The document discusses various topics related to gene prediction including primer designing, restriction mapping, and gene prediction. It provides guidelines for primer designing such as avoiding non-specific binding and dimer formation between primers. It also discusses key concepts in gene prediction such as reading frame consistency between exons, codon and dicodon frequencies that can help distinguish coding from non-coding regions, and position specific scoring matrices to predict translation start sites.
This document discusses various methods for structural annotation and gene prediction, including:
- Using patterns like dicodon frequencies, position-specific weight matrices, and coding potential to identify coding regions and translation starts.
- Scoring donor and acceptor sites of potential exons based on models of conserved motifs near splice sites.
- Calculating multiple scores like coding potential, donor score, and acceptor score for potential exons and using classifiers to distinguish true exons from non-exons.
The document discusses topics to be covered in an IICB course on 8th December 2012, including primer designing, restriction mapping, and gene prediction. It provides information and guidelines on these topics, such as the appropriate length and properties of primers, the four types of restriction enzymes, and methods for gene prediction including patterns, frame consistency, dicodon frequencies, position-specific scoring matrices, and coding potential. Relevant references and websites discussing these techniques are also listed.
The document discusses using NCBI databases to design quantitative PCR (qPCR) assays. It describes several NCBI tools that can be used:
1) The NCBI Nucleotide and Gene databases to obtain sequence information for the gene of interest.
2) NCBI BLAST to perform sequence searches and check primer specificity against relevant databases.
3) NCBI dbSNP to search for single nucleotide polymorphisms (SNPs) in the primer binding sites that could affect assay performance.
The document provides guidance on how to use these NCBI tools at various steps of the qPCR assay design process.
The document discusses the history and process of genome sequencing, as well as several important genome projects such as the Human Genome Project. It also examines the role of databases in genomic research, describing different types of biological databases and how they can be used to store, organize, and retrieve genomic data. Finally, it provides examples of popular databases and genome browsers that are widely used by researchers.
The document discusses various types of biological databases including nucleotide databases, genomic databases, protein databases, and metabolic databases. It provides examples of several specific databases, such as Nucleotide databases like GenBank, genomic databases like Entrez Genome, protein databases like UniProt, and metabolic databases like KEGG. It also discusses the different levels of data in biological databases from primary data directly from experiments to secondary data that is analyzed and derived from primary data.
The document provides information about biological databases and sequence identifiers. It discusses the main objectives of biological databases which include information systems, query systems, storage systems and data. It describes primary databases like GenBank, EMBL, DDBJ, UniProt and PDB as well as secondary curated databases like RefSeq, Taxon and OMIM. It also explains different types of sequence identifiers used in databases like LOCUS, ACCESSION, VERSION, gi numbers and protein identifiers.
This document discusses various methods for structural annotation and gene prediction, including:
- Using patterns like dicodon frequencies, position-specific weight matrices, and coding potential to identify coding regions and translation starts.
- Scoring donor and acceptor sites of potential exons based on models of conserved motifs near splice sites.
- Calculating multiple scores like coding potential, donor score, and acceptor score for potential exons and using classifiers to distinguish true exons from non-exons.
The document discusses topics to be covered in an IICB course on 8th December 2012, including primer designing, restriction mapping, and gene prediction. It provides information and guidelines on these topics, such as the appropriate length and properties of primers, the four types of restriction enzymes, and methods for gene prediction including patterns, frame consistency, dicodon frequencies, position-specific scoring matrices, and coding potential. Relevant references and websites discussing these techniques are also listed.
The document discusses using NCBI databases to design quantitative PCR (qPCR) assays. It describes several NCBI tools that can be used:
1) The NCBI Nucleotide and Gene databases to obtain sequence information for the gene of interest.
2) NCBI BLAST to perform sequence searches and check primer specificity against relevant databases.
3) NCBI dbSNP to search for single nucleotide polymorphisms (SNPs) in the primer binding sites that could affect assay performance.
The document provides guidance on how to use these NCBI tools at various steps of the qPCR assay design process.
The document discusses the history and process of genome sequencing, as well as several important genome projects such as the Human Genome Project. It also examines the role of databases in genomic research, describing different types of biological databases and how they can be used to store, organize, and retrieve genomic data. Finally, it provides examples of popular databases and genome browsers that are widely used by researchers.
The document discusses various types of biological databases including nucleotide databases, genomic databases, protein databases, and metabolic databases. It provides examples of several specific databases, such as Nucleotide databases like GenBank, genomic databases like Entrez Genome, protein databases like UniProt, and metabolic databases like KEGG. It also discusses the different levels of data in biological databases from primary data directly from experiments to secondary data that is analyzed and derived from primary data.
The document provides information about biological databases and sequence identifiers. It discusses the main objectives of biological databases which include information systems, query systems, storage systems and data. It describes primary databases like GenBank, EMBL, DDBJ, UniProt and PDB as well as secondary curated databases like RefSeq, Taxon and OMIM. It also explains different types of sequence identifiers used in databases like LOCUS, ACCESSION, VERSION, gi numbers and protein identifiers.
This document discusses structural annotation and gene finding. It begins with an overview of gene prediction including coding region prediction, translation start prediction, and splice junction prediction for eukaryotic genomes. It then discusses how multiple pieces of information can be combined for gene prediction. Popular gene prediction programs are also listed. The document goes on to discuss the basic ideas of pattern recognition as they apply to gene finding through learning coding versus non-coding regions. It describes gene structures such as open reading frames and reading frame consistency. The use of codon and dicodon frequencies is also covered. The prediction of translation starts, splice sites, and exons is explained in detail. The challenges of gene finding are listed at the end.
Metagenome Sequence Assembly (CABBIO 20150629 Buenos Aires)bedutilh
This is a one-hour lecture about assembly. It is part of a one-day workshop about metagenome assembly of crAssphage, a bacteriophage virus found in human gut. The hands-on workflow can be found at http://tbb.bio.uu.nl/dutilh/CABBIO/ and should be doable in one afternoon with supervision. There is also an iPython notebook about this here: https://github.com/linsalrob/CrAPy
The document discusses sequence similarity searching and comparison. It describes how programs like BLAST and FASTA are used to rapidly identify similarities between sequences and determine evolutionary relationships. BLAST and FASTA utilize word matching and heuristics to efficiently search large databases and return local or global alignments with scoring of matches. They provide a powerful method for functions prediction by comparing new sequences to known genes and proteins.
