DNA Nanotechnology: Concept and its Applications
DNA Nanotechnology # Various 2 and 3 dimensional shapes of DNA nanotechnology # DNA Origami # with their application and Future scope
Protein based nanostructures for biomedical applications karoline Enoch
Proteins are kind of natural molecules that show unique
functionalities and properties in biological materials and
manufacturing feld. Tere are numerous nanomaterials
which are derived from protein, albumin, and gelatin. Tese
nanoparticles have promising properties like biodegradability, nonantigenicity, metabolizable, surface modifer, greater
stability during in vivo during storage, and being relatively
easy to prepare and monitor the size of the particles.
These particles have the ability to attach covalently with
drug and ligand
Nanomaterials in biomedical applicationsumeet sharma
An introduction to emerging technology in medicinal science, "nanodrugs" a fruitful combination of nano-science and medical science. In this presentation, use of nano shells for delivery of drugs to targeted cancer cells has been explained. along with In Vivo and In Vitro studies on use of nanomaterials for biomedical application. For any information please feel free to contact me or refer to the references.
Introduction
Definition
History
Advantages of nanobiotechnology
Applications of nanobiotechnology
Drawback of nanobiotechnology
New features in the nanobiotechnology
Conclusion
References
DNA Nanotechnology: Concept and its Applications
DNA Nanotechnology # Various 2 and 3 dimensional shapes of DNA nanotechnology # DNA Origami # with their application and Future scope
Protein based nanostructures for biomedical applications karoline Enoch
Proteins are kind of natural molecules that show unique
functionalities and properties in biological materials and
manufacturing feld. Tere are numerous nanomaterials
which are derived from protein, albumin, and gelatin. Tese
nanoparticles have promising properties like biodegradability, nonantigenicity, metabolizable, surface modifer, greater
stability during in vivo during storage, and being relatively
easy to prepare and monitor the size of the particles.
These particles have the ability to attach covalently with
drug and ligand
Nanomaterials in biomedical applicationsumeet sharma
An introduction to emerging technology in medicinal science, "nanodrugs" a fruitful combination of nano-science and medical science. In this presentation, use of nano shells for delivery of drugs to targeted cancer cells has been explained. along with In Vivo and In Vitro studies on use of nanomaterials for biomedical application. For any information please feel free to contact me or refer to the references.
Introduction
Definition
History
Advantages of nanobiotechnology
Applications of nanobiotechnology
Drawback of nanobiotechnology
New features in the nanobiotechnology
Conclusion
References
introduction to Nanobiotechnology
what is nanotechnology
bionanotechnology
classical biotechnology industrial production using biological system
modern biotechnology from industrial processes to noval therapeutics
modern biotechnology immunological enzymatic and neucleic acid based technology
Dna based technology
self assembly and supramolecular chemistry
formation of ordered structure at nano scale
Ab Initio Protein Structure Prediction is a method to determine the tertiary structure of protein in the absence of experimentally solved structure of a similar/homologous protein. This method builds protein structure guided by energy function.
I had prepared this presentation for an internal project during my masters degree course.
Nanostructure DNA Templates
Synthesis and Purification of Plasmid templates # Fabrication and Preparation of ultrathin carbon-coated TEM Grids # Preparation of Q-CdS/pUCLeu4 or Q-CdS/φχ174 RF II plasmd samples # their characterization
Quantum-confined cadmium sulfide nanoparticles (Q-CdS) formed circular DNA plasmid pUCLeu4 and φχ174 RF II Quantum confined cadmium sulfide
Introduction
Nanoparticle characterization techniques
Electron Microscope
Scanning electron microscope
Transmission electron Microscope
X-ray powder diffraction
Nuclear Magnetic Resonance
This talk provides a review of the current status of research related to self-assembling DNA nanotechnology (particularly DNA nanostructures, synthetic biology, and DNA origami scaffolding structures) and how the self-assembly of artificial systems might be applied in the context of neuro-nanomedicine. One application of self-assembling DNA nanotechnology might be new forms of brain-computer interfaces (BCIs) that are less invasive than current computer chip-based hardware solutions. Another application of self-assembling DNA nanotechnology might be high-resolution neocortical recording devices where synthetic molecules would assemble a DNA signature every time a neuron was fired.
introduction to Nanobiotechnology
what is nanotechnology
bionanotechnology
classical biotechnology industrial production using biological system
modern biotechnology from industrial processes to noval therapeutics
modern biotechnology immunological enzymatic and neucleic acid based technology
Dna based technology
self assembly and supramolecular chemistry
formation of ordered structure at nano scale
Ab Initio Protein Structure Prediction is a method to determine the tertiary structure of protein in the absence of experimentally solved structure of a similar/homologous protein. This method builds protein structure guided by energy function.
