PCR & Primer
 Designing



Karan Veer Singh
    NBFGR
What is a primer?
   A primer is a short synthetic oligonucleotide which is used in many
    molecular techniques. These primers are designed to have a sequence
    which is the reverse compliment a region of template or target DNA to
    which we wish the primer to anneal.
                            3’           5’
                            TGACCTGAAAAGAC           Primer

     GATGGACTGATTACCGATGACTGGACTTTTCTG              Template
     5’                               3’



                        3’                   5’
                         TGACCTGAAAAGAC
                         :: ::: : : : : : : : :
      GATGGACTGATTACCGATGACTGGACTTTTCTG             Annealing
      5’                                      3’




      05/15/12            NBFGR         karan veer singh
05/15/12   NBFGR   karan veer singh
Diagram for PCR Primer
Design

 Sequence from
 which to choose
 primers

                                              Results of search,
   PCR reaction                               including suggested
   parameters              Primer             annealing temperatures
                           Design             shown in list

   Primer Selection
   Rules


Primer design is an art when done by human beings, and a far
better done by machines.
               machines
Primer Design Criteria
•  Primer uniqueness
•  Primer length
•  Melting temperature
•  GC content range
•  3'-clamp properties (terminal residue,
CG-content)
• Avoid hairpins in primers
• Length of amplified region
• Avoid primer-primer interaction
• Melting temperature compatability
    05/15/12   NBFGR   karan veer singh
A simple set of rules for primer sequence design is as
                        follows

‫٭‬Primers should be 17-28 bases in length;
¼ chance (4ˉ¹) of finding an A, G, C or T in any given DNA sequence;

1/16 chance (4ˉ²) of finding any dinucleotide sequence (eg. AG);

1/256 chance of finding a given 4-base sequence.

Thus, a sixteen base sequence will statistically be present only once in every
4¹6 bases (=4 294 967 296, or 4 billion) about the size of the human or maize
genome


        05/15/12            NBFGR        karan veer singh
‫٭‬Base composition should be 50-60% (G+C);
 ‫٭‬Primers should end (3') in a G or C, or CG or
 GC: this prevents "breathing" of ends and
 increases efficiency of priming;

 ‫٭‬Tms between 55-80ºC are preferred;
           Tm = 4(G + C) + 2(A + T) ºC.


05/15/12          NBFGR   karan veer singh
Common problems in primer design
‫٭‬Runs of three or more Cs or Gs at the 3'-ends of primers
may promote mispriming at G or C-rich sequences (because
of stability of annealing), and should be avoided;

‫-'3٭‬ends of primers should not be complementary
‫٭‬Primer self-complementarity (ability to form 2º structures
such as hairpins) should be avoided.




      05/15/12       NBFGR      karan veer singh
05/15/12   NBFGR   karan veer singh
Hairpin formation




 05/15/12   NBFGR   karan veer singh
05/15/12   NBFGR   karan veer singh
When is a “PRIMER” a Primer?




  05/15/12    NBFGR   karan veer singh
Designing Degenerative Oligonucleotide
    A group of degenerate oligonucleotides contain related sequences with
     differences at specific locations.
    One common use of degenerative oligonucletides is when the amino acid
     sequences of a protein is known. One can reverse translate this sequence to
     determine all of the possible nucleotide sequences that could encode that
     amino acid sequence. A set of degenerate oligonucleotides would then be
     produce matching those DNA sequences .

 http:// cvmbs.colostate.edu/molkit/rtranslate/


                     AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln
                   GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA
                      C G C CT CAGC C     C   T C C C G
                              A    A      A        A A
                              G    G      G        G G



       05/15/12              NBFGR          karan veer singh
Related Bioinformatics Programs:


 ‫٭‬Primer3 http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi
 ‫٭‬Web Primer http://seq.yeastgenome.org/cgi-bin/web-primer
 ‫٭‬Gene Fisher (http://bibiserv.techfak.uni-bielefeld.de/genefisher/)
 ‫٭‬GeneWalker (http://www.cybergene.se/primerdesign/)
 ‫٭‬CODEHOP (http://www.blocks.fhcrc.org/codehop.html)
 ‫٭‬Net Primer
 (http://www.premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html )
 …….and many others



