Open reading frame is part of reading frame that contains no stop codons or region of amino acids coding triple codons.
ORF starts with start codon and ends at stop codon.
Sequence alig Sequence Alignment Pairwise alignment:-naveed ul mushtaq
Sequence Alignment Pairwise alignment:- Global Alignment and Local AlignmentTwo types of alignment Progressive Programs for multiple sequence alignment BLOSUM Point accepted mutation (PAM)PAM VS BLOSUM
Sequence alig Sequence Alignment Pairwise alignment:-naveed ul mushtaq
Sequence Alignment Pairwise alignment:- Global Alignment and Local AlignmentTwo types of alignment Progressive Programs for multiple sequence alignment BLOSUM Point accepted mutation (PAM)PAM VS BLOSUM
An integrated publicly accessible bioinformatics resource to support genomic/proteomic research and scientific discovery.
Established in 1984, by the National Biomedical Research Foundation (NBRF) Georgetown University Medial Center, Washington D.C., USA.
It is the source of annotated protein databases and analysis tools for the researchers.
Serve as primary resource for the exploration of protein information.
Accessible by text search for entry and list retrieval, and also BLAST search and peptide match.
Scoring system is a set of values for qualifying the set of one residue being substituted by another in an alignment.
It is also known as substitution matrix.
Scoring matrix of nucleotide is relatively simple.
A positive value or a high score is given for a match & negative value or a low score is given for a mismatch.
Scoring matrices for amino acids are more complicated because scoring has to reflect the physicochemical properties of amino acid residues.
Automated sequencing of genomes require automated gene assignment
Includes detection of open reading frames (ORFs)
Identification of the introns and exons
Gene prediction a very difficult problem in pattern recognition
Coding regions generally do not have conserved sequences
Much progress made with prokaryotic gene prediction
Eukaryotic genes more difficult to predict correctly
What is Genome,Genome mapping,types of Genome mapping,linkage or genetic mapping,Physical mapping,Somatic cell hybridization
Radiation hybridization ,Fish( =fluorescence in - situ hybridization),Types of probes for FISH,applications,Molecular markers,Rflp(= Restriction fragment length polymorphism),RFLPs may have the following Applications;Advantages of rflp,disAdvantages of rflp, Rapd(=Random amplification of polymorphic DNA),Process of rapd, Difference between rflp &rapd
INTRODUCTION.
NCBI.
EMBL.
DDBJ.
CONCLUSION.
REFERENSE.
The National Center for Biotechnology Information (NCBI) is part of the United States National Library of Medicine (NLM), a branch of the National Institutes of Health.
The NCBI is located in Bethesda, Maryland and was founded in 1988 through legislation sponsored by Senator Claude Pepper.
The NCBI houses a series of databases relevant to biotechnology and biomedicine. Major databases include GenBank for DNA sequences and PubMed, a bibliographic database for the biomedical literature.
All these databases are available online through the Entrez search engine.
INTRODUCTION OF BIOINFORMATICS
HISTORY
WHAT IS DATABASE
NEED FOR DATABASE
TYPES OF DATABASE
PRIMARY DATABASE
NUCLEIC ACID SEQUENCE DATABASE
GENE BANK
INTRODUCTION
GENE BANK SUBMISSION TOOL
GENE BANK SUBMISSION TYPE
HOW TO RETRIEVE DATA FROM GENEBANK
APPLICATION
CONCLUSION
REFERENCE
It includes the information related to a bioinformatics tool BLAST (Basic Local Alignment Search Tool), BLAST is in-silico hybridisation to find regions of similarity between biological sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance. This presentation too contains the input - output format, Blast process and its types .
The Protein Data Bank (PDB) is a database for the three-dimensional structural data of large biological molecules, such as proteins and nucleic acids. This presentation deals with what, why, how, where and who of PDB. In this presentation we have also included briefing about various file formats available in PDB with emphasis on PDB file format
An integrated publicly accessible bioinformatics resource to support genomic/proteomic research and scientific discovery.
