Primer design is important for PCR, cDNA synthesis, and DNA sequencing. There are general guidelines for primer design such as 18-30 base pairs in length, 40-60% GC content, melting temperature between 55-66°C. Primers should avoid secondary structures and mismatches at the 3' end. Common programs for primer design are Primer-BLAST and Primer3, which check specificity and secondary structures. Manual design is used for universal primers from multiple sequence alignments. The primers are then checked and optimized before being ordered and used in PCR experiments.
A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR). It monitors the amplification of a targeted DNA molecule during the PCR, i.e. in real-time, and not at its end, as in conventional PCR.
https://www.patreon.com/biotechlive
SUPPORT EDUCATION... SUPPORT US
Sanger sequencing is a method of DNA sequencing based on the selective incorporation of chain-terminating dideoxynucleotides by DNA polymerase during in vitro DNA replication.
In shotgun sequencing the genome is broken randomly into short fragments (1 to 2 kbp long) suitable for sequencing. The fragments are ligated into a suitable vector and then partially sequenced. Around 400–500 bp of sequence can be generated from each fragment in a single sequencing run. In some cases, both ends of a fragment are sequenced. Computerized searching for overlaps between individual sequences then assembles the complete sequence.
A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR). It monitors the amplification of a targeted DNA molecule during the PCR, i.e. in real-time, and not at its end, as in conventional PCR.
https://www.patreon.com/biotechlive
SUPPORT EDUCATION... SUPPORT US
Sanger sequencing is a method of DNA sequencing based on the selective incorporation of chain-terminating dideoxynucleotides by DNA polymerase during in vitro DNA replication.
In shotgun sequencing the genome is broken randomly into short fragments (1 to 2 kbp long) suitable for sequencing. The fragments are ligated into a suitable vector and then partially sequenced. Around 400–500 bp of sequence can be generated from each fragment in a single sequencing run. In some cases, both ends of a fragment are sequenced. Computerized searching for overlaps between individual sequences then assembles the complete sequence.
Basics of Primer designing.
Steps involved in designing primers for Prokaryotic expression
Steps involved in designing primers for Eukaryotic expression
High data quality and accuracy are recognized characteristics of Sanger re-sequencing projects and are primary reasons that next generation sequencing projects compliment their results by capillary electrophoresis data validation. We have developed an on-line tool called Primer Designer™ to streamline the NGS-to-Sanger sequencing workflow by taking the laborious task of PCR primer design out of the hands of the researcher by providing pre-designed assays for the human exome. The primer design tool has been created to enable scientists using next generation sequencing to quickly confirm variants discovered in their work by providing the means to quickly search, order and receive suitable pre-designed PCR primers for Sanger sequencing. Using the Primer Designer™ tool to design M13-tailed and non-tailed PCR primers for Sanger sequencing we will demonstrate validation of 28-variants across 24-amplicons and 19-genes using the BDD, BDTv1.1 and BDTv3.1 sequencing chemistries on the 3500xl Genetic Analyzer capillary electrophoresis platform.
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3QIAGEN
Using actual PCR Array data, this slidedeck presents an easy-to-use and free web-based data analysis tool to calculate fold-differences in gene expression from your raw real-time PCR threshold cycles. Learn how you can look at your results in different formats, including heat map, scatter, volcano, clustergram and multigroup plot.
Richard's aventures in two entangled wonderlandsRichard Gill
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Sérgio Sacani
Since volcanic activity was first discovered on Io from Voyager images in 1979, changes
on Io’s surface have been monitored from both spacecraft and ground-based telescopes.
Here, we present the highest spatial resolution images of Io ever obtained from a groundbased telescope. These images, acquired by the SHARK-VIS instrument on the Large
Binocular Telescope, show evidence of a major resurfacing event on Io’s trailing hemisphere. When compared to the most recent spacecraft images, the SHARK-VIS images
show that a plume deposit from a powerful eruption at Pillan Patera has covered part
of the long-lived Pele plume deposit. Although this type of resurfacing event may be common on Io, few have been detected due to the rarity of spacecraft visits and the previously low spatial resolution available from Earth-based telescopes. The SHARK-VIS instrument ushers in a new era of high resolution imaging of Io’s surface using adaptive
optics at visible wavelengths.