   05/15/12            NBFGR        karan veer singh
PCR Mastermix Box Titration Calculator
- http://www.attotron.com/pub/pcrtitr.htm


PCR Optimization Program Helper –
http://www.molbiol.ru/eng/scripts/01_14.html

‫٭‬MGH-PGA Proteomic Tools PCR Primer design for
peptide sequences
‫٭‬Oligo Calculator -- to calculate Tm, GC%, etc for a
given oligo.

 05/15/12            NBFGR         karan veer singh
Primer Bank

http://pga.mgh.harvard.edu/primerbank/index.html

PCR Primers for Gene Expression Detection and Quantification




  05/15/12          NBFGR        karan veer singh
Other Primer Databases:

    RTPrimerDB - Real Time PCR Primer and Probe Database
    (submitted by researchers).

    Real Time PCR Primer Sets Real time PCR primers
    (submitted by researchers).

    The Quantitative PCR Primer Database (QPPD) provides
    information about primers and probes that can be used for
    human and mouse real time RT–PCR assays (published
    articles)

    IMGT/PRIMER-DB, the IMGT database for primers of the
    immunoglobulins (IG), T cell receptors (TR) and related
    proteins of the immune system (RPI).

   05/15/12           NBFGR         karan veer singh
Components       Volume          Per Concentration
                 sample              reaction
DDW              38.8 µl                 -
Buffer           5.00 µl                 1X
dNTP’s           1.00 µl (0.25 µl 200 μM each
                 each)
Primer F         0.04 µl                 5-10 p moles
Primer R         0.04 µl                 5-10 p moles
MgCl2            2.00 µl                 -
Taq Polymerase   0.04 µl                 1.5 U
Total Volume     48.00 µl                -
      05/15/12    NBFGR     karan veer singh
Buffer:

 1X, usually comes as 10X stock.
 For 25µL reactions, this means 2.5µL.




 05/15/12   NBFGR   karan veer singh
dNTP’s:

 •a 2mM stock of dNTPs means that the final
 concentration of EACH dNTP (dATP,
 dCTP, dGTP, and dTTP) is 2mM -- NOT
 that all dNTPs together make 2mM.

 •dNTPs come as 100mM stocks -- thaw and
 add 10µL of each dNTP to 460µL of ddH20
 to make 2mM. Store at -20°C.

  05/15/12    NBFGR   karan veer singh
Primers:

A good place to start with primer
concentration is 50pmol of each primer
per reaction.
If you don’t get your desired product, you
can increase to 75pmol or 100pmol. This
usually does the trick.



  05/15/12    NBFGR    karan veer singh
MgCl2 Concentration.

 •Mg2+ ions form complexes with dNTPs, primers and DNA templates,
 the optimal concentration of MgCl2 has to be selected for each
 experiment.
 Too few Mg2+ ions result in a low yield of PCR product, and too
 many increase the yield of non-specific products and promote
 misincorporation.
 Lower Mg2+ concentrations are desirable when fidelity of DNA
 synthesis is critical.




  05/15/12           NBFGR        karan veer singh
Taq DNA Polymerase:

Usually 1-1.5u of Taq DNA Polymerase are used in 50µl of
reaction mix. Higher Taq DNA Polymerase concentrations
may cause synthesis of nonspecific products.

However, if inhibitors are present in the reaction mix (e.g., if
the template DNA used is not highly purified), higher
amounts of Taq DNA Polymerase (2-3u) may be necessary to
obtain a better yield of amplification products.




     05/15/12         NBFGR      karan veer singh
Template:


 It’s not usually necessary to be incredibly
 fastidious about how much template you
 add to a reaction. You can get product
 with incredibly small amounts of starting
 DNA.