Established in 1984, by the National Biomedical Research Foundation (NBRF) Georgetown University Medial Center, Washington D.C., USA.
It is the source of annotated protein databases and analysis tools for the researchers.
Serve as primary resource for the exploration of protein information.
Accessible by text search for entry and list retrieval, and also BLAST search and peptide match.
Scoring system is a set of values for qualifying the set of one residue being substituted by another in an alignment.
It is also known as substitution matrix.
Scoring matrix of nucleotide is relatively simple.
A positive value or a high score is given for a match & negative value or a low score is given for a mismatch.
Scoring matrices for amino acids are more complicated because scoring has to reflect the physicochemical properties of amino acid residues.
Automated sequencing of genomes require automated gene assignment
Includes detection of open reading frames (ORFs)
Identification of the introns and exons
Gene prediction a very difficult problem in pattern recognition
Coding regions generally do not have conserved sequences
Much progress made with prokaryotic gene prediction
Eukaryotic genes more difficult to predict correctly
What is Genome,Genome mapping,types of Genome mapping,linkage or genetic mapping,Physical mapping,Somatic cell hybridization
Radiation hybridization ,Fish( =fluorescence in - situ hybridization),Types of probes for FISH,applications,Molecular markers,Rflp(= Restriction fragment length polymorphism),RFLPs may have the following Applications;Advantages of rflp,disAdvantages of rflp, Rapd(=Random amplification of polymorphic DNA),Process of rapd, Difference between rflp &rapd
INTRODUCTION.
NCBI.
EMBL.
DDBJ.
CONCLUSION.
REFERENSE.
The National Center for Biotechnology Information (NCBI) is part of the United States National Library of Medicine (NLM), a branch of the National Institutes of Health.
The NCBI is located in Bethesda, Maryland and was founded in 1988 through legislation sponsored by Senator Claude Pepper.
The NCBI houses a series of databases relevant to biotechnology and biomedicine. Major databases include GenBank for DNA sequences and PubMed, a bibliographic database for the biomedical literature.
All these databases are available online through the Entrez search engine.
INTRODUCTION OF BIOINFORMATICS
HISTORY
WHAT IS DATABASE
NEED FOR DATABASE
TYPES OF DATABASE
PRIMARY DATABASE
NUCLEIC ACID SEQUENCE DATABASE
GENE BANK
INTRODUCTION
GENE BANK SUBMISSION TOOL
GENE BANK SUBMISSION TYPE
HOW TO RETRIEVE DATA FROM GENEBANK
APPLICATION
CONCLUSION
REFERENCE
It includes the information related to a bioinformatics tool BLAST (Basic Local Alignment Search Tool), BLAST is in-silico hybridisation to find regions of similarity between biological sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance. This presentation too contains the input - output format, Blast process and its types .
The Protein Data Bank (PDB) is a database for the three-dimensional structural data of large biological molecules, such as proteins and nucleic acids. This presentation deals with what, why, how, where and who of PDB. In this presentation we have also included briefing about various file formats available in PDB with emphasis on PDB file format
RNA Sequence data analysis,Transcriptome sequencing, Sequencing steady state RNA in a sample is known as RNA-Seq. It is free of limitations such as prior knowledge about the organism is not required.
RNA-Seq is useful to unravel inaccessible complexities of transcriptomics such as finding novel transcripts and isoforms.
Data set produced is large and complex; interpretation is not straight forward.
Being able to identify genes, compare them, analyze them could be applied in various research areas from medical to industrial.
This ppt is designed for Health science and computational biology students to enable you understand the above mentioned topic.
You will write a Python program that finds all the ORFs in a genomicchandaronald
You will write a Python program that finds all the ORFs in a genomic sequence.
