulted in fewer scaffolds, larger size, and fewer gaps compared to previous versions. For ND886, PacBio reads were error corrected and assembled. Both assemblies captured more repetitive elements compared to previous Sanger-based assemblies. Gene predictions were also improved in number and quality.
This document discusses motifs, which are nucleotide or amino acid sequence patterns associated with biological functions. It defines motifs, patterns, and profiles. Motifs are conserved regions, patterns are qualitative expressions, and profiles are quantitative representations. It discusses tools for de novo prediction of motifs like MEME and resources for motif discovery. Finally, it provides examples of motifs, patterns, and building position specific scoring matrices from sample sequences.
The document discusses various types of biological databases including sequence databases, structure databases, genome databases, and model organism databases. It provides examples of nucleotide databases like Genbank, DDBJ, EMBL-EBI, and TIGR. Genome browsers like UCSC Genome Browser, Ensembl browser, and Integrated Genome Browser are also mentioned. Other topics covered include the Encyclopedia of Life, India Biodiversity, Barcode of Life, data retrieval schemes, bibliographic databases, and database journals.
This document outlines the schedule and topics for a class on SNPs and gene expression. The class will have 6 sessions, with groups of 2 students presenting on selected papers in each session. Topics to be covered include an introduction to terminology like forward and reverse genetics; how often SNPs occur in the general population; databases of SNPs like dbSNP and haplotype projects like HapMap; gene expression analysis using microarrays; and experimental design, data analysis, and visualization techniques for microarray data. Papers for each group to present on are also listed. The next class will involve discussing one particular paper on SNPs.
The document provides information about performing chi-square tests and choosing appropriate statistical tests. It discusses key concepts like the null hypothesis, degrees of freedom, and expected versus observed values. Examples are provided to illustrate chi-square tests for goodness of fit and comparison of proportions. The document also compares parametric and non-parametric tests, providing examples of when each would be used.
This document summarizes information from several genomics and bioinformatics research groups and projects. It discusses:
- The ENCODE project and its focus areas including databases, data mining, visualization, transcriptomics, alternative splicing, sequencing pipelines, comparative genomics, epigenomics, and population genomics.
- Tools and databases for variant analysis from the 1000 Genomes Project and FORGE Consortium.
- The Genome Modeling System from The Genome Institute at Washington University for analyzing TCGA, ICGC, 1000 Genomes, and PCGP data.
- Using RNA-seq technology to reveal the transcriptome and methods for isolating translated mRNA.
- Resources for analyzing Human Microbiome Project data
The chi-square test is used to determine if an observed distribution of data differs from the distribution expected if the null hypothesis is true. It requires a contingency table of observed and expected frequencies, a probability value, and degrees of freedom. The chi-square test calculates a test statistic to determine if any difference is statistically significant or likely due to chance. Examples show applying the chi-square test to genetics data on tall and dwarf pea plants and to the distribution of sixes rolled in dice.
This document discusses the development of a new lightweight version of the Eumicrobedb database called Transcriptomicsdb. The new version reduces the database size and dependencies by decreasing the number of tables and views from 329 to 37 and 127 to 18 respectively in Eumicrobedb-Oracle. It also improves query time from 10 seconds to 1.2 seconds and reduces genome upload time from 12-14 hours to 2 hours. The document describes how the new database will help laboratories with limited hosting facilities to store and analyze sequencing data. It notes that the source code will soon be released to allow others to replicate the database without needing an Oracle license and various bioinformatics packages.
Pharmacogenetics refers to how genetic differences affect individuals' responses to drugs. It influences different metabolic pathways and is responsible for over 106,000 deaths annually in the US. Certain genetic mutations can determine how effectively drugs are processed in the body. Microarrays are DNA chips that allow researchers to analyze large numbers of genes simultaneously, helping to identify genetic factors influencing drug responses and diseases.
Many diseases are caused by genetic mutations. Over 4000 diseases are linked to altered genes, including heart disease, cancer, autoimmune disorders, and diabetes. Specific mutations are associated with certain cancers, such as mutations in the RB1 and BRCA1 genes which can lead to retinoblastoma and breast cancer respectively. Large-scale projects like the Cancer Genome Atlas and ENCODE project aim to catalogue all mutations in cancers and across the human genome. Immunogenetics research examines the genetic links to immune-related disorders. The HapMap and 1000 Genomes projects studied genetic variants and helped map human genetic diversity.
This document discusses genomics and genome sequencing. It provides an overview of the history of genome sequencing including early organisms sequenced like bacteriophage. It describes how genomes are sequenced through library construction, cloning, and strategies like Sanger sequencing. Applications of genome sequencing are also mentioned such as predicting genes, studying genome organization and evolution, and understanding the genetic basis of disease.