What is greenhouse gasses and how many gasses are there to affect the Earth.moosaasad1975
What are greenhouse gasses how they affect the earth and its environment what is the future of the environment and earth how the weather and the climate effects.
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...University of Maribor
Slides from:
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Track: Artificial Intelligence
https://www.etran.rs/2024/en/home-english/
This presentation explores a brief idea about the structural and functional attributes of nucleotides, the structure and function of genetic materials along with the impact of UV rays and pH upon them.
DERIVATION OF MODIFIED BERNOULLI EQUATION WITH VISCOUS EFFECTS AND TERMINAL V...Wasswaderrick3
In this book, we use conservation of energy techniques on a fluid element to derive the Modified Bernoulli equation of flow with viscous or friction effects. We derive the general equation of flow/ velocity and then from this we derive the Pouiselle flow equation, the transition flow equation and the turbulent flow equation. In the situations where there are no viscous effects , the equation reduces to the Bernoulli equation. From experimental results, we are able to include other terms in the Bernoulli equation. We also look at cases where pressure gradients exist. We use the Modified Bernoulli equation to derive equations of flow rate for pipes of different cross sectional areas connected together. We also extend our techniques of energy conservation to a sphere falling in a viscous medium under the effect of gravity. We demonstrate Stokes equation of terminal velocity and turbulent flow equation. We look at a way of calculating the time taken for a body to fall in a viscous medium. We also look at the general equation of terminal velocity.
Nucleophilic Addition of carbonyl compounds.pptxSSR02
Nucleophilic addition is the most important reaction of carbonyls. Not just aldehydes and ketones, but also carboxylic acid derivatives in general.
Carbonyls undergo addition reactions with a large range of nucleophiles.
Comparing the relative basicity of the nucleophile and the product is extremely helpful in determining how reversible the addition reaction is. Reactions with Grignards and hydrides are irreversible. Reactions with weak bases like halides and carboxylates generally don’t happen.
Electronic effects (inductive effects, electron donation) have a large impact on reactivity.
Large groups adjacent to the carbonyl will slow the rate of reaction.
Neutral nucleophiles can also add to carbonyls, although their additions are generally slower and more reversible. Acid catalysis is sometimes employed to increase the rate of addition.
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...Ana Luísa Pinho
Functional Magnetic Resonance Imaging (fMRI) provides means to characterize brain activations in response to behavior. However, cognitive neuroscience has been limited to group-level effects referring to the performance of specific tasks. To obtain the functional profile of elementary cognitive mechanisms, the combination of brain responses to many tasks is required. Yet, to date, both structural atlases and parcellation-based activations do not fully account for cognitive function and still present several limitations. Further, they do not adapt overall to individual characteristics. In this talk, I will give an account of deep-behavioral phenotyping strategies, namely data-driven methods in large task-fMRI datasets, to optimize functional brain-data collection and improve inference of effects-of-interest related to mental processes. Key to this approach is the employment of fast multi-functional paradigms rich on features that can be well parametrized and, consequently, facilitate the creation of psycho-physiological constructs to be modelled with imaging data. Particular emphasis will be given to music stimuli when studying high-order cognitive mechanisms, due to their ecological nature and quality to enable complex behavior compounded by discrete entities. I will also discuss how deep-behavioral phenotyping and individualized models applied to neuroimaging data can better account for the subject-specific organization of domain-general cognitive systems in the human brain. Finally, the accumulation of functional brain signatures brings the possibility to clarify relationships among tasks and create a univocal link between brain systems and mental functions through: (1) the development of ontologies proposing an organization of cognitive processes; and (2) brain-network taxonomies describing functional specialization. To this end, tools to improve commensurability in cognitive science are necessary, such as public repositories, ontology-based platforms and automated meta-analysis tools. I will thus discuss some brain-atlasing resources currently under development, and their applicability in cognitive as well as clinical neuroscience.