A genomic sequence has 6 reading frames, corresponding to the six possible ways of translating the sequence into three-letter codons. Frame 1 treats each group of three bases as a codon, starting from the first base. Frame 2 starts at the second base, and frame 3 starts at the third base. Frames 4, 5 and 6 are defined in a similar way, but refer to the opposite strand, which is the reverse complement of the first strand.
Specifications:
Write a Python program called orfs to find all the open reading frames (ORFs) in the input sequence.
INPUT: The program will take in as input a file, which will contain any number of DNA sequences in the FASTA format: - A line beginning with a ">" is the header line for the next sequence - All lines after the header contain sequence data. - There will be any number of sequences per file. - Sequences may be split over many lines. - Sequence data may be upper or lower case. - Sequence data may contain white space, which should be ignored.
Ask the user for the minimum ORF to search for. The default is 50, which means your program should print out all ORFs with at least 50 bases.
OUTPUT:
Print your output in FASTA format, with one header line for each ORF, followed by the DNA in the ORF. The header should be the same as the header in the input file, followed by a bar "|" followed by FRAME = POS = LEN = , where is the frame number (1-6)
is the genomic position of the start of the ORF (left end is base 1) is the length of the ORF (in bases) If N = 4, 5 or 6, then P should be a negative number that indicates the position of the start of the ORF from the right end of the sequence. The DNA in the ORF should be printed out with a space between each codon, and no more than 15 codons per line.
...
RECOMBINATION MOLECULAR BIOLOGY PPT UPDATED new.pptxSabahat Ali
This ppt is about recombination and where it occurs. Types of recombination and models of recombination along with many factors in prokaryotic and eukaryotic recombination
Folding depends upon sequence of Amino Acids not the Composition. Folding starts with the secondary structure and ends at quaternary structure.
Denaturation occur at secondary, tertiary & quaternary level but not at primary level.
Tertiary Structure basically of Hydrophobic interactions, (interactions in side chains), hydrogen bonding, salt bridges, Vander Waals interactions.
e.g. Globular proteins & Fibrous Proteins
THE IMPORTANCE OF MARTIAN ATMOSPHERE SAMPLE RETURN.Sérgio Sacani
The return of a sample of near-surface atmosphere from Mars would facilitate answers to several first-order science questions surrounding the formation and evolution of the planet. One of the important aspects of terrestrial planet formation in general is the role that primary atmospheres played in influencing the chemistry and structure of the planets and their antecedents. Studies of the martian atmosphere can be used to investigate the role of a primary atmosphere in its history. Atmosphere samples would also inform our understanding of the near-surface chemistry of the planet, and ultimately the prospects for life. High-precision isotopic analyses of constituent gases are needed to address these questions, requiring that the analyses are made on returned samples rather than in situ.
Cancer cell metabolism: special Reference to Lactate PathwayAADYARAJPANDEY1
Normal Cell Metabolism:
Cellular respiration describes the series of steps that cells use to break down sugar and other chemicals to get the energy we need to function.
Energy is stored in the bonds of glucose and when glucose is broken down, much of that energy is released.
Cell utilize energy in the form of ATP.
The first step of respiration is called glycolysis. In a series of steps, glycolysis breaks glucose into two smaller molecules - a chemical called pyruvate. A small amount of ATP is formed during this process.
Most healthy cells continue the breakdown in a second process, called the Kreb's cycle. The Kreb's cycle allows cells to “burn” the pyruvates made in glycolysis to get more ATP.
The last step in the breakdown of glucose is called oxidative phosphorylation (Ox-Phos).
It takes place in specialized cell structures called mitochondria. This process produces a large amount of ATP. Importantly, cells need oxygen to complete oxidative phosphorylation.
If a cell completes only glycolysis, only 2 molecules of ATP are made per glucose. However, if the cell completes the entire respiration process (glycolysis - Kreb's - oxidative phosphorylation), about 36 molecules of ATP are created, giving it much more energy to use.
IN CANCER CELL:
Unlike healthy cells that "burn" the entire molecule of sugar to capture a large amount of energy as ATP, cancer cells are wasteful.
