Polymerase chain reaction
Prepared by: Sara Abudahab
University of Jordan
Department of Clinical Pharmacy
Outline
• History
• Principles of PCR:
• Purpose
• Components
• Steps
• Advantages and disadvantages of PCR
• Gel Electrophoresis
• Applications of PCR
History
• PCR is a coping machine for
DNA molecules
• Invented by Kary Mullis and his
colleagues in the 1983
• Nobel prize 1993
Principles of PCR
• Purpose
• Components
• Steps
Purpose of PCR
• Purpose of PCR Technique in vitro (test tube) is
amplification of specific DNA sequences
• PCR allows a "target" DNA sequence to be
selectively amplified, several million-fold in just a
few hours.
Exponential Amplification:
the DNA sequence between primers doubles after each cycle
PCR Components
DNATemplate
Amount
Human genomic DNA should be up to 500ng
Bacterial DNA1-10ng
Plasmid DNA 0.1-1ng
Primers
• Typical primers are 18-28 bases in length
• Having 50-60% GC composition
• Have a balanced distribution of G/C andA/T rich
domains
• Are not complementary to each other at the 3' ends to
avoid primer- dimer forming artifacts.
• Not self complementary “Hairpin” formation
DNA Polymerase
• The most widely characterized
polymerase is that from
Thermus aquaticus (Taq)
• Thermophilic bacterium lives in
hot springs
• Consist of a single polypeptide
chain has an optimum
polymerization temperature of
70 – 80 C (72 C).
Four Normal Deoxynucleosides Triphosphate
• Always use balanced
solution of all four dNTPs
to minimize polymerase
error rate.
Buffer
The standard PCR buffer contains:
• MgCl2
• Tris-HCl
• KCl
• Gelatin or Bovine Serum Albumin
PCR Master Mix
• PCR Master Mix is a premixed, ready-to-use
solution containing:
• Taq DNA Polymerase
• dNTPs
• MgCl2
• Reaction buffers
At optimal concentrations for efficient amplification
of DNA templates by PCR.
Video
PCR steps
Each cycle includes three successive steps:
Number of Cycles
• The number of cycles required for optimum
amplification varies depending on the amount of the
starting material.
• Most PCR should, therefore, include only 25 – 35
cycles. As cycle increases, nonspecific products can
accumulate.
• After 20- 40 cycles of heating and cooling build up over
a million copies of original DNAmolecules.
Advantages and disadvantages
Advantages of PCR
Useful non- invasive procedure.
Simplicity of the procedure.
Sensitivity of the PCR
Disadvantages of PCR
False positive results (cross contamination).
False negative results
Gel Electrophoresis
Agarose Gel Electrophoresis
• It is a method used in biochemistry and molecular
biology to separate DNA, or RNA molecules based
upon charge, size and shape.
• To determine the presence or amount of DNA
• To determine the sizes of DNA fragments
Preparation of Gel
Ready for loading
Loading PCR samples
Running the electrophoresis
DNA has an overall negative charge. Because of Phosphate group.
Separation
Factors that affect the mobility of molecules
in the gel
• Charge
• Size
• Shape
• Buffer conditions
• Gel concentration and
• Voltage
Reading results
• Under the UV light
• Many dyes are used:
Ethidium Bromide Dye
Green stain Dye
Red Safe Dye
DNA ladder
• DNA Ladder consists of known
DNA sizes used to determine the
size of an unknown DNA
sample.
PCR Application
Paternity Testing
 Genetic material is inherited from both parents, half
from mother and half from father.
 Matching genetic fingerprinting of suspected parents
with that of children.
 DNA sample from buccal saliva or blood is collected
and extracted from the alleged child. Then the
extracted DNA is subjected to PCR, thousands of
copies of amplified DNA is obtained.
Diagnosis of Infectious Disease
 DNA from the infected parts of a person may be
subjected to PCR with primer specific gene of the
pathogen and diagnosis can be done on amplification
of DNA.
 These PCR-based tests have advantage over
conventional antibody-based diagnostic methods
that determine the body's immune response to a
pathogen.
 As patients can take weeks to develop antibodies
against an contagious agent but this is fast and
efficient.
Detecting HIV
 HIV DNA collected from white blood cells of patient.
Detecting HIV
• RT-PCR based tests have been developed to
enumerate the amount of virus in a person's blood
‘viral load' there by allowing physicians to check
their patients' disease progression
Mutation detection in Inherited disease
 Any point mutation, a deletion or an insertion and
expanded tandem repeat can be detected by PCR.
 It is a highly sensitive tool in the diagnosis of various
diseases in human.
Figure : Gap-PCR for α-thalassemia deletions.
(αα/αα) (--MED/--MED) (αα/--MED)
Gene Expression Analysis
 Testing gene expression can be done by PCR
 Important enzyme used in this method is reverse
transcriptase.
 Gene expression can be test by using the RNA.
 The more abundant transcripts from highly transcribed
genes (now in the form of cDNA) will yield more
product than more weakly transcribed genes.
DNA Fingerprinting
 PCR's main advantage in forensics is that forensic
scientists can use it to amplify or make copies of
regions of the genome that vary widely between
different individuals, called VNTRs (variable number
tandem repeats).
 By comparing the length of different VNTRs they can
determine whether the sample may be a match
with the suspect's DNA.
DNA cloning
 PCR can be utilized for DNA cloning - It can
concentrate fragments for insertion into a vector from
a bigger genome, which may be accessible in little
amounts
 PCR cloning is a rapid method for cloning genes, and
is often used for projects that require higher
throughput than traditional cloning methods can
accommodate. It allows for the cloning of DNA
fragments that are not available in large amounts.
DNA sequencing
 The DNA to be sequenced is used in the single
stranded form and DNA polymerase synthesizes new
complementary DNA strand.
 Nucleic acids are labeled
 Detection of cDNA and along the original DNA
sequence
Our Research
Novel SNPs of UGT1A1 and UGT1A7 genes in
Circassians and Chechens subpopulations
compared to the Jordanian population.
What is UGT?
UGT1A7 location
Location (UCSC) Chr 2: 233.68 – 233.77 Mb
Irinotecan
• Is used alone or in combination with other
medications to treat colon or rectal cancer
UGT1A7*3 Mutation
ATGGCTCGTGCAGGGTGGACTGGCCTCCTTCCACTATATGTGTGTCTACTGC
TGACCTGTGGCTTTGCCAAGGCAGGGAAGCTGCTGGTAGTGCCCATGGATG
GGAGCCACTGGTTCACCATGCAGTCGGTGGTGGAGAAACTCATCCTCAGG
GGGCATGAGGTGGTCGTAGTCATGCCAGAGGTGAGTTGGCAACTGGGAAG
ATCACTGAATTGCACAGTGAAGACTTACTCAACCTCATACACTCTGGAGGA
TCAGGACCGGGAGTTCATGGTTTTTGCCGATGCTCGCTGGACGGCACCATT
GCGAAGTGCATTTTCTCTATTAACAAGTTCATCCAATGGTATTTTTGACTTAT
TTTTTTCAAATTGCAGGAGTTTGTTTAA(T)GACAAAAAATTAGTAGAATAC
TTAAAGGAGAGTTGTTTTGATGCAGTGTTTCTCGATCCTTTTGATGCCTGTG
GCTTAATTGTTGCCAAATATTTCTCCCTCCCCTCTGTGGTCTTCGCCAGGGG
AATATTTTGCCACTATCTTGAAGAAGGTGCACAGTGCCCTGCTCCTCTTTCC
TATGTCCCCAGACTTCTCTTAGGGTTCTCAGACGCCATGACTTTCAAGGAG
AGAGTACGGAACCACATCATGCACTTGGAGGAACATTTATTTTGCCCCTATT
TTTTCAAAAATGTCTTAGAAATAGCCTCTGAAATTCTCCAAACCCCTGTCAC
GGCATATGATCTCTACAGCCACACATCAATTTGGTTGTTGCGAACTGACTTT
GTTTTGGAGTATCCCAAACCCGTGATGCCCAATATGATCTTCATTGGTGGTAT
CAACTGTCATCAGGGAAAGCCAGTGCCTATG
16 samples of Chechen
Sequencing results