The document discusses various bioinformatics tools and concepts. It introduces GitHub as a code hosting platform and describes control structures, lists, and dictionaries in Python. It also covers topics like regular expressions, Biopython, parsing sequences from online databases, secondary structure prediction using Chou-Fasman algorithm, and transmembrane region prediction using Kyte-Doolittle hydropathy plots.
This document discusses molecular evolution at the sequence level. It provides context on molecular evolution and defines key terms like purifying selection, neutral theory, and positive selection. It describes how the genetic code works, including synonymous and nonsynonymous substitutions. Methods for estimating substitution rates and codon usage biases are introduced. Applications of molecular evolution analysis to subjects like human/primate relationships and disease origins are also mentioned.
Generating haplotype phased reference genomes for the dikaryotic wheat strip...Benjamin Schwessinger
The document summarizes work to generate haplotype phased reference genomes for the wheat stripe rust fungus Puccinia striformis f. sp. tritici. High quality DNA was extracted and sequenced using PacBio long reads, resulting in an assembly of under 400 contigs. Mapping of the primary and associated contigs showed heterozygosity between the two dikaryotic nuclei. Future work includes repeat annotation, RNAseq mapping, sequencing additional isolates, and single nucleus sequencing to better understand the dikaryotic nature of the fungus and its success. The work aims to generate chromosomally-level assemblies of both dikaryotic nuclei.
This document discusses sequence alignment and homology. It begins by defining homology as similarities between organisms derived from a common ancestor, compared to analogous traits which evolved independently. It then discusses using sequence alignment and comparison to measure evolutionary relatedness and identify homologous sequences. The document provides examples of pairwise and multiple sequence alignments and discusses how alignment scores are calculated based on substitution matrices and log-odds ratios.
This document discusses genome sequencing and three approaches to sequencing genomes: hierarchical shotgun sequencing, shotgun sequencing, and de novo whole genome sequencing. It describes key concepts in genome assembly such as contigs, supercontigs/scaffolds, sequence coverage, and physical coverage. It also provides an example of a sequencing read.
This document provides an overview of sequence alignment and scoring matrices. It defines key terms like identity, homology, orthologous, and paralogous genes. It discusses different types of scoring matrices including unitary matrices that score matches as 1 and mismatches as 0, and transition/transversion matrices that account for the higher likelihood of transitional mutations in nucleic acids. The document emphasizes that scoring matrices represent underlying evolutionary models and influence sequence analysis outcomes.
The document provides an overview of sequence alignment concepts including:
- Definitions of terms like identity, homology, orthologous, and paralogous genes
- Examples and explanations of scoring matrices used for nucleotide and protein sequence alignments like BLOSUM and PAM matrices
- An example multiple sequence alignment of glyceraldehyde-3-phosphate dehydrogenases from different species
- Descriptions of how scoring matrices are used to quantify sequence similarity and their importance in sequence analysis
Plz I need your Help With these Question on page 1 2 3 As.pdfshreedattaagenciees2
Plz I need your Help With these Question on page 1, 2, 3 As soon As Possible
How DNA Determines Traits A distant alien planet similar to earth has been discovered. The most
popular species on the planet are called "uoieriffins".A, which are some hybrid of birds, lions, and
unicorns. ScienFsts, have recently obtained DNA samples and have mapped out 10 genes so far.
Your job as science students is to analyze the DN sequences of the yrieriffio samples to determine
which features each sample codes for. Determine which traits each type of ynigriffin has by
decoding the DNA. There are a total of 10 genes, which could be two possible versions.Before you
can decode the ONA samples you must FiRST transcribe the DNA to its complimentary mRNA
strand. Using the mRNA codons, you can configure the amino acids to determine the traits. AUG
is a start codon, and it signals the beginning of each gene. UAA is a stop codon and signals the
end of a gene. Though these start and stop codes would typically be seen at the start and end of
each and every gene, to save time we can assume they have already been translated for us. Tip:
Transcribe the all the mRNA first, then go back and translate the amino acids, and lastly determine
traits. Ulla Unigrij DNA: I CAT AGG GAG I CAAGGG TGACTT TIT | AAT AAT GAC GGG I mRNA:
LGUA UCC CUC I GUTI CCC ACU GAA.AAA UUA UUA CUG CCC aminoacids: I yalser leu I val
pro thr Glu Jysi Leu Les Leu prol traits: Iround ears I short wings Bird like scaled front legs I DNA:
ICAC CGT CGA I GTA GTA I AGA GGG CAT I TTG TAA GGA GGG GGGTGT I mRNA: IGUG
GCA GCU CAU CAUIUCU COC GLAIAAC AUU CCU CCC CCC ACAL amino acids: IVAL ALA
ela | His Hisi I Ser Pro Val I Asolle Pro Ecouece Thel traits. Llong curved beak gnay Igreen eyes
(round pupils like a mammal DNA. I CAATTG TTA CGG I AAA AGA CCC I GCC ATA ACA TIT I
mRNA: GUUAAC AAU GCCI IUUUCU GGG CGGUAUUGUAAAUnique Unigriffin DNA: I
CAGTCG IIT | ATG GGG CTT CTT IIT | GAG AAT TCACGC | mRNA: amino acids: traits: DNA: |
GGA CAACAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG | mRNA: amino
acids: traits: DNA: I TTA TIG TTACGG | AAA AGACCT | GCAGCCTTG TGT | mRNA: amino
acids: traits: Unruly Unigriffin DNA: I CATAGA TII I CAAGGATGACTTTC I GAAGAGGAGGGG I
mRNA: amino acids: traits: DNA: CAA CGC CGA | GTA TAG | CAT AAA ATA | TTG TAA GGA
GGG GGG TGT | mRNA: amino acids: traits: DNA: CAG TTA TIACGT I AAG AAA CCA | GCT
ATG ACA TIT | MRNA: amino acids: traits:Ulla Yoigriffia Unique Unigriffir: Unruly Unigris1. Where
are genes found? What does a gene do? 2. Distinguish between transcription and translation,
include where they occur. 3. List the detailed steps of protein synthesis (hint: the answer is not
initiation, elogation, and termination) a) b) c) 4. How does a ribosome know which protein to make
an dhow to make them? 5. Random mutations may occur that cause a change in the order of
nitrogen bases in a codon. One type of mutation involves the substitution of one of the nitrogen
bases in a codon. a) What amino aci.