I had prepared this presentation for an internal project during my masters degree course.
Nanostructure DNA Templates
Synthesis and Purification of Plasmid templates # Fabrication and Preparation of ultrathin carbon-coated TEM Grids # Preparation of Q-CdS/pUCLeu4 or Q-CdS/φχ174 RF II plasmd samples # their characterization
Quantum-confined cadmium sulfide nanoparticles (Q-CdS) formed circular DNA plasmid pUCLeu4 and φχ174 RF II Quantum confined cadmium sulfide
Introduction
Nanoparticle characterization techniques
Electron Microscope
Scanning electron microscope
Transmission electron Microscope
X-ray powder diffraction
Nuclear Magnetic Resonance
This talk provides a review of the current status of research related to self-assembling DNA nanotechnology (particularly DNA nanostructures, synthetic biology, and DNA origami scaffolding structures) and how the self-assembly of artificial systems might be applied in the context of neuro-nanomedicine. One application of self-assembling DNA nanotechnology might be new forms of brain-computer interfaces (BCIs) that are less invasive than current computer chip-based hardware solutions. Another application of self-assembling DNA nanotechnology might be high-resolution neocortical recording devices where synthetic molecules would assemble a DNA signature every time a neuron was fired.
Nanobiotechnological applications in dna therapySenthil Natesan
Gene therapy is a form of molecular medicine that has the potential to influence significantly human health in this 21st century. It promises to provide new treatments for a large number of inherited and acquired diseases (Verma and Weitzman, 2005). The basic concept of gene therapy is simple which includes introduction of a piece of genetic material into target cells that will result in either a cure for the disease or a slowdown in the progression of the disease. To achieve this goal, gene therapy requires technologies capable of gene transfer into a wide variety of cells, tissues, and organs. A key factor in the success of gene therapy is the development of delivery systems that are capable of efficient gene transfer in a variety of tissues, without causing any associated pathogenic effects. Vectors based upon many different viral systems, including retroviruses, lentiviruses, adenoviruses, and adeno-associated viruses, currently offer the best choice for efficient gene delivery.
Nanotechnology: Basic introduction to the nanotechnology.Sathya Sujani
This simple presentation will help you to understand the every aspects of nanotechnology including basic definition and it's practical application in a very simple yet precise manner.
Nanotechnology and potential in Cancer therapy and treatmentladen12
this presentation focuses on new nanotechnology and it possible use in detection and therapy with cancer. it was prepared by final year biochemistry student at NCU.
INTRODUCTION
DEFINITION
HISTORY
METHODS OF DNA SEQUENCING
MAXAM GILBERT METHOD
SANGERS METHOD
AUTOMATED DNA SEQUENCER
PYROSEQUENCING
SHOTGUN SEQUENCING
DNA MICROARRAY
APPLICATION
CONCLUSION
REFRENCES
The Genome editing Era (CRISPER Cas 9) : State of the Art and Perspectives fo...Anand Choudhary
Role of CRISPR/Cas9 in plant pathology
Production of disease resistance cultivars by editing the genome which is responsible for susceptibility factor for fungal and bacterial diseases.
By editing the genome which governs host pathogen interaction we can obtain incompatible interaction between host pathogen.
To improve the efficacy of bio control agents.
By editing the genome responsible for virus multiplication and virulence we can obtain virus free resistance cultivars.
The Genome-editing Era (CRISPER Cas 9) : State of the Art and Perspectives fo...ANAND CHOUDHARY
Role of CRISPR/Cas9 in plant pathology
Production of disease resistance cultivars by editing the genome which is responsible for susceptibility factor for fungal and bacterial diseases.
By editing the genome which governs host pathogen interaction we can obtain incompatible interaction between host pathogen.
To improve the efficacy of bio control agents.
By editing the genome responsible for virus multiplication and virulence we can obtain virus free resistance cultivars.
DNA microarrays
– DNA molecules printed at high density used to determine
the level of RNA or DNA in a sample.