   05/15/12    NBFGR    karan veer singh
Steps                  Temperature (°C)       Time      Cycle

Initial denaturation        950               120 sec   1 Cycle

Denaturation                940               30 sec

Annealing                   540               30 sec    35 Cycle

Extension                   720               60 sec

Elongated extended          720               600 sec   1 cycle

 Storage                    40                Forever -




        05/15/12         NBFGR       karan veer singh

PCR Primer desining

  • 1.
    PCR & Primer Designing Karan Veer Singh NBFGR
  • 2.
    What is aprimer?  A primer is a short synthetic oligonucleotide which is used in many molecular techniques. These primers are designed to have a sequence which is the reverse compliment a region of template or target DNA to which we wish the primer to anneal. 3’ 5’ TGACCTGAAAAGAC Primer GATGGACTGATTACCGATGACTGGACTTTTCTG Template 5’ 3’ 3’ 5’ TGACCTGAAAAGAC :: ::: : : : : : : : : GATGGACTGATTACCGATGACTGGACTTTTCTG Annealing 5’ 3’ 05/15/12 NBFGR karan veer singh
  • 3.
    05/15/12 NBFGR karan veer singh
  • 4.
    Diagram for PCRPrimer Design Sequence from which to choose primers Results of search, PCR reaction including suggested parameters Primer annealing temperatures Design shown in list Primer Selection Rules Primer design is an art when done by human beings, and a far better done by machines. machines
  • 5.
    Primer Design Criteria • Primer uniqueness • Primer length • Melting temperature • GC content range • 3'-clamp properties (terminal residue, CG-content) • Avoid hairpins in primers • Length of amplified region • Avoid primer-primer interaction • Melting temperature compatability 05/15/12 NBFGR karan veer singh
  • 6.
    A simple setof rules for primer sequence design is as follows ‫٭‬Primers should be 17-28 bases in length; ¼ chance (4ˉ¹) of finding an A, G, C or T in any given DNA sequence; 1/16 chance (4ˉ²) of finding any dinucleotide sequence (eg. AG); 1/256 chance of finding a given 4-base sequence. Thus, a sixteen base sequence will statistically be present only once in every 4¹6 bases (=4 294 967 296, or 4 billion) about the size of the human or maize genome 05/15/12 NBFGR karan veer singh
  • 7.
    ‫٭‬Base composition shouldbe 50-60% (G+C); ‫٭‬Primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; ‫٭‬Tms between 55-80ºC are preferred; Tm = 4(G + C) + 2(A + T) ºC. 05/15/12 NBFGR karan veer singh
  • 8.
    Common problems inprimer design ‫٭‬Runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided; ‫-'3٭‬ends of primers should not be complementary ‫٭‬Primer self-complementarity (ability to form 2º structures such as hairpins) should be avoided. 05/15/12 NBFGR karan veer singh
  • 9.
    05/15/12 NBFGR karan veer singh
  • 10.
    Hairpin formation 05/15/12 NBFGR karan veer singh
  • 11.
    05/15/12 NBFGR karan veer singh
  • 12.
    When is a“PRIMER” a Primer? 05/15/12 NBFGR karan veer singh
  • 13.
    Designing Degenerative Oligonucleotide  A group of degenerate oligonucleotides contain related sequences with differences at specific locations.  One common use of degenerative oligonucletides is when the amino acid sequences of a protein is known. One can reverse translate this sequence to determine all of the possible nucleotide sequences that could encode that amino acid sequence. A set of degenerate oligonucleotides would then be produce matching those DNA sequences . http:// cvmbs.colostate.edu/molkit/rtranslate/ AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA C G C CT CAGC C C T C C C G A A A A A G G G G G 05/15/12 NBFGR karan veer singh
  • 14.
