Reverse transcription of RNA, which refers to the conversion of the RNA template into its complimentary DNA strand (cDNA) is an essential step in the analysis of gene transcripts.
cDNA can be sequenced, cloned and applied to estimate the copy number of specific genes in order to characterize and to validate gene expression.
A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR). It monitors the amplification of a targeted DNA molecule during the PCR, i.e. in real-time, and not at its end, as in conventional PCR.
https://www.patreon.com/biotechlive
SUPPORT EDUCATION... SUPPORT US
Reverse transcription of RNA, which refers to the conversion of the RNA template into its complimentary DNA strand (cDNA) is an essential step in the analysis of gene transcripts.
cDNA can be sequenced, cloned and applied to estimate the copy number of specific genes in order to characterize and to validate gene expression.
A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR). It monitors the amplification of a targeted DNA molecule during the PCR, i.e. in real-time, and not at its end, as in conventional PCR.
https://www.patreon.com/biotechlive
SUPPORT EDUCATION... SUPPORT US
Scoring system is a set of values for qualifying the set of one residue being substituted by another in an alignment.
It is also known as substitution matrix.
Scoring matrix of nucleotide is relatively simple.
A positive value or a high score is given for a match & negative value or a low score is given for a mismatch.
Scoring matrices for amino acids are more complicated because scoring has to reflect the physicochemical properties of amino acid residues.
Sanger sequencing is one of the DNA sequencing methods used to identify and determine the sequence (Nucleotide) of DNA .This is an enzymatic method of sequencing developed by Fred Sanger.
BAC & YAC are artificially prepared chromosomes to clone DNA sequences.yeast artificial chromosome is capable of carrying upto 1000 kbp of inserted DNA sequence
Scoring system is a set of values for qualifying the set of one residue being substituted by another in an alignment.
It is also known as substitution matrix.
Scoring matrix of nucleotide is relatively simple.
A positive value or a high score is given for a match & negative value or a low score is given for a mismatch.
Scoring matrices for amino acids are more complicated because scoring has to reflect the physicochemical properties of amino acid residues.
Sanger sequencing is one of the DNA sequencing methods used to identify and determine the sequence (Nucleotide) of DNA .This is an enzymatic method of sequencing developed by Fred Sanger.
BAC & YAC are artificially prepared chromosomes to clone DNA sequences.yeast artificial chromosome is capable of carrying upto 1000 kbp of inserted DNA sequence
A detailed description about the basic steps involved in the - PCR - Polymerase Chain Reaction, its applications,its limitations and steps to overcome it.
The yak is one of the most enduring symbols of the high Himalayas. Whether you visit Tibet, Bhutan, India or Nepal, you will inevitably find tourist places with yaks for picture clicking and ride.
As the largest animal on the Tibetan plateau and its surrounding regions, the yak is a “flagship species”, and indicates the health of the ecosystem within which it lives.
DNA sequence analysis of a uniform target gene like the mitochondrial cytochrome oxidase subunit I (COI) to enable species identification has been referred to as “DNA Barcoding”, by analogy with the Universal Product Code (UPC) system barcodes used to identify manufactured goods.
DNA barcoding has the potential to be a practical method for identification of the estimated 10 million species of eukaryotic life on earth.
Microsatellite are powerful DNA markers for quantifying genetic variations within & between populations of a species, also called as STR, SSR, VNTR. Tandemly repeated DNA sequences with the repeat/size of 1 – 6 bases repeated several times
Access and Benefit sharing from Genetic ResourcesKaran Veer Singh
Millions of people depend on biological (genetic) resources and traditional knowledge for their livelihoods. While the concept of an access and benefit sharing (ABS) regime is new, access to biological resources and transfer of associated traditional knowledge is centuries old.
Indian act on IPRs, CBD, Copyright Act, 1957
The Patents Act, 1970
The Geographical Indications of Goods (Registration and Protection) Act, 1999
The Trade Marks Act, 1999
The Designs Act, 2000
The Semiconductor Integrated Circuits Layout-Design Act, 2000
Protection of Plant Varieties and Farmers' Rights Act, 2001
Biological Diversity Act, 2002
Genome annotation, NGS sequence data, decoding sequence information, The genome contains all the biological information required to build and maintain any given living organism.
The quality of data is very important for various downstream analyses, such as sequence assembly, single nucleotide polymorphisms identification this ppt show parameters for
NGS Data quality check and Dataformat of top sequencing machine
RNA Sequence data analysis,Transcriptome sequencing, Sequencing steady state RNA in a sample is known as RNA-Seq. It is free of limitations such as prior knowledge about the organism is not required.
RNA-Seq is useful to unravel inaccessible complexities of transcriptomics such as finding novel transcripts and isoforms.