– Can be thought of a “reverse Northern blots”
Introduction
Nucleic Acid Sequencing
Types of Nucleic Acid Sequencing
DNA Sequencing
Method of DNA Sequencing
Applications of DNA Sequencing
Conclusion
References
DNA sequencing: rapid improvements and their implicationsJeffrey Funk
these slides analyze the rapid improvements in DNA sequencers and the implications for these rapid improvements for drug discovery, new crops, materials creation, and new bio-fuels. Many of the rapid improvements are from "reductions in scale." As with integrated circuits, reducing the size of features on DNA sequencers has enabled many orders of magnitude improvements in them. Unlike integrated circuits, the improvements are also due to changes in technology. For example, changes from pyrosequencing to semiconductor and nanopore sequencing have also been needed to achieve the reductions in scale. Second, pyrosequencing also benefited from improvements in lasers and camera chips.
The CRISPR/Cas9 system has emerged as one of the leading tools for modifying genomes of organisms ranging from E. coli to humans. Additionally, the simple gene targeting mechanism of CRISPR technology has been modified and adapted to other applications that include gene regulation, detection of intercellular trafficking, and pathogen detection. With a wealth of methods for introducing Cas9 and gRNAs into cells, it can be challenging to decide where to start. In this presentation, Dr Adam Clore describes the CRISPR mechanism and some of the most prominent uses for CRISPR, along with methods where IDT technologies can assist scientists in designing, testing, and executing a variety of CRISPR-mediated experiments. For more informaton, visit: http://www.idtdna.com/crispr
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
Francesca Gottschalk - How can education support child empowerment.pptxEduSkills OECD
Francesca Gottschalk from the OECD’s Centre for Educational Research and Innovation presents at the Ask an Expert Webinar: How can education support child empowerment?
Safalta Digital marketing institute in Noida, provide complete applications that encompass a huge range of virtual advertising and marketing additives, which includes search engine optimization, virtual communication advertising, pay-per-click on marketing, content material advertising, internet analytics, and greater. These university courses are designed for students who possess a comprehensive understanding of virtual marketing strategies and attributes.Safalta Digital Marketing Institute in Noida is a first choice for young individuals or students who are looking to start their careers in the field of digital advertising. The institute gives specialized courses designed and certification.
for beginners, providing thorough training in areas such as SEO, digital communication marketing, and PPC training in Noida. After finishing the program, students receive the certifications recognised by top different universitie, setting a strong foundation for a successful career in digital marketing.
2. Shrishaila cd
Dept of Genetics and Plant B
DNA NANOTECHNOLOGY
SEMINAR 2
ON
Shrishaila CD(GPB) UASR
3. Introduction
History of Nanotechnology
Nano particles
Applications of Nanotechnology
DNA Nanotechnology
DNA Nano Structures
Case Studies
Applications of DNA Nanotechnology
Conclusions
Shrishaila CD(GPB) UASR
4. Nanotechnology
“Nanotechnology is the art and science of manipulating matter at
nanoscale”
‘Nano’ is a Greek word, means Dwarf
1 nm = 10ˉ⁹ m i.e. one billionth of a meter
Shrishaila CD(GPB) UASR
6. Richard Feynman,
Father of nanotechnology
Nobel Laureate(Physics)1965
Norio Taniguchi
coined the term “Nanotechnology” (1974)
Michael Faraday
1831
Shrishaila CD(GPB) UASR
8. (Royal Society and Royal Academy of Engineering, 2004)
TOP DOWN APPROACH
METHODS OF NANOPARTICLE PRODUCTION
Shrishaila CD(GPB) UASR
9. (Royal Society and Royal Academy of Engineering, 2004)
BOTTOM UPAPPROACH
Shrishaila CD(GPB) UASR
10. Properties of Nano particles
• Every substance regardless of composition exhibits new properties
when the size is reduced to nano scale
• Properties of material is changed due to quantum effect
Shrishaila CD(GPB) UASR
11. Things behave differently in nano-world
Carbon in the form of Graphite (i.e. pencil lead) is