Towards Ultra-Large-Scale System: Design of Scalable Software and Next-Gen H...Arghya Kusum Das
Recent advances in large-scale experimental facilities ushered in an era of data-driven science. These large-scale data increase the opportunity to answer many fundamental questions in basic science. However, these data pose new challenges to the scientific community in terms of their optimal processing. Consequently, scientists are in dire need of robust high-performance computing (HPC) solutions that can scale with terabytes of data.
In this talk, I will address the challenges of two major aspects of scientific big data processing: 1) Developing scalable software and algorithms for data- and compute-intensive scientific applications. 2) Proposing new cluster architectures that these applications and software tools need for good performance. In this talk, I will mainly address the challenges involved in large-scale genome analysis applications such as, genomic error correction and genome assembly which made their way to the forefront of big data challenges recently as the sequencing machines outperformed Moore's law by several magnitudes.
In the first part, I will address the challenges involved in developing scalable algorithms to process huge amounts of genomic big data using the power of recent analytic tools such as, Hadoop, Giraph, distributed NoSQL, etc. The algorithms are carefully tailored to scale over terabytes of data over hundreds of computing nodes. At a border level, these algorithms take advantage of locality-based computing for their scalability. In this aspect, I will briefly talk about my general-purpose, analytic framework for easy and rapid designing of embarrassingly parallel algorithms for massive-scale scientific data.
In the second part, I will address the challenges in designing the hardware environment that these data- and compute-intensive applications require for good performance. I will pinpoint the limitations in a traditional HPC cluster (supercomputer) to process this huge amount of big genomic data with respect to these applications and propose a solution to those limitations by balancing the storage (both I/O and memory) bandwidth, with the computational speed of high-performance CPUs. I will briefly discuss my theoretical model that can help the HPC system designers who are striving for system balance.
Many of these observations and developments are used by different hardware vendors such as, Samsung and IBM to develop or improve the configuration of their next-gen HPC clusters (e.g., Samsung’s hyper-scale computing cluster, IBM’s Power8-based supercomputer) with high-speed storage and processing power
This document discusses the process of PCR-based cloning. It explains that PCR is used to amplify a DNA sequence of interest and add restriction enzyme sites to the ends to allow for cloning into a plasmid. It provides details on designing forward and reverse primers, including adding a leader sequence, restriction site, and hybridization sequence. The document provides an example of adding EcoRI and NotI sites to a gene of interest for cloning into a recipient plasmid. It discusses factors to consider when choosing restriction enzymes and provides the specific primer sequences designed for the example.
Degenerate primers are designed from conserved amino acid sequences aligned from multiple species. They contain nucleotide degeneracies that allow binding to related gene sequences. Key steps are:
1) Identifying conserved regions over 5+ amino acids long and within 200-600 bp for primers.
2) Calculating primer degeneracy based on contributing amino acids to minimize values over 64.
3) Optimizing primers by avoiding amino acids with 6-fold degeneracy and adding 5' tails.
An Efficient Biological Sequence Compression Technique Using LUT and Repeat ...IOSR Journals
This document presents two improved biological sequence compression algorithms that utilize a lookup table (LUT) and identification of tandem repeats in sequences. The first algorithm maps all possible 3-character combinations to ASCII characters using a 125-entry LUT. The second maps all possible 4-character combinations to ASCII characters using a 256-entry LUT. These algorithms aim to achieve high compression factors, saving percentages, and faster compression/decompression times compared to previous biological sequence compression methods.
The document provides an overview of open reading frames (ORFs) and how to identify them in a nucleotide sequence using an ORF finder. It explains that an ORF is the region between a start and stop codon that could code for a protein. It then demonstrates how to use an ORF finder to analyze 6 reading frames of a sample sequence, identify ORFs in each frame based on start and stop codons, and select the longest ORF for further analysis like BLAST searching to find similar sequences.
Genetic engineering involves manipulating DNA through techniques like selective breeding, hybridization, genetic bottlenecks, inbreeding, and genetic engineering. Genetic engineering uses vectors to insert genes into host organisms. Key steps include isolating the gene, inserting it into a host using a vector, producing copies of the host, and purifying the gene product. Restriction enzymes and ligases are important tools that cut and join DNA. PCR is used to amplify DNA, and sequencing methods like Sanger sequencing determine the DNA sequence. Primer design is important for techniques like PCR, cloning, and discovery of unknown sequences through degenerate primers.
The document discusses gene regulation and structure. It provides information on how genes are regulated through transcription factors binding to DNA and responding to environmental conditions. It also describes where gene regulation occurs, such as during transcription, translation and protein modifications. Additionally, it contrasts differences between prokaryotic and eukaryotic genes and gene structure, such as the presence of introns and exons in eukaryotes. Common methods for finding genes like the use of consensus splice sites and coding bias are also summarized.
This document provides an overview of sequence alignment and scoring matrices. It defines key terms like identity, homology, orthologous, and paralogous genes. It discusses different types of scoring matrices, including unitary matrices that score matches as 1 and mismatches as 0, and transition/transversion matrices that account for the different likelihood of transition vs. transversion mutations in DNA. It explains that scoring matrices represent implicit models of evolution and influence sequence analysis outcomes. The document emphasizes that results depend critically on the chosen scoring matrix and model.
This document describes Genome Annotator light (GAL), a tool for genome analysis and visualization. GAL integrates genome annotation, comparative genomics, and visualization features into a single virtual machine. It uses a MySQL database with a schema based on the Genome Unified Schema. The front end is built with Perl, CGI, GD, PHP, JavaScript, and Ajax. GAL can annotate genomes with varying levels of data, from simple fasta files to fully annotated genomes. It visualizes genomes through features like a genome browser, gene details pages, and synteny viewers. GAL has been implemented on oomycete and cyanobacterial genomes.
This document summarizes the assembly of the Phytophthora ramorum genome using PacBio long reads. It describes the error correction and assembly process for two P. ramorum strains, Pr102 and ND886. For Pr102, multiple assembly versions (V1-V5) were generated using different error correction and assembly protocols. The V5 assembly resulted in fewer scaffolds, larger size, and fewer gaps compared to previous versions. For ND886, PacBio reads were error corrected and assembled. Both assemblies captured more repetitive elements compared to previous Sanger-based assemblies. Gene predictions were also improved in number and quality.
This document discusses structural annotation and gene finding. It begins with an overview of gene prediction including coding region prediction, translation start prediction, and splice junction prediction for eukaryotic genomes. It then discusses how multiple pieces of information can be combined for gene prediction. Popular gene prediction programs are also listed. The document goes on to discuss the basic ideas of pattern recognition as they apply to gene finding through learning coding versus non-coding regions. It describes gene structures such as open reading frames and reading frame consistency. The use of codon and dicodon frequencies is also covered. The prediction of translation starts, splice sites, and exons is explained in detail. The challenges of gene finding are listed at the end.
