Downloaded 289 times
Uploaded byHarshvardhan Gaikwad
Genomics and Plant Genomics
Genomics refers to the study of the entire genome of an organism. It deals with mapping genes on chromosomes and sequencing entire genomes. While work on genomics began with prokaryotes like bacteria, research has now been conducted on crop plants like rice and Arabidopsis thaliana. Genomics is an interdisciplinary field that uses tools from molecular biology, robotics, and computing to study genomes. It provides information on genome size, gene number, gene function, and evolution. Genomics has applications in crop improvement through gene mapping, marker-assisted selection, and transgenic breeding. However, genomic research also faces limitations due to high costs, technical challenges, and complexity of traits.
More Related Content
Similar to Genomics and Plant Genomics
Genomics and Plant Genomics
- 1.
- 2.
- 3. What is thedefinition of genomics? Study of genomes
- 4. What is thegenome? Entire genetic compliment of an organism
- 5. Genomics The complete setof DNA found in each cell is known as the genome Most crop plant genomes have billions of nucleotide bases Arabidopsis thaliana has 120 million bases that encode approximately 25,000 genes The entire Arabidopsis genome was sequenced in 2000
- 6. Origin of terminology Theterm genome was used by German botanist Hans Winker in 1920 Collection of genes in haploid set of chromosomes Now it encompasses all DNA in a cell In 1986 mouse geneticist Thomas Roderick used Genomics for “mapping, sequencing and characterizing genomes” New terms: Functional genomics, transcriptomics, proteomics, metabolomics, phenomics (Omics)
- 7. Origin of Genomics HumanGenome Project – Goal: sequence 3 billion base pairs – High-quality sequence (<1 error per 10 K bases) ACGT Immensity of task required new technologies – Automated sequencing Decision to sequence other genomes: yeast and bacteria – Beginnings of comparative genomics
- 8. What is genomics? Amarriage of molecular biology, robotics, and computing Tools and techniques of recombinant DNA technology – e.g., DNA sequencing, making libraries and PCRs High-throughput technology – e.g., robotics for sequencing Computers are essential for processing and analyzing the large quantities of data generated
- 9. •The term genomics wasfirst used by Thomas Roderick in 1986. •It refers to the study of structure and function of entire genome of a living organism. Genomics Structure of Chromosome Function of all the genes Genomics
- 10. DNA sequence 1 gtcgacccacgcgtccgtct tgaaagaata tgaagttgta aagagctggt aaagtggtaa 61 taagcaagat gatggaatct ggggctccta tatgccatac ctgtggtgaa caggtggggc 121 atgatgcaaa tggggagcta tttgtggctt gccatgagtg tagctatccc atgtgcaagt 181 cttgtttcga gtttgaaatc aatgagggcc ggaaagtttg cttgcggtgt ggctcgccat 241 atgatgagaa cttgctggat gatgtagaaa agaaggggtc tggcaatcaa tccacaatgg 301 catctcacct caacgattct caggatgtcg gaatccatgc tagacatatc agtagtgtgt 361 ccactgtgga tagtgaaatg aatgatgaat atgggaatcc aatttggaag aatcgggtga 421 agagctgtaa ggataaagag aacaagaaga aaaagagaag tcctaaggct gaaactgaac Protein coding regions of Genes begin with ATG and end with either TAG, TGA or TAA atg atg gaa tct ggg gct cct… use genetic code.. M M E S G A P ..* Study function of proteins and expression of genes in different organs and tissues DNA to RNA to Proteins transcription translation
- 11. Main points relatedto genomics are given below: •It is a computer aided study of structure and function of entire genome of an organism. •It deals with mapping of genes on the chromosomes. •It deals with sequencing of genes in an organism. •It is a rapid and accurate method of gene mapping. It is more accurate than recombination mapping and deletion mapping techniques. •The genomic techniques are highly powerful, efficient and effective in solving complex genetic problems. •Now the use of genomic techniques has become indispensable in plant breeding and genetics.
- 12. How many typesof genomes are there in this world? Prokaryotic genomes Eukaryotic Genomes Nuclear Genomes Mitochondrial genomes Chloroplast genomes
- 13. TYPES OF GENOMICS StructuralGenomics: It deals with the study of the structure of entire genome of an organism. In other words, it deals with the study of the genetic structure of the each chromosome of the genome. It determines size of the genome of a species in Megabases (Mb) and also the number of genes present in the entire genome of a species.