Cancer cells only partially break down sugar molecules. They overuse the first step of respiration, glycolysis. They frequently do not complete the second step, oxidative phosphorylation.
This results in only 2 molecules of ATP per each glucose molecule instead of the 36 or so ATPs healthy cells gain. As a result, cancer cells need to use a lot more sugar molecules to get enough energy to survive.
Unlike healthy cells that "burn" the entire molecule of sugar to capture a large amount of energy as ATP, cancer cells are wasteful.
Cancer cells only partially break down sugar molecules. They overuse the first step of respiration, glycolysis. They frequently do not complete the second step, oxidative phosphorylation.
This results in only 2 molecules of ATP per each glucose molecule instead of the 36 or so ATPs healthy cells gain. As a result, cancer cells need to use a lot more sugar molecules to get enough energy to survive.
introduction to WARBERG PHENOMENA:
WARBURG EFFECT Usually, cancer cells are highly glycolytic (glucose addiction) and take up more glucose than do normal cells from outside.
Otto Heinrich Warburg (; 8 October 1883 – 1 August 1970) In 1931 was awarded the Nobel Prize in Physiology for his "discovery of the nature and mode of action of the respiratory enzyme.
WARNBURG EFFECT : cancer cells under aerobic (well-oxygenated) conditions to metabolize glucose to lactate (aerobic glycolysis) is known as the Warburg effect. Warburg made the observation that tumor slices consume glucose and secrete lactate at a higher rate than normal tissues.
Richard's aventures in two entangled wonderlandsRichard Gill
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
This presentation explores a brief idea about the structural and functional attributes of nucleotides, the structure and function of genetic materials along with the impact of UV rays and pH upon them.
Introduction:
RNA interference (RNAi) or Post-Transcriptional Gene Silencing (PTGS) is an important biological process for modulating eukaryotic gene expression.
It is highly conserved process of posttranscriptional gene silencing by which double stranded RNA (dsRNA) causes sequence-specific degradation of mRNA sequences.
dsRNA-induced gene silencing (RNAi) is reported in a wide range of eukaryotes ranging from worms, insects, mammals and plants.
This process mediates resistance to both endogenous parasitic and exogenous pathogenic nucleic acids, and regulates the expression of protein-coding genes.
What are small ncRNAs?
micro RNA (miRNA)
short interfering RNA (siRNA)
Properties of small non-coding RNA:
Involved in silencing mRNA transcripts.
Called “small” because they are usually only about 21-24 nucleotides long.
Synthesized by first cutting up longer precursor sequences (like the 61nt one that Lee discovered).
Silence an mRNA by base pairing with some sequence on the mRNA.
Discovery of siRNA?
The first small RNA:
In 1993 Rosalind Lee (Victor Ambros lab) was studying a non- coding gene in C. elegans, lin-4, that was involved in silencing of another gene, lin-14, at the appropriate time in the
development of the worm C. elegans.
Two small transcripts of lin-4 (22nt and 61nt) were found to be complementary to a sequence in the 3' UTR of lin-14.
Because lin-4 encoded no protein, she deduced that it must be these transcripts that are causing the silencing by RNA-RNA interactions.
Types of RNAi ( non coding RNA)
MiRNA
Length (23-25 nt)
Trans acting
Binds with target MRNA in mismatch
Translation inhibition
Si RNA
Length 21 nt.
Cis acting
Bind with target Mrna in perfect complementary sequence
Piwi-RNA
Length ; 25 to 36 nt.
Expressed in Germ Cells
Regulates trnasposomes activity
MECHANISM OF RNAI:
First the double-stranded RNA teams up with a protein complex named Dicer, which cuts the long RNA into short pieces.
Then another protein complex called RISC (RNA-induced silencing complex) discards one of the two RNA strands.
The RISC-docked, single-stranded RNA then pairs with the homologous mRNA and destroys it.