Metagenome Sequence Assembly (CABBIO 20150629 Buenos Aires)bedutilh
This is a one-hour lecture about assembly. It is part of a one-day workshop about metagenome assembly of crAssphage, a bacteriophage virus found in human gut. The hands-on workflow can be found at http://tbb.bio.uu.nl/dutilh/CABBIO/ and should be doable in one afternoon with supervision. There is also an iPython notebook about this here: https://github.com/linsalrob/CrAPy
The document discusses sequence similarity searching and comparison. It describes how programs like BLAST and FASTA are used to rapidly identify similarities between sequences and determine evolutionary relationships. BLAST and FASTA utilize word matching and heuristics to efficiently search large databases and return local or global alignments with scoring of matches. They provide a powerful method for functions prediction by comparing new sequences to known genes and proteins.
The document discusses various bioinformatics tools and concepts. It introduces GitHub as a code hosting platform and describes control structures, lists, and dictionaries in Python. It also covers topics like regular expressions, Biopython, parsing sequences from online databases, secondary structure prediction using Chou-Fasman algorithm, and transmembrane region prediction using Kyte-Doolittle hydropathy plots.
This document discusses molecular evolution at the sequence level. It provides context on molecular evolution and defines key terms like purifying selection, neutral theory, and positive selection. It describes how the genetic code works, including synonymous and nonsynonymous substitutions. Methods for estimating substitution rates and codon usage biases are introduced. Applications of molecular evolution analysis to subjects like human/primate relationships and disease origins are also mentioned.
Generating haplotype phased reference genomes for the dikaryotic wheat strip...Benjamin Schwessinger
The document summarizes work to generate haplotype phased reference genomes for the wheat stripe rust fungus Puccinia striformis f. sp. tritici. High quality DNA was extracted and sequenced using PacBio long reads, resulting in an assembly of under 400 contigs. Mapping of the primary and associated contigs showed heterozygosity between the two dikaryotic nuclei. Future work includes repeat annotation, RNAseq mapping, sequencing additional isolates, and single nucleus sequencing to better understand the dikaryotic nature of the fungus and its success. The work aims to generate chromosomally-level assemblies of both dikaryotic nuclei.
This document discusses sequence alignment and homology. It begins by defining homology as similarities between organisms derived from a common ancestor, compared to analogous traits which evolved independently. It then discusses using sequence alignment and comparison to measure evolutionary relatedness and identify homologous sequences. The document provides examples of pairwise and multiple sequence alignments and discusses how alignment scores are calculated based on substitution matrices and log-odds ratios.
This document discusses genome sequencing and three approaches to sequencing genomes: hierarchical shotgun sequencing, shotgun sequencing, and de novo whole genome sequencing. It describes key concepts in genome assembly such as contigs, supercontigs/scaffolds, sequence coverage, and physical coverage. It also provides an example of a sequencing read.
This document provides an overview of sequence alignment and scoring matrices. It defines key terms like identity, homology, orthologous, and paralogous genes. It discusses different types of scoring matrices including unitary matrices that score matches as 1 and mismatches as 0, and transition/transversion matrices that account for the higher likelihood of transitional mutations in nucleic acids. The document emphasizes that scoring matrices represent underlying evolutionary models and influence sequence analysis outcomes.
The document provides an overview of sequence alignment concepts including:
- Definitions of terms like identity, homology, orthologous, and paralogous genes
- Examples and explanations of scoring matrices used for nucleotide and protein sequence alignments like BLOSUM and PAM matrices
- An example multiple sequence alignment of glyceraldehyde-3-phosphate dehydrogenases from different species
- Descriptions of how scoring matrices are used to quantify sequence similarity and their importance in sequence analysis
Plz I need your Help With these Question on page 1 2 3 As.pdfshreedattaagenciees2
Plz I need your Help With these Question on page 1, 2, 3 As soon As Possible
How DNA Determines Traits A distant alien planet similar to earth has been discovered. The most
popular species on the planet are called "uoieriffins".A, which are some hybrid of birds, lions, and
unicorns. ScienFsts, have recently obtained DNA samples and have mapped out 10 genes so far.
Your job as science students is to analyze the DN sequences of the yrieriffio samples to determine
which features each sample codes for. Determine which traits each type of ynigriffin has by
decoding the DNA. There are a total of 10 genes, which could be two possible versions.Before you
can decode the ONA samples you must FiRST transcribe the DNA to its complimentary mRNA
strand. Using the mRNA codons, you can configure the amino acids to determine the traits. AUG
is a start codon, and it signals the beginning of each gene. UAA is a stop codon and signals the
end of a gene. Though these start and stop codes would typically be seen at the start and end of
each and every gene, to save time we can assume they have already been translated for us. Tip:
Transcribe the all the mRNA first, then go back and translate the amino acids, and lastly determine
traits. Ulla Unigrij DNA: I CAT AGG GAG I CAAGGG TGACTT TIT | AAT AAT GAC GGG I mRNA:
LGUA UCC CUC I GUTI CCC ACU GAA.AAA UUA UUA CUG CCC aminoacids: I yalser leu I val
pro thr Glu Jysi Leu Les Leu prol traits: Iround ears I short wings Bird like scaled front legs I DNA:
ICAC CGT CGA I GTA GTA I AGA GGG CAT I TTG TAA GGA GGG GGGTGT I mRNA: IGUG
GCA GCU CAU CAUIUCU COC GLAIAAC AUU CCU CCC CCC ACAL amino acids: IVAL ALA
ela | His Hisi I Ser Pro Val I Asolle Pro Ecouece Thel traits. Llong curved beak gnay Igreen eyes
(round pupils like a mammal DNA. I CAATTG TTA CGG I AAA AGA CCC I GCC ATA ACA TIT I
mRNA: GUUAAC AAU GCCI IUUUCU GGG CGGUAUUGUAAAUnique Unigriffin DNA: I
CAGTCG IIT | ATG GGG CTT CTT IIT | GAG AAT TCACGC | mRNA: amino acids: traits: DNA: |
GGA CAACAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG | mRNA: amino
acids: traits: DNA: I TTA TIG TTACGG | AAA AGACCT | GCAGCCTTG TGT | mRNA: amino
acids: traits: Unruly Unigriffin DNA: I CATAGA TII I CAAGGATGACTTTC I GAAGAGGAGGGG I
mRNA: amino acids: traits: DNA: CAA CGC CGA | GTA TAG | CAT AAA ATA | TTG TAA GGA
GGG GGG TGT | mRNA: amino acids: traits: DNA: CAG TTA TIACGT I AAG AAA CCA | GCT
ATG ACA TIT | MRNA: amino acids: traits:Ulla Yoigriffia Unique Unigriffir: Unruly Unigris1. Where
are genes found? What does a gene do? 2. Distinguish between transcription and translation,
include where they occur. 3. List the detailed steps of protein synthesis (hint: the answer is not
initiation, elogation, and termination) a) b) c) 4. How does a ribosome know which protein to make
an dhow to make them? 5. Random mutations may occur that cause a change in the order of
nitrogen bases in a codon. One type of mutation involves the substitution of one of the nitrogen
bases in a codon. a) What amino aci.