- 14. TYPES OF GENOMICS FunctionalGenomics: It deals with the study of function of all genes found in the entire genome of a living organism. deals with transcriptome and proteome. The transcriptome refers to complete set of RNAs transcribed from a genome and proteome refers to complete set of proteins encoded by a genome. genomics can be classified based on the experimental material used and type of analysis carried out . Functional genomics assigns functions to each and every gene identified through structural genomics. Thus function genomics is more complicated that structural genomics
- 15. Why should westudy genomes? • Each and everyone is a unique creation! • Life’s little book of instructions • DNA blue print of life! • Human body has 1013 cells and each cell has 6 billion base pairs (A, C, G, T) • A hidden language/code determines which proteins should be made and when • This language is common to all organisms
- 16. What can genomesequence tell us? • Everything about the organism's life • Its developmental program • Disease resistance or susceptibility • History • Where you are going?
- 17. Now look atyour neighbor and say Hi! • What do you see? • Someone is different than you! • Could be that your friend differs in his/her sex, looks, nature, smartness, or simply the way he/she dresses and talks • How much similarity you think you share with your friend at the gene level? • 99.9% so we could fix genes if we want
- 18. Now look atyour own hands and legs • Do they look similar? No! • But they contain the same DNA in each of their cells • DNA makes RNA makes proteins • Different genes are expressed differently in different cells, tissues and organs of an organism • Having a gene does not mean it will be expressed.
- 19. How will wechange in this century because of the Genomics? • You will control the destiny of this planet • Big changes in our own life • Biotechnology: more products • GMOs: More food-More problems? • Our society will not be the same! • Individualized medicine • Gene therapy • Immortality? Disease free life?
- 20. Genome sequencing insome organisms Species Year Genome size (Mb) No. of genes identifies Prokaryotes Haemophillus Mycoplasma Methanococcus jannaschi E.Coli M.Tuberculosis Eukaryotes Yeast (S. cerevisiae) Nemotode (C. elegans) Fruitfly (D. melanogaster) Arabidopsis thaliana Human (Homo spiens) Rice (Oryza sativa) 1995 1995 1996 1997 1998 1996 1998 2000 2000 2001 2002 1.83 0.58 1.66 4.64 4.41 12.00 97.00 180.00 125.00 3200.00 430.00 1740 500 1750 4400 4000 5800 19000 13600 25500 40000 56000 D. melanogaster Nemotode (C. elegans)
- 21. •The genomic researchhas so far been carried out mainly on prokaryotes and a very little work has been done on crop plants. •In crop plants, the genome mapping has been completed in two species, viz. Arabidopsis thaliana (a weedy relative of mustard) and rice (Oriza sativa). •Now the work on genome mapping has been initiated in several field crops and fruit crops by the Indian Council of Agricultural Research, New Delhi. •The estimated genome size of some crop plants is presented on next slide. GENOMIOCS IN CROP PLANTS
- 22. Name of cropBotanical Name Genomic Size (Mb) Field Crops Rice Oryza sativa 400 Sorghum Sorghum bicolour 1000 Maize Zea mays 2500 Barley Hordeum Vulgare 8000 Bread Wheat Triticum aestivum 16000 Chick pea Cicer arietinum 1000 Pigeonpea Cajanus cajan 1500 Field Pea Pisum sativum 4800 Soybean Glycine max 2000 Tomato Lycopersicon escueentum 950 Fruit Crops Mango Mangifera indica 350 Citrus Citrus sp. 385 Banana Musa spientum 873
- 23. GENOME MAPPING ININDIA Lab Setup The genome mapping is a very costly affair because it requires specialized technical skill, sophisticated Laboratory, costly equipments, chemicals and glass wares. Thus main or basic requirements of genome mapping are listed below: •High or specialized technical skill •Sophisticated Laboratory facilities •Costly equipments and Instruments •Costly chemicals •Costly glass wares Such very expensive projects are taken up through International Collaboration. Now intentional Consortia are available to take up such research work.
- 24. Genome mapping Laboratories GenomeInstitutes/Countries Involved Human Genome (2001) USA, UK, China and Japan through Human Genome Initiative project Bacterial Genome (1995) several countries Rice Genome (2002) IRRI, USA, China and Japan through International Rice Genome Sequence Project. Arabidopsis Genome (2000) USA, China and Japan Wheat Genome Project International Genome Research on wheat by the scientists from Mexico (CYMMIT), UK, USA and Japan Brassica Genome China, Japan and USA under the Project Brassica Genome Gateway Cotton Genome USA, France and Australia and the International Cotton Genome Initiative Project
- 25. Technical foundations ofgenomics Molecular biology: recombinant-DNA technology DNA sequencing Library construction PCR amplification Hybridization techniques LogMW Distance . . . .