Data set produced is large and complex; interpretation is not straight forward.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
The Roman Empire A Historical Colossus.pdfkaushalkr1407
The Roman Empire, a vast and enduring power, stands as one of history's most remarkable civilizations, leaving an indelible imprint on the world. It emerged from the Roman Republic, transitioning into an imperial powerhouse under the leadership of Augustus Caesar in 27 BCE. This transformation marked the beginning of an era defined by unprecedented territorial expansion, architectural marvels, and profound cultural influence.
The empire's roots lie in the city of Rome, founded, according to legend, by Romulus in 753 BCE. Over centuries, Rome evolved from a small settlement to a formidable republic, characterized by a complex political system with elected officials and checks on power. However, internal strife, class conflicts, and military ambitions paved the way for the end of the Republic. Julius Caesar’s dictatorship and subsequent assassination in 44 BCE created a power vacuum, leading to a civil war. Octavian, later Augustus, emerged victorious, heralding the Roman Empire’s birth.
Under Augustus, the empire experienced the Pax Romana, a 200-year period of relative peace and stability. Augustus reformed the military, established efficient administrative systems, and initiated grand construction projects. The empire's borders expanded, encompassing territories from Britain to Egypt and from Spain to the Euphrates. Roman legions, renowned for their discipline and engineering prowess, secured and maintained these vast territories, building roads, fortifications, and cities that facilitated control and integration.
The Roman Empire’s society was hierarchical, with a rigid class system. At the top were the patricians, wealthy elites who held significant political power. Below them were the plebeians, free citizens with limited political influence, and the vast numbers of slaves who formed the backbone of the economy. The family unit was central, governed by the paterfamilias, the male head who held absolute authority.
Culturally, the Romans were eclectic, absorbing and adapting elements from the civilizations they encountered, particularly the Greeks. Roman art, literature, and philosophy reflected this synthesis, creating a rich cultural tapestry. Latin, the Roman language, became the lingua franca of the Western world, influencing numerous modern languages.
Roman architecture and engineering achievements were monumental. They perfected the arch, vault, and dome, constructing enduring structures like the Colosseum, Pantheon, and aqueducts. These engineering marvels not only showcased Roman ingenuity but also served practical purposes, from public entertainment to water supply.
Honest Reviews of Tim Han LMA Course Program.pptxtimhan337
Personal development courses are widely available today, with each one promising life-changing outcomes. Tim Han’s Life Mastery Achievers (LMA) Course has drawn a lot of interest. In addition to offering my frank assessment of Success Insider’s LMA Course, this piece examines the course’s effects via a variety of Tim Han LMA course reviews and Success Insider comments.
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...Levi Shapiro
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
2024.06.01 Introducing a competency framework for languag learning materials ...Sandy Millin
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
2. What is a primer?
A primer is a short synthetic oligonucleotide which is used in many
molecular techniques. These primers are designed to have a sequence
which is the reverse compliment a region of template or target DNA to
which we wish the primer to anneal.
3’ 5’
TGACCTGAAAAGAC Primer
GATGGACTGATTACCGATGACTGGACTTTTCTG Template
5’ 3’
3’ 5’
TGACCTGAAAAGAC
:: ::: : : : : : : : :
GATGGACTGATTACCGATGACTGGACTTTTCTG Annealing
5’ 3’
05/15/12 NBFGR karan veer singh
4. Diagram for PCR Primer
Design
Sequence from
which to choose
primers
Results of search,
PCR reaction including suggested
parameters Primer annealing temperatures
Design shown in list
Primer Selection
Rules
Primer design is an art when done by human beings, and a far
better done by machines.
machines
5. Primer Design Criteria
• Primer uniqueness
• Primer length
• Melting temperature
• GC content range
• 3'-clamp properties (terminal residue,
CG-content)
• Avoid hairpins in primers
• Length of amplified region
• Avoid primer-primer interaction
• Melting temperature compatability
05/15/12 NBFGR karan veer singh
6. A simple set of rules for primer sequence design is as
follows
٭Primers should be 17-28 bases in length;
¼ chance (4ˉ¹) of finding an A, G, C or T in any given DNA sequence;
1/16 chance (4ˉ²) of finding any dinucleotide sequence (eg. AG);
1/256 chance of finding a given 4-base sequence.
Thus, a sixteen base sequence will statistically be present only once in every
4¹6 bases (=4 294 967 296, or 4 billion) about the size of the human or maize
genome
05/15/12 NBFGR karan veer singh
7. ٭Base composition should be 50-60% (G+C);
٭Primers should end (3') in a G or C, or CG or
GC: this prevents "breathing" of ends and
increases efficiency of priming;
٭Tms between 55-80ºC are preferred;
Tm = 4(G + C) + 2(A + T) ºC.