Towards Ultra-Large-Scale System: Design of Scalable Software and Next-Gen H...Arghya Kusum Das
Recent advances in large-scale experimental facilities ushered in an era of data-driven science. These large-scale data increase the opportunity to answer many fundamental questions in basic science. However, these data pose new challenges to the scientific community in terms of their optimal processing. Consequently, scientists are in dire need of robust high-performance computing (HPC) solutions that can scale with terabytes of data.
In this talk, I will address the challenges of two major aspects of scientific big data processing: 1) Developing scalable software and algorithms for data- and compute-intensive scientific applications. 2) Proposing new cluster architectures that these applications and software tools need for good performance. In this talk, I will mainly address the challenges involved in large-scale genome analysis applications such as, genomic error correction and genome assembly which made their way to the forefront of big data challenges recently as the sequencing machines outperformed Moore's law by several magnitudes.
In the first part, I will address the challenges involved in developing scalable algorithms to process huge amounts of genomic big data using the power of recent analytic tools such as, Hadoop, Giraph, distributed NoSQL, etc. The algorithms are carefully tailored to scale over terabytes of data over hundreds of computing nodes. At a border level, these algorithms take advantage of locality-based computing for their scalability. In this aspect, I will briefly talk about my general-purpose, analytic framework for easy and rapid designing of embarrassingly parallel algorithms for massive-scale scientific data.
In the second part, I will address the challenges in designing the hardware environment that these data- and compute-intensive applications require for good performance. I will pinpoint the limitations in a traditional HPC cluster (supercomputer) to process this huge amount of big genomic data with respect to these applications and propose a solution to those limitations by balancing the storage (both I/O and memory) bandwidth, with the computational speed of high-performance CPUs. I will briefly discuss my theoretical model that can help the HPC system designers who are striving for system balance.
Many of these observations and developments are used by different hardware vendors such as, Samsung and IBM to develop or improve the configuration of their next-gen HPC clusters (e.g., Samsung’s hyper-scale computing cluster, IBM’s Power8-based supercomputer) with high-speed storage and processing power
This document discusses the process of PCR-based cloning. It explains that PCR is used to amplify a DNA sequence of interest and add restriction enzyme sites to the ends to allow for cloning into a plasmid. It provides details on designing forward and reverse primers, including adding a leader sequence, restriction site, and hybridization sequence. The document provides an example of adding EcoRI and NotI sites to a gene of interest for cloning into a recipient plasmid. It discusses factors to consider when choosing restriction enzymes and provides the specific primer sequences designed for the example.
Degenerate primers are designed from conserved amino acid sequences aligned from multiple species. They contain nucleotide degeneracies that allow binding to related gene sequences. Key steps are:
1) Identifying conserved regions over 5+ amino acids long and within 200-600 bp for primers.
2) Calculating primer degeneracy based on contributing amino acids to minimize values over 64.
3) Optimizing primers by avoiding amino acids with 6-fold degeneracy and adding 5' tails.
An Efficient Biological Sequence Compression Technique Using LUT and Repeat ...IOSR Journals
This document presents two improved biological sequence compression algorithms that utilize a lookup table (LUT) and identification of tandem repeats in sequences. The first algorithm maps all possible 3-character combinations to ASCII characters using a 125-entry LUT. The second maps all possible 4-character combinations to ASCII characters using a 256-entry LUT. These algorithms aim to achieve high compression factors, saving percentages, and faster compression/decompression times compared to previous biological sequence compression methods.
The document provides an overview of open reading frames (ORFs) and how to identify them in a nucleotide sequence using an ORF finder. It explains that an ORF is the region between a start and stop codon that could code for a protein. It then demonstrates how to use an ORF finder to analyze 6 reading frames of a sample sequence, identify ORFs in each frame based on start and stop codons, and select the longest ORF for further analysis like BLAST searching to find similar sequences.
Genetic engineering involves manipulating DNA through techniques like selective breeding, hybridization, genetic bottlenecks, inbreeding, and genetic engineering. Genetic engineering uses vectors to insert genes into host organisms. Key steps include isolating the gene, inserting it into a host using a vector, producing copies of the host, and purifying the gene product. Restriction enzymes and ligases are important tools that cut and join DNA. PCR is used to amplify DNA, and sequencing methods like Sanger sequencing determine the DNA sequence. Primer design is important for techniques like PCR, cloning, and discovery of unknown sequences through degenerate primers.
The document discusses gene regulation and structure. It provides information on how genes are regulated through transcription factors binding to DNA and responding to environmental conditions. It also describes where gene regulation occurs, such as during transcription, translation and protein modifications. Additionally, it contrasts differences between prokaryotic and eukaryotic genes and gene structure, such as the presence of introns and exons in eukaryotes. Common methods for finding genes like the use of consensus splice sites and coding bias are also summarized.
This document provides an overview of sequence alignment and scoring matrices. It defines key terms like identity, homology, orthologous, and paralogous genes. It discusses different types of scoring matrices, including unitary matrices that score matches as 1 and mismatches as 0, and transition/transversion matrices that account for the different likelihood of transition vs. transversion mutations in DNA. It explains that scoring matrices represent implicit models of evolution and influence sequence analysis outcomes. The document emphasizes that results depend critically on the chosen scoring matrix and model.