THE RISC COMPLEX:
RISC is large(>500kD) RNA multi- protein Binding complex which triggers MRNA degradation in response to MRNA
Unwinding of double stranded Si RNA by ATP independent Helicase
Active component of RISC is Ago proteins( ENDONUCLEASE) which cleave target MRNA.
DICER: endonuclease (RNase Family III)
Argonaute: Central Component of the RNA-Induced Silencing Complex (RISC)
One strand of the dsRNA produced by Dicer is retained in the RISC complex in association with Argonaute
ARGONAUTE PROTEIN :
1.PAZ(PIWI/Argonaute/ Zwille)- Recognition of target MRNA
2.PIWI (p-element induced wimpy Testis)- breaks Phosphodiester bond of mRNA.)RNAse H activity.
MiRNA:
The Double-stranded RNAs are naturally produced in eukaryotic cells during development, and they have a key role in regulating gene expression .
What is greenhouse gasses and how many gasses are there to affect the Earth.moosaasad1975
What are greenhouse gasses how they affect the earth and its environment what is the future of the environment and earth how the weather and the climate effects.
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...Ana Luísa Pinho
Functional Magnetic Resonance Imaging (fMRI) provides means to characterize brain activations in response to behavior. However, cognitive neuroscience has been limited to group-level effects referring to the performance of specific tasks. To obtain the functional profile of elementary cognitive mechanisms, the combination of brain responses to many tasks is required. Yet, to date, both structural atlases and parcellation-based activations do not fully account for cognitive function and still present several limitations. Further, they do not adapt overall to individual characteristics. In this talk, I will give an account of deep-behavioral phenotyping strategies, namely data-driven methods in large task-fMRI datasets, to optimize functional brain-data collection and improve inference of effects-of-interest related to mental processes. Key to this approach is the employment of fast multi-functional paradigms rich on features that can be well parametrized and, consequently, facilitate the creation of psycho-physiological constructs to be modelled with imaging data. Particular emphasis will be given to music stimuli when studying high-order cognitive mechanisms, due to their ecological nature and quality to enable complex behavior compounded by discrete entities. I will also discuss how deep-behavioral phenotyping and individualized models applied to neuroimaging data can better account for the subject-specific organization of domain-general cognitive systems in the human brain. Finally, the accumulation of functional brain signatures brings the possibility to clarify relationships among tasks and create a univocal link between brain systems and mental functions through: (1) the development of ontologies proposing an organization of cognitive processes; and (2) brain-network taxonomies describing functional specialization. To this end, tools to improve commensurability in cognitive science are necessary, such as public repositories, ontology-based platforms and automated meta-analysis tools. I will thus discuss some brain-atlasing resources currently under development, and their applicability in cognitive as well as clinical neuroscience.
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Sérgio Sacani
Since volcanic activity was first discovered on Io from Voyager images in 1979, changes
on Io’s surface have been monitored from both spacecraft and ground-based telescopes.
Here, we present the highest spatial resolution images of Io ever obtained from a groundbased telescope. These images, acquired by the SHARK-VIS instrument on the Large
Binocular Telescope, show evidence of a major resurfacing event on Io’s trailing hemisphere. When compared to the most recent spacecraft images, the SHARK-VIS images
show that a plume deposit from a powerful eruption at Pillan Patera has covered part
of the long-lived Pele plume deposit. Although this type of resurfacing event may be common on Io, few have been detected due to the rarity of spacecraft visits and the previously low spatial resolution available from Earth-based telescopes. The SHARK-VIS instrument ushers in a new era of high resolution imaging of Io’s surface using adaptive
optics at visible wavelengths.
Professional air quality monitoring systems provide immediate, on-site data for analysis, compliance, and decision-making.
Monitor common gases, weather parameters, particulates.