05/15/12 NBFGR karan veer singh
8. Common problems in primer design
٭Runs of three or more Cs or Gs at the 3'-ends of primers
may promote mispriming at G or C-rich sequences (because
of stability of annealing), and should be avoided;
-'3٭ends of primers should not be complementary
٭Primer self-complementarity (ability to form 2º structures
such as hairpins) should be avoided.
05/15/12 NBFGR karan veer singh
12. When is a “PRIMER” a Primer?
05/15/12 NBFGR karan veer singh
13. Designing Degenerative Oligonucleotide
A group of degenerate oligonucleotides contain related sequences with
differences at specific locations.
One common use of degenerative oligonucletides is when the amino acid
sequences of a protein is known. One can reverse translate this sequence to
determine all of the possible nucleotide sequences that could encode that
amino acid sequence. A set of degenerate oligonucleotides would then be
produce matching those DNA sequences .
http:// cvmbs.colostate.edu/molkit/rtranslate/
AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln
GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA
C G C CT CAGC C C T C C C G
A A A A A
G G G G G
05/15/12 NBFGR karan veer singh
14. Related Bioinformatics Programs:
٭Primer3 http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi
٭Web Primer http://seq.yeastgenome.org/cgi-bin/web-primer
٭Gene Fisher (http://bibiserv.techfak.uni-bielefeld.de/genefisher/)
٭GeneWalker (http://www.cybergene.se/primerdesign/)
٭CODEHOP (http://www.blocks.fhcrc.org/codehop.html)
٭Net Primer
(http://www.premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html )
…….and many others
05/15/12 NBFGR karan veer singh
15. PCR Mastermix Box Titration Calculator
- http://www.attotron.com/pub/pcrtitr.htm
PCR Optimization Program Helper –
http://www.molbiol.ru/eng/scripts/01_14.html
٭MGH-PGA Proteomic Tools PCR Primer design for
peptide sequences
٭Oligo Calculator -- to calculate Tm, GC%, etc for a
given oligo.
05/15/12 NBFGR karan veer singh
17. Other Primer Databases:
RTPrimerDB - Real Time PCR Primer and Probe Database
(submitted by researchers).
Real Time PCR Primer Sets Real time PCR primers
(submitted by researchers).
The Quantitative PCR Primer Database (QPPD) provides
information about primers and probes that can be used for
human and mouse real time RT–PCR assays (published
articles)
IMGT/PRIMER-DB, the IMGT database for primers of the
immunoglobulins (IG), T cell receptors (TR) and related
proteins of the immune system (RPI).
05/15/12 NBFGR karan veer singh
18. Components Volume Per Concentration
sample reaction
DDW 38.8 µl -
Buffer 5.00 µl 1X
dNTP’s 1.00 µl (0.25 µl 200 μM each
each)
Primer F 0.04 µl 5-10 p moles
Primer R 0.04 µl 5-10 p moles
MgCl2 2.00 µl -
Taq Polymerase 0.04 µl 1.5 U
Total Volume 48.00 µl -
05/15/12 NBFGR karan veer singh
19. Buffer:
1X, usually comes as 10X stock.
For 25µL reactions, this means 2.5µL.
05/15/12 NBFGR karan veer singh
20. dNTP’s:
•a 2mM stock of dNTPs means that the final
concentration of EACH dNTP (dATP,
dCTP, dGTP, and dTTP) is 2mM -- NOT
that all dNTPs together make 2mM.
•dNTPs come as 100mM stocks -- thaw and
add 10µL of each dNTP to 460µL of ddH20
to make 2mM. Store at -20°C.
05/15/12 NBFGR karan veer singh
21. Primers:
A good place to start with primer
concentration is 50pmol of each primer
per reaction.
If you don’t get your desired product, you
can increase to 75pmol or 100pmol. This
usually does the trick.
05/15/12 NBFGR karan veer singh
22. MgCl2 Concentration.
•Mg2+ ions form complexes with dNTPs, primers and DNA templates,
the optimal concentration of MgCl2 has to be selected for each
experiment.
Too few Mg2+ ions result in a low yield of PCR product, and too
many increase the yield of non-specific products and promote
misincorporation.
Lower Mg2+ concentrations are desirable when fidelity of DNA
synthesis is critical.
05/15/12 NBFGR karan veer singh
23. Taq DNA Polymerase:
Usually 1-1.5u of Taq DNA Polymerase are used in 50µl of
reaction mix. Higher Taq DNA Polymerase concentrations
may cause synthesis of nonspecific products.
However, if inhibitors are present in the reaction mix (e.g., if
the template DNA used is not highly purified), higher
amounts of Taq DNA Polymerase (2-3u) may be necessary to
obtain a better yield of amplification products.
05/15/12 NBFGR karan veer singh
24. Template:
It’s not usually necessary to be incredibly
fastidious about how much template you
add to a reaction. You can get product
with incredibly small amounts of starting
DNA.
05/15/12 NBFGR karan veer singh