This document describes Genome Annotator light (GAL), a tool for genome analysis and visualization. GAL integrates genome annotation, comparative genomics, and visualization features into a single virtual machine. It uses a MySQL database with a schema based on the Genome Unified Schema. The front end is built with Perl, CGI, GD, PHP, JavaScript, and Ajax. GAL can annotate genomes with varying levels of data, from simple fasta files to fully annotated genomes. It visualizes genomes through features like a genome browser, gene details pages, and synteny viewers. GAL has been implemented on oomycete and cyanobacterial genomes.
This document summarizes the assembly of the Phytophthora ramorum genome using PacBio long reads. It describes the error correction and assembly process for two P. ramorum strains, Pr102 and ND886. For Pr102, multiple assembly versions (V1-V5) were generated using different error correction and assembly protocols. The V5 assembly resulted in fewer scaffolds, larger size, and fewer gaps compared to previous versions. For ND886, PacBio reads were error corrected and assembled. Both assemblies captured more repetitive elements compared to previous Sanger-based assemblies. Gene predictions were also improved in number and quality.
This document discusses motifs, which are nucleotide or amino acid sequence patterns associated with biological functions. It defines motifs, patterns, and profiles. Motifs are conserved regions, patterns are qualitative expressions, and profiles are quantitative representations. It discusses tools for de novo prediction of motifs like MEME and resources for motif discovery. Finally, it provides examples of motifs, patterns, and building position specific scoring matrices from sample sequences.
The document discusses various types of biological databases including sequence databases, structure databases, genome databases, and model organism databases. It provides examples of nucleotide databases like Genbank, DDBJ, EMBL-EBI, and TIGR. Genome browsers like UCSC Genome Browser, Ensembl browser, and Integrated Genome Browser are also mentioned. Other topics covered include the Encyclopedia of Life, India Biodiversity, Barcode of Life, data retrieval schemes, bibliographic databases, and database journals.
This document outlines the schedule and topics for a class on SNPs and gene expression. The class will have 6 sessions, with groups of 2 students presenting on selected papers in each session. Topics to be covered include an introduction to terminology like forward and reverse genetics; how often SNPs occur in the general population; databases of SNPs like dbSNP and haplotype projects like HapMap; gene expression analysis using microarrays; and experimental design, data analysis, and visualization techniques for microarray data. Papers for each group to present on are also listed. The next class will involve discussing one particular paper on SNPs.
The document provides information about performing chi-square tests and choosing appropriate statistical tests. It discusses key concepts like the null hypothesis, degrees of freedom, and expected versus observed values. Examples are provided to illustrate chi-square tests for goodness of fit and comparison of proportions. The document also compares parametric and non-parametric tests, providing examples of when each would be used.
This document summarizes information from several genomics and bioinformatics research groups and projects. It discusses:
- The ENCODE project and its focus areas including databases, data mining, visualization, transcriptomics, alternative splicing, sequencing pipelines, comparative genomics, epigenomics, and population genomics.
- Tools and databases for variant analysis from the 1000 Genomes Project and FORGE Consortium.
- The Genome Modeling System from The Genome Institute at Washington University for analyzing TCGA, ICGC, 1000 Genomes, and PCGP data.
- Using RNA-seq technology to reveal the transcriptome and methods for isolating translated mRNA.
- Resources for analyzing Human Microbiome Project data
The chi-square test is used to determine if an observed distribution of data differs from the distribution expected if the null hypothesis is true. It requires a contingency table of observed and expected frequencies, a probability value, and degrees of freedom. The chi-square test calculates a test statistic to determine if any difference is statistically significant or likely due to chance. Examples show applying the chi-square test to genetics data on tall and dwarf pea plants and to the distribution of sixes rolled in dice.
This document discusses the development of a new lightweight version of the Eumicrobedb database called Transcriptomicsdb. The new version reduces the database size and dependencies by decreasing the number of tables and views from 329 to 37 and 127 to 18 respectively in Eumicrobedb-Oracle. It also improves query time from 10 seconds to 1.2 seconds and reduces genome upload time from 12-14 hours to 2 hours. The document describes how the new database will help laboratories with limited hosting facilities to store and analyze sequencing data. It notes that the source code will soon be released to allow others to replicate the database without needing an Oracle license and various bioinformatics packages.
Pharmacogenetics refers to how genetic differences affect individuals' responses to drugs. It influences different metabolic pathways and is responsible for over 106,000 deaths annually in the US. Certain genetic mutations can determine how effectively drugs are processed in the body. Microarrays are DNA chips that allow researchers to analyze large numbers of genes simultaneously, helping to identify genetic factors influencing drug responses and diseases.
Many diseases are caused by genetic mutations. Over 4000 diseases are linked to altered genes, including heart disease, cancer, autoimmune disorders, and diabetes. Specific mutations are associated with certain cancers, such as mutations in the RB1 and BRCA1 genes which can lead to retinoblastoma and breast cancer respectively. Large-scale projects like the Cancer Genome Atlas and ENCODE project aim to catalogue all mutations in cancers and across the human genome. Immunogenetics research examines the genetic links to immune-related disorders. The HapMap and 1000 Genomes projects studied genetic variants and helped map human genetic diversity.
This document discusses genomics and genome sequencing. It provides an overview of the history of genome sequencing including early organisms sequenced like bacteriophage. It describes how genomes are sequenced through library construction, cloning, and strategies like Sanger sequencing. Applications of genome sequencing are also mentioned such as predicting genes, studying genome organization and evolution, and understanding the genetic basis of disease.
The document discusses several topics related to biodiversity databases and identification tools:
- The Encyclopedia of Life is a collaborative effort to bring together information about 1.9 million named species on the internet freely.
- 17 countries contain 70% of global biodiversity and are considered "megadiverse."
- The Barcode of Life project uses DNA barcoding to identify species using markers like COI for animals, ITS for fungi, and rbcL and matK for plants.
- GenBank and related NCBI databases like PubMed, Nucleotide, and Protein are important tools for depositing and retrieving sequence data using services like ESearch and ESummary.
This document provides an overview of genome sequencing. It discusses the history of genome sequencing, from early sequencing of small viruses in the 1970s to larger genomes like yeast and the human genome. The document outlines different sequencing technologies over time, from Sanger sequencing to newer single-molecule approaches. It also summarizes key genome projects like ENCODE and 1000 Genomes that have provided insights into non-coding regulatory elements and human genetic variation.
A consortium of 440 scientists from 32 laboratories characterized functional elements in the human genome as part of the ENCyclopedia Of DNA Elements (ENCODE) project. They found that 80% of the genome is biochemically active, with millions of regulatory elements such as promoters, enhancers, and insulators. Many of these elements interact with genes over long distances to control gene expression. This study significantly changes understanding of how the genome works.