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...Scintica Instrumentation
Intravital microscopy (IVM) is a powerful tool utilized to study cellular behavior over time and space in vivo. Much of our understanding of cell biology has been accomplished using various in vitro and ex vivo methods; however, these studies do not necessarily reflect the natural dynamics of biological processes. Unlike traditional cell culture or fixed tissue imaging, IVM allows for the ultra-fast high-resolution imaging of cellular processes over time and space and were studied in its natural environment. Real-time visualization of biological processes in the context of an intact organism helps maintain physiological relevance and provide insights into the progression of disease, response to treatments or developmental processes.
In this webinar we give an overview of advanced applications of the IVM system in preclinical research. IVIM technology is a provider of all-in-one intravital microscopy systems and solutions optimized for in vivo imaging of live animal models at sub-micron resolution. The system’s unique features and user-friendly software enables researchers to probe fast dynamic biological processes such as immune cell tracking, cell-cell interaction as well as vascularization and tumor metastasis with exceptional detail. This webinar will also give an overview of IVM being utilized in drug development, offering a view into the intricate interaction between drugs/nanoparticles and tissues in vivo and allows for the evaluation of therapeutic intervention in a variety of tissues and organs. This interdisciplinary collaboration continues to drive the advancements of novel therapeutic strategies.
2. • In molecular genetics, an open reading frame (ORF) is
the part of a reading frame that contains no stop codons
or region of amino acids coding triplet codons
• An ORF starts with a start codon ATG (Met) in most species
and ends with a stop codon (TAA, TAG, TGA)
• Transcription termination pause site is located after ORF
ORFs
• One common use of open reading frames is as one piece of
evidence to assist in gene prediction
• Potential coding regions of a gene are detected by looking at
ORFs in a DNA sequence
Genomic Sequence
Open reading frame
ATG TGA
3. Identifying ORFs
(Open Reading Frames)
Simple First Step In Gene Finding
– A genome of length n is comprised of (n/3) codons
– Stop codons break genome into segments between
consecutive Stop codons
– Segments of these that start from Start codon (ATG) are
ORFs
• ORFs in different frames may overlap
• Genomic sequence is translated in codon frames
• Stop codons are identified in each frame
• Regions without stop codons are called ORFs
• All of the likely ORFs in a sequence are located and tagged
• Longest ORF from a Met codon is a good prediction of a protein
encoding sequence
4. Reading sequence of DNA in six reading frames
• Every region of DNA has six possible reading frames;
- Three in the forward direction
- Three in the reverse direction
Frame 1 starts with the "a", Frame 2 with the "t" and Frame 3 with the "g“
5' atgcccaagctgaatagcgtagaggggttttcatcatttgaggacgatgtataa 3'
1 atg ccc aag ctg aat agc gta gag ggg ttt tca tca ttt gag gac gat gta taa
M P K L N S V E G F S S F E D D V *
2 tgc cca agc tga ata gcg tag agg ggt ttt cat cat ttg agg acg atg tat
C P S * I A * R G F H H L R T M Y
3 gcc caa gct gaa tag cgt aga ggg gtt ttc atc att tga gga cga tgt ata
A Q A E * R R G V F I I * G R C I
Stop codons are indicated by an "*" in the protein sequence
The longest ORF is in Frame 1
5. SOFTWARES TO FIND ORFs
• ORF Finder: It is a graphical analysis tool which finds all
open reading frames of a selectable minimum size in a user's
sequence or in a sequence already in the database
• ORF Investigator: It is a program which not only gives
information about the coding and non-coding sequences but
also can perform pairwise global alignment of different
gene/DNA regions sequences
• ORF Predictor: It is a web server designed for identifying
protein-coding regions in expressed sequence tag (EST)-
derived sequences
6. SOFTWARES TO FIND ORFs
• ORF Finder: It is a graphical analysis tool which finds all
open reading frames of a selectable minimum size in a user's
sequence or in a sequence already in the database
• ORF Investigator: It is a program which not only gives
information about the coding and non-coding sequences but
also can perform pairwise global alignment of different
gene/DNA regions sequences
• ORF Predictor: It is a web server designed for identifying
protein-coding regions in expressed sequence tag (EST)-
derived sequences