soft, at the nano-scale, can be stronger than steel and
is six times lighter
Nano-scale copper is a highly elastic metal at room
temperature, stretching to 50 times its original length
without breaking
Shiny orange yellow Gold changes its colour to
brownish black on reducing the size
Absorption of solar radiation in photovoltaic cells is
much higher in nanoparticles than it is in thin films
of continuous sheets of bulk material
Shrishaila CD(GPB) UASR
14. In Agriculture and Allied Sciences
Food science and technology
Smart packaging with Nano silicon embedded durethan polymer to enhance
the shelf life of the food materials
Seed technology
Use of carbon Nanotubes increases the germination through better penetration
of the moisture
Soil remediation
Nanotech-based soil binder called SoilSet employed to avoid soil erosion
Water treatments
magnetite (iron oxide) nanocrystals to capture and remove arsenic from
contaminated water
Agricultural Engineering Issues
Nano coating of agricultural tools to increase their resistance against wear
and corrosion Shrishaila CD(GPB) UASR
15. Operates like human nose &Identify different
types of odours and their concentrations
e-Nose
Medicine Cancer treatment ,Bone treatment, Drug delivery
Smaller, faster, more energy efficient and
powerful computing and other IT-based systems
Information
Technology
Advanced packaging materials, sensors
and lab-on-chips for food quality testing
Foods and
beverages
Shrishaila CD(GPB) UASR
17. It is the design and manufacture of artificial nucleic acid structures
for technological uses
Also known as Nucleic Acid Nanotechnology
DNA is the carrier of Genetic information but here used as a
structural component
Shrishaila CD(GPB) UASR
18. History of DNA Nanotechnology
• 1964-Holliday Junction
• 1970-Sticky Ends
• 1980-DNA Nanotechnology
• 1991-first synthetic 3D DNA Nanostructure developed
• 1998-2D DNA Lattice
• 2006-2D DNA Origami developed
• 2009-3D DNA Origami developed
Shrishaila CD(GPB) UASR
19. DNA nanotechnology was first laid out by Nadrian C Seeman in
the early 1980s
In 1991, Seeman's laboratory published a report on the first synthetic
cube made up of DNA
Shrishaila CD(GPB) UASR
21. Why DNA IN NANO WORLD
• Basic Geometric and Thermodynamic properties of DNA are well known
and predictable by available software's like TILE SOFT, GenoCAD
• DNA’s Ladder like structure provides the key frame work to the
scientists
• Existence of commercially available modifying enzymes
• Persistent length of DNA is about 500Å
• Self assembly property of DNA makes easy to construct the variety of
structures in a predictable manner
• Shapes of DNA nanostructures can be controllable
• Synthesis of SsDNA is less expensive
• Assembled structures can be characterized by various techniques like
AFM,TEM,CryoEM
Shrishaila CD(GPB) UASR
22. Construction of DNA Nanostructures
Mainly by using the following motifs
• Stem loop(Hair pin) structure
• Sticky ends
• Holliday Junction
Shrishaila CD(GPB) UASR
23. Unpaired region occur in Ss DNA or RNA
The structure is also known as a hairpin or hairpin loop
Shrishaila CD(GPB) UASR
24. Sticky ends
• An overhang is a stretch of unpaired nucleotides in the end of a DNA
molecule
• These overhangs are in most cases Palindromic
• Sticky ends are often used to combine two DNA nanostructures
together via hybridization of their complementary SsDNA
Shrishaila CD(GPB) UASR
25. Holliday junction
• Robin Holliday proposed its existence in 1964
• Two parallel DNA helices form a junction with one strand of each
DNA helix crossing over to the other DNA helix
Shrishaila CD(GPB) UASR
27. DNA Lattice
A DNA tile is a DNA nanostructure that has a number of
sticky ends on its sides, which are termed pads
A DNA lattice is a DNA nanostructure composed of a
group of DNA tiles that are assembled together via
hybridization of their pads
Winfree, Yang and Seeman (1996) developed a family
of DNA tiles known collectively as DX tiles
Shrishaila CD(GPB) UASR
28. DNA Cube
• It is the first 3D DNA Structure
• DNA Axes connected to form the cube
• Each edge of the cube has 2 molecules
of dsDNA which are connected to
each other
• It contains 6 different strands
Shrishaila CD(GPB) UASR
29. DNA Origami
• Rothemund used the 5
SsDNA of M13 Phage 2006
• In 2009 Anderson et al.