The document discusses several topics related to biodiversity databases and identification tools:
- The Encyclopedia of Life is a collaborative effort to bring together information about 1.9 million named species on the internet freely.
- 17 countries contain 70% of global biodiversity and are considered "megadiverse."
- The Barcode of Life project uses DNA barcoding to identify species using markers like COI for animals, ITS for fungi, and rbcL and matK for plants.
- GenBank and related NCBI databases like PubMed, Nucleotide, and Protein are important tools for depositing and retrieving sequence data using services like ESearch and ESummary.
The document discusses the history and process of genome sequencing, as well as several important genome projects such as the Human Genome Project. It also examines the role of databases in genomic research, describing different types of biological databases and how they can be used to store, organize, and retrieve genomic data. Finally, it provides examples of popular databases and genome browsers that are widely used by researchers.
This document provides an overview of genome sequencing. It discusses the history of genome sequencing, from early sequencing of small viruses in the 1970s to larger genomes like yeast and the human genome. The document outlines different sequencing technologies over time, from Sanger sequencing to newer single-molecule approaches. It also summarizes key genome projects like ENCODE and 1000 Genomes that have provided insights into non-coding regulatory elements and human genetic variation.
A consortium of 440 scientists from 32 laboratories characterized functional elements in the human genome as part of the ENCyclopedia Of DNA Elements (ENCODE) project. They found that 80% of the genome is biochemically active, with millions of regulatory elements such as promoters, enhancers, and insulators. Many of these elements interact with genes over long distances to control gene expression. This study significantly changes understanding of how the genome works.
This document discusses oomycete genomics research that has been funded by the National Science Foundation, USDA CSREES, and USDA NIFA from 2007-2016. Over 120 destructive oomycete pathogen species have been studied, including the genera Phytophthora and Hyaloperonospora. The genomes of several Phytophthora species have been sequenced, with efforts underway to sequence all species through a new initiative with BGI. Comparisons between sequenced oomycete genomes show both conserved and unique genes. Effector genes associated with disease are located in repeat-rich regions of genomes and have expanded through evolution.
The document discusses past, present, and future work on oomycete genomics. In the past, genome comparisons found conserved gene order and effector genes associated with repeats. The P. sojae genome is being finished using new sequencing methods. In the future, sequencing capacity is rapidly improving which will enable more oomycete genomes to be sequenced cheaply.
Level 3 NCEA - NZ: A Nation In the Making 1872 - 1900 SML.pptHenry Hollis
The History of NZ 1870-1900.
Making of a Nation.
From the NZ Wars to Liberals,
Richard Seddon, George Grey,
Social Laboratory, New Zealand,
Confiscations, Kotahitanga, Kingitanga, Parliament, Suffrage, Repudiation, Economic Change, Agriculture, Gold Mining, Timber, Flax, Sheep, Dairying,
🔥🔥🔥🔥🔥🔥🔥🔥🔥
إضغ بين إيديكم من أقوى الملازم التي صممتها
ملزمة تشريح الجهاز الهيكلي (نظري 3)
💀💀💀💀💀💀💀💀💀💀
تتميز هذهِ الملزمة بعِدة مُميزات :
1- مُترجمة ترجمة تُناسب جميع المستويات
2- تحتوي على 78 رسم توضيحي لكل كلمة موجودة بالملزمة (لكل كلمة !!!!)
#فهم_ماكو_درخ
3- دقة الكتابة والصور عالية جداً جداً جداً
4- هُنالك بعض المعلومات تم توضيحها بشكل تفصيلي جداً (تُعتبر لدى الطالب أو الطالبة بإنها معلومات مُبهمة ومع ذلك تم توضيح هذهِ المعلومات المُبهمة بشكل تفصيلي جداً
5- الملزمة تشرح نفسها ب نفسها بس تكلك تعال اقراني
6- تحتوي الملزمة في اول سلايد على خارطة تتضمن جميع تفرُعات معلومات الجهاز الهيكلي المذكورة في هذهِ الملزمة
واخيراً هذهِ الملزمة حلالٌ عليكم وإتمنى منكم إن تدعولي بالخير والصحة والعافية فقط
كل التوفيق زملائي وزميلاتي ، زميلكم محمد الذهبي 💊💊
🔥🔥🔥🔥🔥🔥🔥🔥🔥
Elevate Your Nonprofit's Online Presence_ A Guide to Effective SEO Strategies...TechSoup
Whether you're new to SEO or looking to refine your existing strategies, this webinar will provide you with actionable insights and practical tips to elevate your nonprofit's online presence.