Polymerase Chain Reaction

Editor's Notes

  • #6 via the temperature mediated DNA polymerase enzyme by simultaneous primer extension of complementary strands of DNA.
  • #10 Primer concentration between 0.1 and 0.6 M are generally optimal
  • #11 0.5 – 2 units/50l reaction. Too little will limit the amount of products, while too much can produce unwanted non specific products
  • #12 Final concentration of dNTPs should be 50-500 M (each dNTP). Usually included at conc. of 200 M for each nucleotide.
  • #16 Each cycle includes: Initial Denaturation: Initial heating of the PCR mixture at 94- 95C  2 min. is enough to completely denature complex genomic DNA. Each cycle includes three successive steps: Denaturation, annealing and extension. Post extension and holding: Cycling should conclude with a final extension at 72 C  for 5 -15 minute to promote completion of partial extension products and then holding at 4 C  .
  • #19 Notes: Maybe you should mention this slide before the gel electrophoresis And maybe also you could mention the different types of PCR techniques/machines, e.g. RT-PCR
  • #22 http://www.phschool.com/science/biology_place/labbench/lab6/prepare.html Notes: - Tell them that the microwave is used to accelerate the process of agarose melting
  • #28 Notes: - If you want to do your presentation to the best of your ability, each point of these needs to be explained and how they truly affect the mobility
  • #29 Notes: You can tell them cool information like EthBr being carcinogenic and red stain and green stains were developed as a safe substitute to EthBr
  • #34 PCR technology facilitates the detection of DNA or RNA of pathogenic organisms in clinical diagnostic tests for a range of infectious agents like viruses, bacteria, protozoa etc.
  • #35 Using PCR DNA is amplified, with each cycle thousands of copies of DNA are obtained.
  • #39 Figure : Gap-PCR for α-thalassemia deletions. The amplification products are run on 2% agarose gel. The normal (αα/αα) control shows two bands at 446 and 298 bp, while both parents show three bands (561, 446, and 298 bp) and are thus heterozygous for the Mediterranean deletion (αα/--MED). The infant shows only a single band at 561 bp and thus it is homozygous for the latter deletion (--MED/--MED).
  • #48 UDP-glucuronosyltransferase or UGT enzyme for short, is one part of the drug metabolism cascade in the human body, it's specifically part of the hepatic phase Ⅱ reactions; which involves a diverse group of enzymes, generally responsible for producing a more water soluble metabolites by a process known as sugar conjugation, which allows for the detoxication of drugs by producing products that are easily excreted by the gallbladder or the kidneys.