Seminar of U.V. Spectroscopy by SAMIR PANDASAMIR PANDA
Spectroscopy is a branch of science dealing the study of interaction of electromagnetic radiation with matter.
Ultraviolet-visible spectroscopy refers to absorption spectroscopy or reflect spectroscopy in the UV-VIS spectral region.
Ultraviolet-visible spectroscopy is an analytical method that can measure the amount of light received by the analyte.
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...University of Maribor
Slides from talk:
Aleš Zamuda: Remote Sensing and Computational, Evolutionary, Supercomputing, and Intelligent Systems.
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Inter-Society Networking Panel GRSS/MTT-S/CIS Panel Session: Promoting Connection and Cooperation
https://www.etran.rs/2024/en/home-english/
BREEDING METHODS FOR DISEASE RESISTANCE.pptxRASHMI M G
Plant breeding for disease resistance is a strategy to reduce crop losses caused by disease. Plants have an innate immune system that allows them to recognize pathogens and provide resistance. However, breeding for long-lasting resistance often involves combining multiple resistance genes
1. PCR primer design
Methee Sriprapun, PhD
(Principle and how to design primers)
Sriprapun.m@gmail.com
2. Objective of primer usage
•To generate cDNA for PCR assay
•To use as the origin of new DNA synthesis
•To use as the origin of DNA sequencing
http://seqcore.brcf.med.umich.edu/doc/educ/dnapr/sequencing.html http://kem-en-tec-nordic.com/pcr-page/
3. Types of primer
•Oligo dT (16-20 T primer) primes at the poly-A tail of mRNA
• Random hexamers: Total RNA template for cDNA
•Gene specific primer: usually uses reverse primer
http://www.thermoscientificbio.com/general-reagents-and-
accessories/primers-for-cdna-synthesis/
http://www.bio.davidson.edu/genomics/method/cDNAproduction.html
4. General guidelines for primer design
• Primer sizes: 18-30 bp
• 40-60% of GC contents in each primer
• Optimum temperature (Tm) of each primer should be 55-66 C and the
difference of forward and reverse primers should not more than 2 C
• 3’ end of each primer contains G or C (Last 5 bases: only 2G, 2C or GC)
• Avoid repetitive bases
• Avoid mismatch between primers and template at 3’end
5. General guidelines for primer
design (II)
•Avoid secondary structures:
- Hairpin
- Self-complementary
- Primer-dimer
3’ 5’
DNA template
5’ 3’ 3’ end of primer is important !
6. •Check primer specificity by blasting with database such as
GenBank
•Designed F primer: ready for use (primer synthesis)
•Designed R primer: reverse complement before Blast or
primer synthesis
•Primer-BLAST: not do reverse complement for R primer
•Design primers for qPCR: PCR product < 300 bp
General guidelines for primer
design (III)
8. Calculation of Tm and annealing
temperature
•Tm: temperature that makes dsDNA ssDNA 50%
Tm= 2 x (no. of [A+T]) + 4 x (no. of [G+C])
Annealing temp. = Tm of primer - 5
http://www.gravitywaves.com/chemistry/CHEMXL153/NucleotidesCompandStruc.htm
9. Tm calculation quiz
Tm= 2 x (no. of [A+T]) + 4 x (no. of [G+C])
Annealing temp. = Tm of primer - 5
Sequence Tm
(C)
Annealing
Temp. (C)
5’ GAT TAC TTG GGC AAG GCC GA 3’ 62 57
5’ ATG GGC AAT AAT TTG GGA 3’ 50 45
5’ ATT GGC AAG TTG AAG GCG GGG 3’ 64 59
5’ TTG TTG AAG AGC CCC GGA C 3’ 60 55
10. Reverse complement
• Reverse: change nt. sequence from (5’3’) to (3’5’)
• Complement with the reversed sequence
5’CTCCAAGCTCCAAGCTCCAG 3’
Reverse: 5’GACCTCGAACCTCGAACCTC 3’
Complement: 5’CTGGAGCTTGGAGCTTGGAG 3’
Courier New: suitable font for
typing DNA sequence
11. How to design primers
1. Manual design
- Download all interested sequences from GenBank and manually
select the position for primer design
- Multiple sequence alignment of all interested sequences from
and find the conserve position to generate “universal primers”
- Primer checking: length , %GC, Tm, specificity to DNA target,
etc.