How Barcodes Can Be Leveraged Within Odoo 17Celine George
In this presentation, we will explore how barcodes can be leveraged within Odoo 17 to streamline our manufacturing processes. We will cover the configuration steps, how to utilize barcodes in different manufacturing scenarios, and the overall benefits of implementing this technology.
A Visual Guide to 1 Samuel | A Tale of Two HeartsSteve Thomason
These slides walk through the story of 1 Samuel. Samuel is the last judge of Israel. The people reject God and want a king. Saul is anointed as the first king, but he is not a good king. David, the shepherd boy is anointed and Saul is envious of him. David shows honor while Saul continues to self destruct.
This presentation was provided by Rebecca Benner, Ph.D., of the American Society of Anesthesiologists, for the second session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session Two: 'Expanding Pathways to Publishing Careers,' was held June 13, 2024.
4. Primer Designing
No non-specific binding
Melting temperature
Should not be forming dimers with itself or other
primers.
5. Some thoughts
1. primers should be 17-28 bases in length;
2. base composition should be 50-60% (G+C);
3. primers should end (3') in a G or C, or CG or GC: this prevents
"breathing" of ends and increases efficiency of priming;
4. Tms between 55-80oC are preferred;
5. 3'-ends of primers should not be complementary (ie. base
pair), as otherwise primer dimers will be synthesised
preferentially to any other product;
6. primer self-complementarity (ability to form 2o structures
such as hairpins) should be avoided;
7. runs of three or more Cs or Gs at the 3'-ends of primers may
promote mispriming at G or C-rich sequences (because of
stability of annealing), and should be avoided.
Adapted from: Innis and Gelfand,1991
7. Restriction Analysis
Found in Bacteria and archea.
4 types
Type -1: cleavage remote to recognition site (methylase
activity)
Type-2: cleavage within a specific distance
Type-3: Cleavage within a short distance
Type-4: Cleaves modified DNA (methylated)
Ref: http://insilico.ehu.es/restriction/long_seq/
http://molbiol-tools.ca/Restriction_endonuclease.htm
8. Gene Prediction
Patterns
Frame Consistency
Dicodon frequencies
PSSMs
Coding Potential and Fickett’s statistics
Fusion of Information
Sensitivity and Specificity
Prediction programs
Known problems
10. Gene Prediction Methods
Common sets of rules
Homology
Ab initio methods
Compositional information
Signal information
11. Pattern Recognition in Gene
Finding
atgttggacagactggacgcaagacgtgtggatgaactcgttttggagctgaac
aaggctctatacgtacttaatcaagcggggcgtttgtggagcgagt
tacttcacaaaaagctagccaatttgggttcaatgcagtgcctgaccgacatggg
tatgtattagtaacgtttggaagaagaaactgttgtggttggtgt
ttatgcagacaatctacaggtgactgcaacgaattcaactctcgtggacagttttt
tcgttgatttacaggacctctcggtaaaggactatgaagaggtg
acaaaattcttggggatgcgcatttcttatgcgcctgaaaatgggtatgattatat
atcgagaagtgacaacccgggaaatgataaaggataa
atggagaggatgctggagacggtcaagacgaccatcacccctgcgcaggcaatgaag
ctgtttactgcacccaaagaacctcaagcgaacctggcccgag
cacttcatgtacttggtggccatctcggaggcctgcggtggtacttagtcctgaataacg
tcgtgccgtacgcgtccgcggatctacgaacggtcctgat
agccaaagtggacggcacgcgtgtcgactacctacagcaagctgaggaactggcgca
tttcgcgcaatcctgggagcttgaagcgcgcacgaagaacatt
We need to study the basic structures of genes first ….!
12. Gene Structure – Common sets of
rules
• Generally true: all long (> 300 bp) orfs in prokaryotic genomes
encode genes
But this may not necessarily be true for eukaryotic genomes
• Eukaryotic introns begin with GT and end with AG(donor and
acceptor sites)
– CT(A/G)A(C/T) 20-50 bases upstream of acceptor site.
13. Gene Structure
Each coding region (exon or whole gene) has a fixed
translation frame
A coding region always sits inside an ORF of same
reading frame
All exons of a gene are on the same strand.
Neighboring exons of a gene could have different
reading frames .
Exons need to be Frame consistent!