This document discusses oomycete genomics research that has been funded by the National Science Foundation, USDA CSREES, and USDA NIFA from 2007-2016. Over 120 destructive oomycete pathogen species have been studied, including the genera Phytophthora and Hyaloperonospora. The genomes of several Phytophthora species have been sequenced, with efforts underway to sequence all species through a new initiative with BGI. Comparisons between sequenced oomycete genomes show both conserved and unique genes. Effector genes associated with disease are located in repeat-rich regions of genomes and have expanded through evolution.
The document discusses past, present, and future work on oomycete genomics. In the past, genome comparisons found conserved gene order and effector genes associated with repeats. The P. sojae genome is being finished using new sequencing methods. In the future, sequencing capacity is rapidly improving which will enable more oomycete genomes to be sequenced cheaply.
The document discusses tools from the US DOE Joint Genome Institute (JGI) for eukaryotic genome annotation and analysis of oomycete genomes. It introduces MycoCosm, a database with over 70 annotated fungal and oomycete genomes that allows manual curation of gene models. The automated annotation pipeline and various gene prediction programs used by JGI are described briefly. The document also outlines the manual curation workflow involving validating gene structures, choosing the best model, and annotating genes.
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
Strategies for Effective Upskilling is a presentation by Chinwendu Peace in a Your Skill Boost Masterclass organisation by the Excellence Foundation for South Sudan on 08th and 09th June 2024 from 1 PM to 3 PM on each day.
Chapter wise All Notes of First year Basic Civil Engineering.pptxDenish Jangid
Chapter wise All Notes of First year Basic Civil Engineering
Syllabus
Chapter-1
Introduction to objective, scope and outcome the subject
Chapter 2
Introduction: Scope and Specialization of Civil Engineering, Role of civil Engineer in Society, Impact of infrastructural development on economy of country.
Chapter 3
Surveying: Object Principles & Types of Surveying; Site Plans, Plans & Maps; Scales & Unit of different Measurements.
Linear Measurements: Instruments used. Linear Measurement by Tape, Ranging out Survey Lines and overcoming Obstructions; Measurements on sloping ground; Tape corrections, conventional symbols. Angular Measurements: Instruments used; Introduction to Compass Surveying, Bearings and Longitude & Latitude of a Line, Introduction to total station.
Levelling: Instrument used Object of levelling, Methods of levelling in brief, and Contour maps.
Chapter 4
Buildings: Selection of site for Buildings, Layout of Building Plan, Types of buildings, Plinth area, carpet area, floor space index, Introduction to building byelaws, concept of sun light & ventilation. Components of Buildings & their functions, Basic concept of R.C.C., Introduction to types of foundation
Chapter 5
Transportation: Introduction to Transportation Engineering; Traffic and Road Safety: Types and Characteristics of Various Modes of Transportation; Various Road Traffic Signs, Causes of Accidents and Road Safety Measures.
Chapter 6
Environmental Engineering: Environmental Pollution, Environmental Acts and Regulations, Functional Concepts of Ecology, Basics of Species, Biodiversity, Ecosystem, Hydrological Cycle; Chemical Cycles: Carbon, Nitrogen & Phosphorus; Energy Flow in Ecosystems.
Water Pollution: Water Quality standards, Introduction to Treatment & Disposal of Waste Water. Reuse and Saving of Water, Rain Water Harvesting. Solid Waste Management: Classification of Solid Waste, Collection, Transportation and Disposal of Solid. Recycling of Solid Waste: Energy Recovery, Sanitary Landfill, On-Site Sanitation. Air & Noise Pollution: Primary and Secondary air pollutants, Harmful effects of Air Pollution, Control of Air Pollution. . Noise Pollution Harmful Effects of noise pollution, control of noise pollution, Global warming & Climate Change, Ozone depletion, Greenhouse effect
Text Books:
1. Palancharmy, Basic Civil Engineering, McGraw Hill publishers.
2. Satheesh Gopi, Basic Civil Engineering, Pearson Publishers.
3. Ketki Rangwala Dalal, Essentials of Civil Engineering, Charotar Publishing House.
4. BCP, Surveying volume 1
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
How to Fix the Import Error in the Odoo 17Celine George
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
Main Java[All of the Base Concepts}.docxadhitya5119
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
A review of the growth of the Israel Genealogy Research Association Database Collection for the last 12 months. Our collection is now passed the 3 million mark and still growing. See which archives have contributed the most. See the different types of records we have, and which years have had records added. You can also see what we have for the future.
2. Topics to be covered
Primer designing
Restriction mapping
Gene Prediction
3. Primer Designing
No non-specific binding
Melting temperature
Should not be forming dimers with itself or other
primers.
The temperature at which 50% of the oligonucleotide and its perfect
complement are in duplex
4. Some thoughts
1. Primers should be 17-28 bases in length;
2. Base composition should be 50-60% (G+C);
3. Primers should end (3') in a G or C, or CG or GC: this
prevents "breathing" of ends and increases efficiency of
priming;
4. Tms between 55-80oC are preferred;
5. Primer self-complementarity (ability to form
2o structures such as hairpins) should be avoided;
6. Runs of three or more Cs or Gs at the 3'-ends of primers
may promote mispriming at G or C-rich sequences
(because of stability of annealing), and should be
avoided.
Adapted from: Innis and Gelfand,1991
7. Restriction Analysis
Found in Bacteria and archea.
4 types
Type -1: cleavage remote to recognition site (methylase
activity)
Type-2: cleavage within a specific distance
Type-3: Cleavage within a short distance
Type-4: Cleaves modified DNA (methylated)
Ref:
http://insilico.ehu.es/restriction/long_seq/
http://molbiol-tools.ca/Restriction_endonuclease.htm
8.
9. Pattern Recognition in Gene
Finding
atgttggacagactggacgcaagacgtgtggatgaactcgttttggagctgaac
aaggctctatacgtacttaatcaagcggggcgtttgtggagcgagt
tacttcacaaaaagctagccaatttgggttcaatgcagtgcctgaccgacatggg
tatgtattagtaacgtttggaagaagaaactgttgtggttggtgt
ttatgcagacaatctacaggtgactgcaacgaattcaactctcgtggacagttttt
tcgttgatttacaggacctctcggtaaaggactatgaagaggtg
acaaaattcttggggatgcgcatttcttatgcgcctgaaaatgggtatgattatat
atcgagaagtgacaacccgggaaatgataaaggataa
atggagaggatgctggagacggtcaagacgaccatcacccctgcgcaggcaatgaag
ctgtttactgcacccaaagaacctcaagcgaacctggcccgag
cacttcatgtacttggtggccatctcggaggcctgcggtggtacttagtcctgaataacg
tcgtgccgtacgcgtccgcggatctacgaacggtcctgat
agccaaagtggacggcacgcgtgtcgactacctacagcaagctgaggaactggcgca
tttcgcgcaatcctgggagcttgaagcgcgcacgaagaacatt
We need to study the basic structures of genes first ….!