- 26. Genomics relies on high-throughputtechnologies 200 Automated sequencers Fluorescent dyes Robotics – Microarray spotters – Colony pickers High-throughput genetics ABI3700
- 27. Other Plant Genomesare being sequenced Large scale sequencing: rice, alfalfa Grass ESTs: rice, maize, barley, wheat, millet, sorghum, forage grasses Dicot ESTs: alfalfa, bean, beet, cassava, cotton, lettuce, potato, rapeseed, soybean, sunflower, tomato, ice plant Tree ESTs: apple, cherry, pine, poplar
- 28. Strawberry flavor development Aharoniet al. 2000 Plant Cell 12:647-661
- 29. .. ROLE OF GENOMICSIN CROP IMPROVEMENT Genomics has various practical applications in crop improvement. The genome mapping is useful in the following ways : 1.Genome size 2. Gene Number 3. Gene mapping 4. Gene sequencing 5. Evolution of crop plants 6. Gene cloning 7. Identification of DNA markers 8. Marker Assisted selection 9. Transgenic breeding 10. Construction of Linkage maps
- 30. In the genomicresearch, both types of genes viz. major genes and minor genes can be easily mapped. In other words, both oligogenic and polygenic traits can be mapped. The mapping of Quantitative Trait Loci is possible by genome mapping techniques which is not possible by conventional gene mapping methods: viz. recombination and deletion techniques. Thus genomics permits mapping of genes for all types of traits. Generally, the genome mapping is done for following type of characters. 1. Morphological Characters: It includes highly heritable characters such as shape, size, colour of leaf, flower, calyx., corolla etc. It also includes surface of leaf and stem (hail)' or smooth). 2. Yield and yield contributing characters. 3. Genes controlling resistance to biotic and abiotic stresses. Biotic stresses include insects, diseases and parasitic weeds. Abiotic stresses include, drought, soil salinity, soil alkalinity, soil acidity, heat, frost, water logging, cold, etc. 4. Genes controlling quality characters. It includes keeping quality as well as market quality. 5. Genes controlling toxic substances. 6. Genes controlling male sterility and self incompatibility in crop plants. 7. Genes controlling fertility restoration. 8. Apomictic genes especially in fruit crops. 9. Genes controlling adaptation to various agroclimatic conditions. 10. Gene controlling photo and thermo-insensitivity. 11. Genes controlling agronomic characters such as earliness, plant height, plant type, elc. 12. Gene controlling non shattering habit in mung bean. Thus all type of characters can be mapped through genomic studies.
- 31. ACHIEVEMENTS Limited progress hasbeen made so far in the field of genomic research related to both animals and crop plants. Important achievements of genomic research are briefly presented below: 1. Bacteria In bacterira, the genome mapping was first completed in influeza fever causing bacterium, viz. Haemophillus injluenzae in 1995. This was the first case of genome mapping in micro-organisms or prokaryotes. Since then genome mapping has been completed in 165 species of bacteria. 2. Mycoplasma In Mycoplasma, the genome mapping was first completed again in 1995 in Mycoplasma genetalium. The genome size of this organism is 0.58 Mb and number of genes are 500. In other words, 500 genes have been mapped in the genome of this species. 3. Yeast In yeast, the genome mapping was first completed in 1996. The genome size of yeast is 12 Mb and 5,800 genes have been mapped so far. 4. Fruit Fly (Drosophila Melanogaster) In fruit fly, the genome mapping was first completed in 2000. The genome size of fruit fly is 180 Mb and 13,600 genes have been mapped so far. 5. Human (Homo sapiens) The human genome was completed in 2001. The genome size of human is 3200 Mb and 40,000 genes have been mapped so far. 6. Crop Plants In crop plants, genome mapping has been completed in two species, viz. Arabidopsis thaliana (a weedy relative of mustard) and rice.
