1. Primer design for PCR
Dr. Thoria Donia
Lecturer of Biochemistry, Faculty of Science,
Tanta University
thoria_donia@science.tanta.edu.eg
1
2. Primers
• Have different sequences
• Are complementary to the sequences on
the opposite strands of the template
DNA.
• flank the segment of target DNA that is
to be amplified.
2
3. Requirements for conventional PCR
• 1-A good starting template
• 2- Taq polymerase
• 3-Buffer solution
• 4- Designing primers
3
4. Resources for General Purpose PCR Primer Design
Primer3
Primer3Plus
PrimerZ
PerlPrimer
Vector NTI Advantage 10
IDT Primer quest tool
7. To check integrity of DNA
• By agarose gel electrophoresis
• Determination of the concentration of the DNA
The fact: 1 absorbance unit equates to 50 µg/ml
of DNA :
•
• Contaminants can be identified by scanning UV
spectrophotometry from 200 nm to 300 nm. A
ratio of 260nm: 280nm of approximately 1.8
indicates that the sample is free of protein
contamination, which absorbs strongly at 280
nm.
7
8. • A260/A230
(2.0-2.2).
Lower -----it may indicate the presence of
contaminants (Guanidine isothiocyanate and /or
phenol), which absorb at 230 nm.
14. • PCR product is produced in
sufficient quantities for
subsequent experimental
analysis.
14
15. PCR
(Replication of DNA in vitro)
• Can generate billions of copies of DNA in few
hours,
• ng of DNA can be amplified to get mg of DNA.
• is based on in vitro enzymatic amplification of
a specific target DNA sequence in a cyclic
process using two oligonucleotides (Primers).
15
16. The PCR reaction cannot be
completed without the primers?
• The DNA primer used in the amplification
provide 3′ end to the Taq DNA
polymerase for initiating the
amplification.
• Once the Primer: DNA junction is
recognised by the Taq DNA polymerase,
it starts adding dTNPs to the DNA strand
and synthesize the new DNA strand.
16
17. What is PCR primer?
• PCR primers are short single-stranded
DNA sequences which help in the
amplification of DNA during PCR
reaction.”
17
18. Applications of PCR
1. Detection of infectious diseases (PCR can be
used to detect the presence of a viral genome in
a sample of blood).
2. Detection of Variations and Mutations in Genes
3. Detects people with inherited disorders and
carriers.
4. Track presence or absence of DNA abnormalities
characteristic to cancer.
5. Prenatal diagnosis of genetic disorders.
18
19. PCR can be used to detect the presence of a viral
genome in a sample of blood
19
22. Primers guarantee the successfulness of a PCR
Specificity?
Proper
annealing to
the template?
23. Specificity and efficiency of primers
are important in primers design
• Specificity ?? mispriming will occur
when primers are poorly
designed……….leads to nonspecific
amplification of sequences found in
the template pool.
• Efficiency ?? An efficient primer pair
will produce a twofold increase in
amplicon for each cycle of the PCR. 23
25. Melting temperature (Tm)
The temperature at which 50% of the DNA duplex dissociates
to become single stranded
50% of the primer and its complement are hybridized
Tm=2(A+T)+4(G+C).
Optimal melting temperature 50°C-- 60°C
Tm above 65°C should be generally avoided because of the
potential for secondary annealing (hairpin, self dimer,
cross dimer)
Higher Tm (75°C-- 80°C) is recommended for amplifying
high GC content targets.
The difference in two primers melting temperature
should be 3 degree maximum.
26. • If you know melting temperature you can
calculate annealing temperature.
• Annealing temperature =Tm+/- 5 degree
• OR
• Annealing temperature = Tm of forward
primer+ Tm of reverse primer /2
26
27. Annealing temperature:
• A temperature at which primer can bind to its
complementary sequence.
• An ideal annealing temperature of the primer
is ranging between 56ºC to 65ºC.