Extended to 3D Origami
• It is the nanoscale folding
of SsDNA to create non-
arbitrary two- and three-
dimensional shapes
• SARSE software is using for
developing the structure Shrishaila CD(GPB) UASR
30. • Double cross over arrays can be
folded to form the DNA Nanotubes
• Can be made in to rings and spirals
• Potential use in the fields of
Drug delivery
Gene therapy
Electronic circuits
Shrishaila CD(GPB) UASR
31. • By shih, Quispe & joyce 2004
• By folding the five 40bp synthetic Ss DNA using a wire frame
structures
Shrishaila CD(GPB) UASR
33. Fabrication of DNA nanotubes using origami-based
nanostructures with sticky ends
Mohammad Mousavi-Khattat ,Adele Rafati ,Pooria Gill
5th February 2015
Objective:- Fabrication of DNA nanotubes using a minimum numbers of
staple oligomers for DNA origami
Shrishaila CD(GPB) UASR
40. Self-assembled aptamer-tethered DNA nanotrains for
targeted transport of molecular drugs
in cancer theranostics
Guizhi Zhu, Jing Zheng, Erqun Song, Michael Donovan, Kejing Zhang,
Chen Liu, and Weihong Tana
May 14, 2013
Shrishaila CD(GPB) UASR
41. Materials and Methods
Preparation of sgc8–NTrs and Drug Loading into Nanotrains
M1:- 5’CGTCGTGCAGCAGCAGCAGCAGCAACGGCTTGCTGCTGCTGCTGCTGC3’
M2:-5’TGCTGCTGCTGCTGCTGCACGACGGCAGCAGCAGCAGCAGCAAGCCGT3’
Sgc8 :-5’ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA3’
Sgc8–trigger
5’TGCTGCTGCTGCTGCTGCACGACGTTTATCTAACTGCTGCGCCGCCGGG3’
5 NOD.Cg-Prkdc (scid) IL2 mice were
purchased from The Jackson Laboratory and
maintained under pathogen Free conditions
Shrishaila CD(GPB) UASR
42. Guizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASR
43. Guizhi Zhu et al. PNAS 2013;110:7998-8003Shrishaila CD(GPB) UASR
44. Guizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASR
45. Guizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASR
46. Guizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASR
47. Guizhi Zhu et al. PNAS 2013;110:7998-8003Shrishaila CD(GPB) UASR
48. Guizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASR
50. ATOMCALLY MODIFIED ORGANISMS
In March 2004, ETC Group reported on a nanotech research initiative in
Thailand
That aims to atomically modify the characteristics of local rice varieties.
Researchers “drilled” a hole through the membrane of a rice cell in order
to insert a nitrogen atom that would stimulate the rearrangement of the
rice’s DNA.
Shrishaila CD(GPB) UASR
51. Researchers have been able
to alter the colour of a local
rice variety from purple to
green Named as BKOS6
Thai jasmine rice (Oryza sativa L.
cv.KDML 105) Rice embryos
bombarded with N++N2+ ions at
an energy level of 60 keV
and ion fluence of 2×1016
ions/cm2
Shrishaila CD(GPB) UASR
52. HAT-RAPD was applied for analysis of genomic variation in the mutant
out Of 10 primers,
two primers detected two additional DNA bands at 450 bp and 400 bp.
Indicates presence of amino acid sequence of flavanoids
Shrishaila CD(GPB) UASR
54. DNA is the best nano wire in existence
BCZ..
1. It can self assemble
2. It can self replicate
3. It can adopt various states and
conformations
Rapid Disease Detection using the DNA
Nanotubes
And Molecular treatment
Shrishaila CD(GPB) UASR
55. Wide range of uses ranging from
building blocks to robotics
DNA Robotics
Used in making much smaller microchips than
the current semiconductor fabrication
technology
DNA Nanochips
Shrishaila CD(GPB) UASR
56. DNA
Computers
DNA can be used to make
computers instead of
silicon.
• Maya-II is an example.
DNA Sensors
made to detect any metal
• Much faster than traditional test
for lead and mercury
Shrishaila CD(GPB) UASR
57. DNA
Walkers
DNA nanotechnology can be
used to create walking bipedal
nano robots
• The walkers move on a DNA
track
Protein structure determination
NANO Mosquitoes
Used in militaries
Shrishaila CD(GPB) UASR
58. NANO In INDIA
• The Department of Science and Technology has a plan called Nano
Mission. It promotes basic research, infrastructure development,
nano-applications and technology development, human resource
development, and international collaborations. And it is headed by
BHARATH RATNA Dr. C N R RAO
• The Department of Electronics and Information Technology
focuses on nano electronics and technology development and on
nanofabrication.
Shrishaila CD(GPB) UASR
59. Two centres in India focusing on development of nanotechnology were
established in
BENGALURU and MUMBAI
• India is among the top ten publishing countries in this area with rise in
9.1%in the past ten years
• In 2013 , 87 patents in nanotechnology were published by Indian assignees
Shrishaila CD(GPB) UASR
62. Conclusions
Inaugurating the Global Forum On Agricultural Research(GFAR)Triennial conference –New Delhi
2006 ,President Dr. A.P.J ABDUL KALAM Focussed on the Nanotechnology as
the new technology that must be applied in Agriculture and Food industry
Shrishaila CD(GPB) UASR