- 32. The genome mappingof crop plants is gaining increasing importance these days. It has several useful applications. However, there are some limitations of genome mapping which are briefly presented below : 1. Very Expensive The genomic research requires well equipped sophisticated laboratory. The chemicals, equipments and glass wares used for such work are very expensive. Thus lot of funds are required for carrying out genomic research. Lack of adequate funds sometimes becomes limiting factor in the progress of such project. 2. Technical Skill The genome mapping work requires high technical skill. It requires training of the scientists in the specialized field of genomics. It also requires International collaboration with other leading genome research laboratories which sometimes becomes limiting factor. The international collaboration is possible if the crop on which genomic research work is to be carried out is of global significance. 3. Laborious Work The genome mapping requires detection of various DNA markers (RFLP, AFLP, SSR, RAPD etc.) which is a laborious and time consuming work. Huge populations related to F2, RILs, NILs and doubled haploids need to be screened for such purpose. This limits the progress of work.
- 33. 4. Limited GenesAvailable Firstly limited number of genes and promoters are available for development of transgenics. Secondly such genes are protected under IPR and therefore, can not be used for developing transgenic plants. 5. Lack of Proper Markers Most of the useful agronomic traits are governed by polygenes and are complex in nature. Tightly linked DNA markers are yet to be identified for such characters. Bt Gene •Cry gene series •Antisense RNA technology for tomato •Terminator gene •Beta Carotene gene in rice •Cry gene series •Antisense RNA technology for tomato •Terminator gene •Beta Carotene gene in rice
- 34. Improved disease diagnosticsfrom genomics Microarray analysis of gene expression from four different types of tumors Grouping of gene expression patterns shows very clear differences among the tumors Used to tailor therapy to individuals
- 35. In the past,the studies on genomics have been confined mostly to proaryotes and a very little work has been Jone on crop plants. In future, the genome research work needs to be directed towards the following thrust areas. Funding. Since genome mapping projects are very costly, there is need of international collaboration for supporting such prestigious projects. Training. Some Laboratories are well equipped for genomic research. Such organizations should impart training to scientist from various countries to develop large number of skilled manpower in genome mapping. Material Sharing. The leading laboratories should develop and distribute frame work DNA markers to various other research laboratories for their use and further research. Research Priorities. The research priorities should be defined. In order to get International collaboration areas of common interest/global significance should be identified for genomic research work. Important Traits. In genome mapping, the major emphasis needs to be given on characters of economic importance such as productivity, quality and resistance to biotic and abiotic stresses. Species. In the past genome mapping has been done mostly on micro- organisms. In plants, such studies have been carried out with two species, viz. Arbidopsis and rice In future genome mapping needs to be carried out with almost all important field, vegetable and fruit crops. The experienced gained in genome mapping of one species may be helpful in the study of related species.
- 36. Genomics refers tothe study of structure and function of entire genome of a living organism Gcnomics is of two types, viz. (i) structural genomics and (ii) functional genomics. The former deals with the study of the structure of entire genome, whereas the latter deals with the study of the function of all genes found in the entire genome of a living organism. Genomics has several practical applications in crop improvement. Genomics is useful in determining (i) genome size, (ii) gene number in the genome, (tii) gene mapping, (iv) gene sequencing, (v) tracing evolution of crops plants, (vi) gene cloning, (vii) identification of DNA markers, (viii) marker assisted selection, (ix) transgenic breeding, (x) construction of linkage maps, and (xi) QTL mapping.
- 37. The genome mappingwork is carried out through International collaboration. Now international consortia are available for such expensive research work. The genome mapping work is being done in USA, UK, China, Japan, Australia. In India, genome mapping work is being done at NRC PB, New Delhi, ICGEB, New Delhi, JNU, New Delhi and NBRI, Lucknow. The genome mapping is possible for both qualitative and quantitative characters. The genome mapping work has been completed in a variety of organisms such as bacteria, mycoplasma, yeasts, nematodes, fruit fly, human and crop plants. In crop plants, genome mapping has been completed in two species viz. Arabidopsis thaliana and rice. Now genome mapping work has been initiated in several crops such as wheat, barley, maize, sorghum, chick pea, pigeon pea, field pea, soybean, Brassica, Tomato, etc. The genome mapping work has some limitations. It is very expensive, requires high technical skill and is a laborius work. Availability of limited number of genes and promoters and lack of proper markers limit the scope of genome mapping work. Adequate funding, proper training facilities and sharing of material is essential for promoting genomic research. Future thrust areas have been indicated.