• 5 degree lower than Tm
27
28. General rules for primer design
Specificity
Determined by primer length as well as sequence
The primer specificity is dependent on the nature of
the template used in the PCR reaction.
29. General rules for primer design
-- GC content; repeats and runs
Primer G/C content
Optimal G/C content: 45-55%
Common G/C content range: 40-60%.
Repeats
A repeat is a nucleotide sequence (a dinucleotide) that is repeated
(e.g. TCTCTCTCTC) should be avoided because they promote mispriming.
maximum number should be 4 di‐nucleotides.
Runs
Runs are repeated nucleotides (e.g. TAAAAAGC has a 5 bp run of Adenine).
Runs should also be avoided because they are prone to mispriming. The
maximum run should be no more than 3–4 bp.
At 3´ end C or G should be present
30. • Another requirements for PCR primers
• forward and reverse primers of similar length
and GC content.
• The Tm of both primers should be similar to
• 1-each other
• 2- the primer-binding sites at the ends of the
fragment to be amplified to achieve an optimal
annealing temperature and amplification.
• 3´-end complementarity between primers and
self complementarity within primers must be
avoided because it may increase primer-dimer
formation and reduce PCR efficiency.
30
32. Length of the primers:
• Primers of 18 to 23 nucleotide long
• If the primer is too short, annealing
temperature becomes lower and it reduces
amplification capacity.
• Long primers -----the annealing temperature is
too high----------leads to non-specific binding.
32
34. • 1-Copy FASTA format of sequence from NCBI
nucleotide database and paste it in primer 3
plus
34
35. FASTA format
• Simple database format to store sequence
data.
• The FASTA format consists of
• 1- A single header line that starts with the
character >.
• 2-followed (without a blank) by an identifier
and optionally a short description.
• 3-The subsequent lines contain the sequence
information
35
39. Use filters to select the right variant
for gene of interest
• 1- Species---Animals for example
• 2- mRNA
• 3- Ref seq
• 4- Organism------Homo sapiens
39
49. The colors shows the annealing site
of primer to your sequence.
49
50. To check if primers are ok or not
• Use oligo calc to check for self complementary
• Add sequence click calculate reverse
complement strand will appear then click
check for self complementary
50
52. Oligo calc is mainly used for
• for reporting DNA and RNA single-stranded
and double-stranded properties, including
molecular weight, solution concentration,
melting temperature, estimated absorbance
coefficients, inter-molecular self-
complementarity estimation and intra-
molecular hairpin loop formation.
52
70. Step 1: Obtain Sequence in FASTA
Format
For example human myoglobin
For designing primers
Choose one with accession number containing
NM
Variant means there are more than isoforms on
genome.
70
71. F11 for full screen view
then print screen and paste in word or powerpoint
page
71
73. From the previous page
• Click exons or coding sequence, they will be
selected in the sequence
• You choose the sequence according to the aim
of your experiment .
73
74. Click fasta and to save fasta sequence
follow the next steps
74
80. • You can exclude some regions on excluded
regions and detect the included region
• Check left and right primers.
80
81. In general settings
• Product size 700-1000
• The product size should include flanking
sequences around the sequence 50-100 bp
especially if you are going to perform
sequencing as the first part I read as noise in
sequencing machine
81
83. No.1 choice is the best
and they appear as pair 1 and 2 and so on
83
84. • Product size in different pairs are variable
• The first with repeated base more than 5 so
choose another one or modify general
settings as following
84
87. Copy in a word file as following
• Left forward
• F: gtatttcctcgctgtgtgactct
• Reverse right
• R:gtcaggtgtagttaatggcttgg
• You can save also the parameters chosen to
get these primers to avoid them if the primers
are not working.