10. Gene Prediction
Patterns
Frame Consistency
Dicodon frequencies
PSSMs
Coding Potential and Fickett’s statistics
Fusion of Information
Sensitivity and Specificity
Prediction programs
Known problems
12. Gene Prediction Methods
Common sets of rules
Homology
Ab initio methods
Compositional information
Signal information
13. Gene Structure – Common sets of
rules
• Generally true: all long (> 300 bp) orfs in prokaryotic genomes
encode genes
But this may not necessarily be true for eukaryotic genomes
• Eukaryotic introns begin with GT and end with AG(donor and
acceptor sites)
– CT(A/G)A(C/T) 20-50 bases upstream of acceptor site.
14. Gene Structure
Each coding region (exon or whole gene) has a fixed
translation frame
A coding region always sits inside an ORF of same
reading frame
All exons of a gene are on the same strand.
Neighboring exons of a gene could have different
reading frames .
Exons need to be Frame consistent!
GATGGGACGACAGATAAGGTGATAGATGGTAGGCAGCAG
0 3 6 9 12 0 1
15. Gene Structure – reading frame consistency
Neighboring exons of a gene should be frame-consistent
exon1 (i, j) in frame a and exon2 (m, n) in frame b are consistent if
b = (m - j - 1 + a) mod 3
2/17/2016
GATGGGACGACAGATAGGTGATTAAGATGGTAGGCCGAGTGGTC
Exon1 (1,16) -> Frame = a = 0 ; i = 1 and j = 16
Case1: Exon2 (33,100): Frame = b = 1; m = 33 and n = 100
Case2: Exon2 (40,100): Frame = b = 1; m = 40 and n =100
GATGGGACGACAGATAGGTGATTAAGATGGTAGGCCGAGTGGTC
1 16 33
1 16 40
Frame 0 Frame 1
Frame 0
Frame 1
…33,36,39,42,45,48,51…
16. Codon Frequencies
Coding sequences are translated into protein sequences
We found the following – the dimer frequency in protein sequences is
NOT evenly distributed
Organism specific!!!!!!!!!!!
The average frequency is ¼% (1/20
* 1/20 = 1/400 = ¼%)
Some amino acids prefer to be next
to each other
Some other amino acids prefer to
be not next to each other
19. Dicodon Frequencies
Believe it or not – the biased (uneven) dimer frequencies are the
foundation of many gene finding programs!
Basic idea – if a dimer has lower than average dimer frequency; this
means that proteins prefer not to have such dimers in its sequence;
Hence if we see a dicodon encoding this dimer, we may
want to bet against this dicodon being in a coding
region!
20. Dicodon Frequencies - Examples
Relative frequencies of a di-codon in coding versus non-coding
frequency of dicodon X (e.g, AAAAAA) in coding region, total number of occurrences of
X divided by total number of dicocon occurrences
frequency of dicodon X (e.g, AAAAAA) in noncoding region, total number of
occurrences of X divided by total number of dicodon occurrences
In human genome, frequency of dicodon “AAA AAA” is
~1% in coding region versus ~5% in non-coding region
Question: if you see a region with many “AAA AAA”,
would you guess it is a coding or non-coding region?
21. Basic idea of gene finding
Most dicodons show bias towards either coding or non-coding
regions; only fraction of dicodons is neutral
Foundation for coding region identification
Dicodon frequencies are key signal used for coding region
detection; all gene finding programs use this information
Regions consisting of dicodons that mostly tend
to be in coding regions are probably coding
regions; otherwise non-coding regions
22. Prediction of Translation Starts Using PSSM
Certain nucleotides prefer to be in certain position around start
“ATG” and other nucleotides prefer not to be there
The “biased” nucleotide distribution is information! It is a basis for
translation start prediction
Question: which one is more probable to be a translation start?
ATG
A
C
T
G
-1-2-4 -3 +3 +5+4 +6
CACC ATG GC
TCGA ATG TT
TCTAGAAGATGGCAGTGGCGAAGA
TCTAGAAAATGACAGTGGCGAAGA
TCTAGAAAATGGCAGTAGCGAAGA
TCTACT A AATGATAGTAGCGAAGA
A 0,0,0,100 ,0, 75,100, 75 ATG
T 100,0,100,0,0, 25, 0, 0 ATG
G 0, 0, 0, 0, 75 ,0, 0, 25 ATG
C 0,100,0,0, 25 ,0, 0, 0 ATG
23. Prediction of Translation Starts
Mathematical model: Fi (X): frequency of X (A, C, G, T) in
position i
Score a string by log (Fi (X)/0.25)
A
C
T
G
CACC ATG GC TCGA ATG TT
log (58/25) + log (49/25) + log (40/25) +
log (50/25) + log (43/25) + log (39/25) =
0.37 + 0.29 + 0.20 + 0.30 + 0.24 + 0.29
= 1.69
log (6/25) + log (6/25) + log (15/25) + log
(15/25) + log (13/25) + log (14/25) =
-(0.62 + 0.62 + 0.22 + 0.22 + 0.28 + 0.25)
= -2.54
The model captures our intuition!
25. Evaluation of Gene prediction
• Sensitivity = No. of Correct exons/No. of actual exons(Measurement of False
negative) -> How many are discarded by mistake
• Specificity = No. of Correct exons/No. of predicted exons(Measurement of
False positive) -> How many are included by mistake
• CC = Metric for combining both
Real
Predicted
TP FP TN FN TP
Sn = TP/TP+FN
Sp=TP/TP+FP
(TP*TN) – (FN*FP)/sqrt( (TP+FN)*(TN+FP)*(TP+FP)*(TN+FN) )
26. Challenges of Gene finder
• Alternative splicing
• Nested/overlapping genes
• Extremely long/short genes
• Extremely long introns
• Non-canonical introns
• Split start codons
• UTR introns
• Non-ATG triplet as the start codon
• Polycistronic genes
• Repeats/transposons