GATGGGACGACAGATAAGGTGATAGATGGTAGGCAGCAG
0 3 6 9 12 01
14. Gene Structure – reading frame consistency
Neighboring exons of a gene should be frame-consistent
Frame 0 Frame 2
GATGGGACGACAGATAGGTGATTAAGATGGTAGGCCGAGTGGTC
1 16 33
GATGGGACGACAGATAGGTGATTAAGATGGTAGGCCGAGTGGTC
1 16 40
Frame 0
Frame 2
Exon1 (1,16) -> Frame = a = 0 ; i = 1 and j = 16
Case1: Exon2 (33,100): Frame = b = 2; m = 33 and n = 100
Case2: Exon2 (40,100): Frame = b = 2; m = 40 and n =100
exon1 (i, j) in frame a and exon2 (m, n) in frame b are consistent if
b = (m - j - 1 + a) mod 3
12/7/2012
…31,34,37,40,43,46,49,52…
15. Codon Frequencies
Coding sequences are translated into protein sequences
We found the following – the dimer frequency in protein sequences is
NOT evenly distributed
Organism specific!!!!!!!!!!!
The average frequency is ¼% (1/20
* 1/20 = 1/400 = ¼%)
Some amino acids prefer to be next
to each other
Some other amino acids prefer to
be not next to each other
18. Dicodon Frequencies
Believe it or not – the biased (uneven) dimer frequencies are the
foundation of many gene finding programs!
Basic idea – if a dimer has lower than average dimer frequency; this
means that proteins prefer not to have such dimers in its sequence;
Hence if we see a dicodon encoding this dimer, we may
want to bet against this dicodon being in a coding
region!
19. Dicodon Frequencies - Examples
Relative frequencies of a di-codon in coding versus non-coding
frequency of dicodon X (e.g, AAAAAA) in coding region, total number of occurrences of
X divided by total number of dicocon occurrences
frequency of dicodon X (e.g, AAAAAA) in noncoding region, total number of
occurrences of X divided by total number of dicodon occurrences
In human genome, frequency of dicodon “AAA AAA” is
~1% in coding region versus ~5% in non-coding region
Question: if you see a region with many “AAA AAA”,
would you guess it is a coding or non-coding region?
20. Basic idea of gene finding
Most dicodons show bias towards either coding or non-coding
regions; only fraction of dicodons is neutral
Foundation for coding region identification
Regions consisting of dicodons that mostly tend
to be in coding regions are probably coding
regions; otherwise non-coding regions
Dicodon frequencies are key signal used for coding region
detection; all gene finding programs use this information
21. Prediction of Translation Starts Using PSSM
Certain nucleotides prefer to be in certain position around start
“ATG” and other nucleotides prefer not to be there 75,100, 75 ATG
TCTAGAAGATGGCAGTGGCGAAGA
A 0,0,0,100 ,0,
TCTAGAAAATGACAGTGGCGAAGA
T 100,0,100,0,0, 25, 0, 0 ATG
TCTAGAAAATGGCAGTAGCGAAGA
G 0, 0, 0, 0, 75 ,0, 0, 25 ATG
TCTACT A AATGATAGTAGCGAAGA ATG C 0,100,0,0, 25 ,0, 0, 0 ATG
A
C
G
T
-4 -3 -2 -1 +3 +4 +5 +6
CACC ATG GC
TCGA ATG TT
The “biased” nucleotide distribution is information! It is a basis for
translation start prediction
Question: which one is more probable to be a translation start?
22. Prediction of Translation Starts
Mathematical model: Fi (X): frequency of X (A, C, G, T) in
position i
Score a string by log (Fi (X)/0.25)
CACC ATG GC TCGA ATG TT
log (58/25) + log (49/25) + log (40/25) + log (6/25) + log (6/25) + log (15/25) + log
log (50/25) + log (43/25) + log (39/25) = (15/25) + log (13/25) + log (14/25) =
0.37 + 0.29 + 0.20 + 0.30 + 0.24 + 0.29 -(0.62 + 0.62 + 0.22 + 0.22 + 0.28 + 0.25)
= 1.69 = -2.54
The model captures our intuition!
A
C
G
T
12/7/2012
23. Evaluation of Gene prediction
TP FP TN FN TP
Real
Predicted
• Sensitivity = No. of Correct exons/No. of actual exons(Measurement of False
negative) -> How many are discarded by mistake
Sn = TP/TP+FN
• Specificity = No. of Correct exons/No. of predicted exons(Measurement of
False positive) -> How many are included by mistake
Sp=TP/TP+FP
• CC = Metric for combining both
(TP*TN) – (FN*FP)/sqrt( (TP+FN)*(TN+FP)*(TP+FP)*(TN+FN) )
12/7/2012
24. Challenges of Gene finder
• Alternative splicing
• Nested/overlapping genes
• Extremely long/short genes
• Extremely long introns
• Non-canonical introns
• Split start codons
• UTR introns
• Non-ATG triplet as the start codon
• Polycistronic genes
• Repeats/transposons