87
88. To check if primers are ok or not
• Use oligo calc to check for self complementary
• Add sequence click calculate reverse
complement strand will appear then click
check for self complementary
88
98. In real time PCR
• Quantification of the amount of the RNA
present into the sample by using the
fluorescent dye or probe by synthesizing cDNA
from RNA using the reverse transcriptase
enzyme
98
123. Designing primers for real time PCR
• RT -PCR amplification of a particular
mRNA sequence requires two PCR
primers that are specific for that mRNA
sequence.
• The primer design should also allow
differentiation between the amplified
product of cDNA and an amplified
product derived from contaminating
genomic DNA. 123
124. Factors that affect the efficiency of a
qPCR
• include the amplicon length and primer
quality.
124
125. In a SYBR® Green‐based qPCR application,
specificity is very important
• SYBR® Green dye will bind to any dsDNA
present in the reaction mix, so amplification of
nonspecific products produces invalid data.
• Primer dimers may increase fluorescence,
resulting in inaccurate quantification of the
amplicon.
125
126. • Design primers that span exonl exon
junctions on the mRNA to avoid
introns sequences. Such primers
should not amplify genomic DNA.
126
127. Primer design for RT-PCR
Design amplicon to be 75–210 bp.
An amplicon should be at least 75 bp to easily
distinguish it from any primer-dimers that might form.
Avoid templates with long (>4) repeats of single bases
Maintain a GC content of 50–60%
Place Gs and Cs on ends of primers
Check sequence of forward and reverse primers to
ensure no 3‘ complementarity (avoid primer-dimer
formation)
Maintain a melting temperature (Tm) between 60C and
68C.
Verify specificity using
(http://www.ncbi.nlm.nih.gov/blast/)
128. Common Parameters of Primer
Design
• Primer Length
• The optimal length of primers 18–24 bp
Primer Melting Temperature (Tm)
• Primers of minimal length which have melting
temperatures (Tm) that are between 59 and 68
°C, with an optimal Tm of 63–64 °C.
• Tm of the primer pair should be within 1 °C of
each other.
128
129. • Annealing Temperature
• Optimal real‐time PCR annealing
temperatures are 59 °C or 60 °C.
• Product Size
• An ideal amplicon should be between 80 and
150 bp
• Mg++ Concentration
• The default is set to zero on most primer
design software. SYBR® Green buffer mixes
contain 3 to 6 mM of MgCl2.
129
130. • Repeats
• A repeat is a nucleotide sequence (a dinucleotide) that
is repeated (e.g. TCTCTCTCTC) should be avoided
because they promote mispriming.
• maximum number should be 4 di‐nucleotides.
• Runs
• Runs are repeated nucleotides (e.g. TAAAAAGC has a 5
bp run of Adenine). Runs should also be avoided
because they are prone to mispriming. The maximum
run should be no more than 3–4 bp.
130
131. • 3′ Stability
• the maximum ΔG of the 5 bases from the 3′
end of the primers.
• (ΔG is the Gibbs Free Energy, the energy
required to break the bonds present at the 3′
end).
• A higher 3′ stability will improve the efficiency
of the primer.
131
132. • GC Clamp
• the maximum ΔG of the 5 bases from the 5′
end of the primers.
• the 5′ stability refers to how stable the 5′ end
is due to the amount of Gs or Cs present at
the 5′ end of the primer. Having 1 to 2 GC
clamps are ideal, as it allows the primer to
bind strongly to the template strand, making it
more specific,
• avoid more than 2 GC clamps.
132
133. NCBI nucleotide database for gene of
interest
• In our case it is AKT3
• Filters as species :animals
• Ref seq and mRNA
• Organism Homo sapiens
145. Try another set using the same steps
• Set 4 would be the best
146. Analysis of gel using image J for
semiquantitative analysis of DNA
• https://www.youtube.com/watch?v=eazdPbE
HpDw
• You can follow what is illustrated in this link
146
147. steps you can follow as screen shot
• 1- open image J software from its setuped
icon
147
148. • Open the image of gel you want to analyze
• By clicking file menu then open
148