- 38. ICGEB Lab, NewDelhi
- 39. ICGEB Lab, NewDelhi
- 40. Bioinformatics Centre Dept. ofMicrobiology and Biotechnology Centre, M.S.University of Baroda, Baroda, India 390002 Phone:91-0265-2794396 , Fax: 91-265-2792508
- 41. Centre for Cellular& Molecular Biology (CCMB)
- 42. National Research Centrefor Plant Biotechnology IARI New Delhi The National Research Centre on Plant Biotechnology was established in 1985 to undertake research, teaching and training personnel in the modern areas of Molecular Biology and Biotechnology. Since its inception, the Centre has grown and has acquired high degree of scientific competence and established excellent research facilities. The Centre is working towards achieving the national priorities of increased agricultural productivity and sustainability
- 43. Jawaharlal Nehru University NewDelhi JNU Campus
- 44. National Botanical ResearchInstitute, Lucknow.
- 45. Now functional genomicprojects are being initiated by the Department of Biotechnology (DBT) and ICAR. The DBT has initiated such work on Rice and ICAR has taken up genome sequencing work on several crops such as Rice, Wheat, Maize, Chickpea, banana, Tomato, Brassica, etc. The ICAR has created genome sequencing facilities for rice at NRCPB, IARI, New Delhi. Facilities for genome mapping of other crops are also being created. Department of Biotechnology (DBT)
- 46. Mexico's National Laboratoryof Genomics
- 47.
- 48.
Editor's Notes
- #8 The field of genomics began with the Human Genome Project. In 1990, the task of sequencing the 3 billion base pairs of the human genome seemed almost insurmountable, especially at a very high level of accuracy. The goal was to achieve an error rate of less than one mistake in every 10,000 bases. Scientists realized that the immensity of the task would require the development of new technologies. Probably the most important among these technologies were machines able to perform DNA sequencing in a fully automated fashion. In addition to automated sequencing, the Human Genome Project spawned a whole range of high-throughput technologies, including automated colony pickers, microarray spotters, and equipment for the rapid isolation of DNA. Another important feature of the Human Genome Project was the decision by its founders to focus on sequencing DNA not only from the human genome, but also from a number of other organisms’ genomes. The sequencing of smaller genomes such as those of baker’s yeast and the roundworm were seen as a warm-up to the much larger task of tackling the entire human genome. These efforts also laid the foundation for the field of comparative genomics.
- #26 Almost all of the underlying techniques of genomics originated with molecular biology, or recombinant-DNA technology. In particular, almost all DNA sequencing is still performed using the approach pioneered by Sanger, for which he won his second Nobel Prize. Also essential to high-throughput sequencing is the ability to generate libraries of genomic clones and then cut portions of these clones and introduce them into other vectors. These techniques were developed in the late 1970s by a number of scientists, including Maniatis and Cohen. The use of the polymerase chain reaction (PCR) to amplify DNA, developed in the 1980s, is another technique at the core of genomics approaches. Finally, the use of hybridization of one nucleic acid to another in order to detect and quantitate DNA and RNA was pioneered by Southern and Alewine in the late 1970s. This method remains the basis for genomics techniques such as microarrays.
- #27 What genomics added to these recombinant-DNA techniques was automation. The innovation that made the greatest impact on genomic sequencing was the use of fluorescent dyes and capillaries in an automated sequencing system. Pictured in the slide is Applied Biosystem’s ABI 3700, which has been the most widely used instrument for large-scale sequencing. It has 96 capillaries that are fed by robotic loading from two 384-well microtiter plates. It makes a sequence run every two to three hours and can read, on average, 600–700 bases per run. Celera, the company that produced a rough draft of the human genome in three years, used 200 of these machines running 24/7 to do so. Similarly, automation was applied to the processes of spotting DNA onto slides to make microarrays and of identifying and isolating bacterial colonies to grow up DNA for sequencing. While initially applied to improving genomics techniques, high-throughput approaches are now permeating much of biology. An example of such an application is the use of robots to automate genetic screens for new mutants.
- #35 There are many efforts to use genomics approaches to improve disease diagnostics. A lot of efforts have focused on identifying gene expression patterns for different types of cancers. An example is shown in this slide, which shows a microarray analysis of RNA from four tumors that can be difficult to distinguish by histology alone. Gene expression patterns have been grouped to highlight the differences among the tumors. Physicians are already testing the feasibility of using gene expression patterns to correctly identify different subtypes of tumors. When the various subtypes are correlated with response to different therapies, treatments can be tailored to the individual. Chapter 6, slide 35