    Related Bioinformatics Programs: ‫٭‬Primer3 http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi ‫٭‬Web Primer http://seq.yeastgenome.org/cgi-bin/web-primer ‫٭‬Gene Fisher (http://bibiserv.techfak.uni-bielefeld.de/genefisher/) ‫٭‬GeneWalker (http://www.cybergene.se/primerdesign/) ‫٭‬CODEHOP (http://www.blocks.fhcrc.org/codehop.html) ‫٭‬Net Primer (http://www.premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html ) …….and many others 05/15/12 NBFGR karan veer singh
  • 15.
    PCR Mastermix BoxTitration Calculator - http://www.attotron.com/pub/pcrtitr.htm PCR Optimization Program Helper – http://www.molbiol.ru/eng/scripts/01_14.html ‫٭‬MGH-PGA Proteomic Tools PCR Primer design for peptide sequences ‫٭‬Oligo Calculator -- to calculate Tm, GC%, etc for a given oligo. 05/15/12 NBFGR karan veer singh
  • 16.
    Primer Bank http://pga.mgh.harvard.edu/primerbank/index.html PCR Primersfor Gene Expression Detection and Quantification 05/15/12 NBFGR karan veer singh
  • 17.
    Other Primer Databases: RTPrimerDB - Real Time PCR Primer and Probe Database (submitted by researchers). Real Time PCR Primer Sets Real time PCR primers (submitted by researchers). The Quantitative PCR Primer Database (QPPD) provides information about primers and probes that can be used for human and mouse real time RT–PCR assays (published articles) IMGT/PRIMER-DB, the IMGT database for primers of the immunoglobulins (IG), T cell receptors (TR) and related proteins of the immune system (RPI). 05/15/12 NBFGR karan veer singh
  • 18.
    Components Volume Per Concentration sample reaction DDW 38.8 µl - Buffer 5.00 µl 1X dNTP’s 1.00 µl (0.25 µl 200 μM each each) Primer F 0.04 µl 5-10 p moles Primer R 0.04 µl 5-10 p moles MgCl2 2.00 µl - Taq Polymerase 0.04 µl 1.5 U Total Volume 48.00 µl - 05/15/12 NBFGR karan veer singh
  • 19.
    Buffer: 1X, usuallycomes as 10X stock. For 25µL reactions, this means 2.5µL. 05/15/12 NBFGR karan veer singh
  • 20.
    dNTP’s: •a 2mMstock of dNTPs means that the final concentration of EACH dNTP (dATP, dCTP, dGTP, and dTTP) is 2mM -- NOT that all dNTPs together make 2mM. •dNTPs come as 100mM stocks -- thaw and add 10µL of each dNTP to 460µL of ddH20 to make 2mM. Store at -20°C. 05/15/12 NBFGR karan veer singh
  • 21.
    Primers: A good placeto start with primer concentration is 50pmol of each primer per reaction. If you don’t get your desired product, you can increase to 75pmol or 100pmol. This usually does the trick. 05/15/12 NBFGR karan veer singh
  • 22.
    MgCl2 Concentration. •Mg2+ions form complexes with dNTPs, primers and DNA templates, the optimal concentration of MgCl2 has to be selected for each experiment. Too few Mg2+ ions result in a low yield of PCR product, and too many increase the yield of non-specific products and promote misincorporation. Lower Mg2+ concentrations are desirable when fidelity of DNA synthesis is critical. 05/15/12 NBFGR karan veer singh
  • 23.
    Taq DNA Polymerase: Usually1-1.5u of Taq DNA Polymerase are used in 50µl of reaction mix. Higher Taq DNA Polymerase concentrations may cause synthesis of nonspecific products. However, if inhibitors are present in the reaction mix (e.g., if the template DNA used is not highly purified), higher amounts of Taq DNA Polymerase (2-3u) may be necessary to obtain a better yield of amplification products. 05/15/12 NBFGR karan veer singh
  • 24.
    Template: It’s notusually necessary to be incredibly fastidious about how much template you add to a reaction. You can get product with incredibly small amounts of starting DNA. 05/15/12 NBFGR karan veer singh
  • 25.
    Steps Temperature (°C) Time Cycle Initial denaturation 950 120 sec 1 Cycle Denaturation 940 30 sec Annealing 540 30 sec 35 Cycle Extension 720 60 sec Elongated extended 720 600 sec 1 cycle Storage 40 Forever - 05/15/12 NBFGR karan veer singh