- Advantage in primer design for multiplex PCR or probe design
in some specific work such as in situ hybridization
14. How to design primers (II)
1. Program design
- Using programs for primer design
- Fast, convenience, easy to adjust some parameters
- Not suitable for primer design in multiplex PCR
- Probe design for qPCR
- Limitation in modified primer design at 5’ end
16. Primer design with Primer-BLAST
http://www.ncbi.nlm.nih.gov/tools/primer-blast/
• Developed by NCBI
• Primer3 to design PCR primers + BLAST and
global alignment algorithm to screen primers
17. Primer-BLAST
• Primer design & BLAST primers with sequences in
database
• Can predict PCR product size from your own designed
primers
• Check primer specificity of your own designed primers
• Cons: Take time due to blast algorithm in primer design
program
18.
19. How to use primer-BLAST
• Choose gene of interest and avoid selecting gene location in intron
• Take gene sequence in the form of FASTA format, only sequence or
Accession No. in program
• Parameter setting and Click at “Get primers”
• Consider possibly designed primer by checking Tm, self-
complementary, GC content, etc.
• Ready to use designed primers ( no reverse complement of R primer)
20. Example: Design primer for human -actin detection (Tm = 60C
PCR product 100-300 bp)
Choose -actin (human) from NCBI
Take sequence or Accession No. into PCR template as mentioned in red arrow
You can either fill in or not
21. Set parameters: product size and Tm of primers
Change to “nr”
Fill in or not
Press “Get Primers”
22. Result
You obtained 5 pairs of primer from this program.
What can we retrieve from the program?
1. Primer characteristics and data
2. Size of PCR product
3. Primer specificity using BLAST algorithm
23. How to check secondary structure
OligoCalc
http://www.basic.northwestern.edu/biotools/oligocalc.html
24. Place each primer sequence here
Choose “ssDNA”
Click “calculate”
27. Primer design with Primer3
• Online program: “Primer3” and “Primer3Plus”
• Primer3Plus is improved in program efficiency but the
used parameters in Primer3 = Primer3Plus
29. Choose -actin (human) sequence from NCBI
Place sequence or upload FASTA file of interested sequence
Example: Design primer for human -actin detection (Tm = 60C
PCR product 100-300 bp)
30. Set parameter: Size of PCR product and Tm of primers
Click “Pick Primers”
32. You can find position of each
primer on your sequence of interest
Other details of designed primers
33. You can “CLICK” to order primer synhesis
You can blast each
primer with GenBank
34. You can use “primer-Blast” to check your designed primers from
Primer3 or Primer3Plus
Put each primer
here
Change to “nr”
Can fill it or Ignore
Click “Get Primers”
35. If you want to check secondary structure Program OligoCalc
No reverse complement in R primer
Pros: Fast and do not have a lot of time to run the program
Cons: Cannot blast both primers simultaneously and may require
other program to check self-complementary or secondary structure
36. Tips for consideration
•Program for primer design tool for prediction of
primers
•Designed primers may not 100% efficiency in the real situation
•The best designed Primers: Usually the first designed
sequences by each primer design program
•Program for primer design: Compass and tool for guiding your
work about how to design and optimize primers in PCR
•PRIMER Optimization in PCR should be
considered in the real situation !!!!!!
37. Primer design at a glance
Choose organisms or gene of interest from database such as
GenBank, EMBL, DDBJ, etc.
Download sequence in FASTA format or using Accession No. of interested gene
Primer design with appropriate program such as primer-BLAST, Primer3, Primer3Plus, etc.
Or manual design (universal primer multiple sequence alignment Choose conserve sequence)
Select suitable designedprimers from primer design program
Consider primer characterization such aslength, Tm, %GC, secondarystructure of primers, etc.
Final checkingof primer sequencesand order primer synthesis
Use the primers in PCR or RT-PCR and optimizationwith reagentsand PCR machine
as well as genome template