Downloaded 32 times
Uploaded byProf. Wim Van Criekinge
Van criekinge next_generation_epigenetic_profling_vlille
This document summarizes a presentation on next generation epigenetic profiling. It introduces epigenetics and how epigenetic changes like DNA methylation are important in causing cancer in addition to genetic changes. It discusses using methyl-binding domain sequencing to discover genome-wide methylation patterns and biomarkers. Examples are given of specific genes like MGMT and BRCA1 that show methylation changes in cancer. Integrating deep sequencing data with other assays is described to better understand methylation patterns and their effects on gene expression and cancer. Developing targeted panels of cancer-related genes with known epigenetic alterations is discussed for clinical applications.
More Related Content
Similar to Van criekinge next_generation_epigenetic_profling_vlille
More from Prof. Wim Van Criekinge
![Bio ontologies and semantic technologies[2]](https://cdn.slidesharecdn.com/ss_thumbnails/bioontologiesandsemantictechnologies2-180509123734-thumbnail.jpg?width=640&height=640&fit=bounds)
Van criekinge next_generation_epigenetic_profling_vlille
- 2. Next Generation Epigenetic Profiling WimVan Criekinge 10th octobre 2013, Lille (FR)
- 3. Overview Epigenetics â Introduction â Methylation& Oncology â Biomarkers MDxHealth âNEXT-GENeration Epigenetic Biomarkers âPharmacoDX: Methylation Based Biomarkers for Predictive and Prognostic Use
- 4.
- 5.
- 6. Historically, Cancer Was Considered tobe Driven Mostly by Genetic Changes Example: Replication errors GENETIC Altered DNA/mRNA/proteins Altered DNA sequence X X Oncogenesis Tumor ď§ Mutations in p53 ď§ Activating mutations in RAS ď§ Mutations or amplifications of the HER-2 gene ď§ Chromosomal translocations in myeloid cells and the generation of the BCR-ABL fusion protein
- 7. Epigenetic Changes are Importantin Causing Cancer Example: Replication errors GENETIC EPIGENETIC Example: Chromatin modification errors Altered DNA/mRNA/proteins Altered DNA sequence Altered levels of mRNA/proteins Altered chromatin structure X X Oncogenesis Tumor
- 8. Source: Schuebel etal 2007 0 20 40 60 80 100 120 Methylated Mutated 76-100 51-75 21-50 1-20 Dx CDx Example of Methylation vs Mutation: Colon & Breast Cancer
- 9. MGMT Biology O6 Methyl-Guanine MethylTransferase Essential DNA Repair Enzyme Removes alkyl groups from damaged guanine bases Healthy individual: - MGMT is an essential DNA repair enzyme Loss of MGMT activity makes individuals susceptible to DNA damage and prone to tumor development Glioblastoma patient on alkylator chemotherapy: - Patients with MGMT promoter methylation show have longer PFS and OS with the use of alkylating agents as chemotherapy
- 10. MGMT Promoter Methylation Predicts Benefitform DNA-Alkylating Chemotherapy Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation 0 5 10 15 20 25 Median Overall Survival 21.7 months 12.7 months radiotherapy plus temozolomide Methylated MGMT Gene Non-Methylated MGMT Gene radiotherapy Adapted from Hegi et al. NEJM 2005 352(10):1036-8. Study with 207 patients
- 11. Overview Epigenetics â Introduction â Methylation& Oncology â Biomarkers MDxHealth âNEXT-GENeration Epigenetic Biomarkers Can we rediscover MGMT ? What does the epigenome look like ? âŚ.
- 12. MBD_Seq DNA Sheared Immobilized Methyl BindingDomain Condensed Chromatin DNA Sheared
- 13. Immobilized Methyl binding domain MgCl2 NextGen Sequencing GA Illumina: 100 million reads MBD_Seq
- 14. Confidential Information |Š2013 MDxHealth Inc. All rights reserved. Quality evaluation of Methyl Binding Domain based kits for enrichment DNA-methylation sequencing De Meyer et al (2013) Plos One
- 15. Confidential Information |Š2013 MDxHealth Inc. All rights reserved. Quality evaluation of Methyl Binding Domain based kits for enrichment DNA-methylation sequencing
- 16.
- 17. # samples # markers MBD_Seq Genome-widemethylation âŚ. by next generation sequencing Discovery 1-2 million methylation cores
- 18.
- 19.
- 20.
- 21.
- 22.
- 23.
- 24.
- 25.
- 26. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Densemethylated needed for transcriptional silencing Are there alleles with all three positions methylated ?
- 27. GCATCGTGACTTACGACTGATCGATGGATGCTA unmethylated alleles less methylationmethylatedalleles more methylation Deep Sequencing
- 28. Deep Sequencing MGMTHeterogenic complexity
- 29. Data integration with DEEPSequencing, Infinium, Reactivation, (directional) Expression âŚ
- 30. Data integration Correlation tracks methylationmethylation expression expression Corr =-1 Corr = 1
- 31. Correlation track in GBM@ MGMT +1 -1
- 32. BRCA1 32 1 T47D 2 BT549 3MCF7 4 MDAMB231 5 HS578T 6 NORMAL 7 NORMAL 8 NORMAL
- 33. 9 BI T21(BRCA1 MUT) 10 BI T22 (BRCA1 MUT) 11 BLC 12 BLC 13 BLC 14 BLC 15 BLC 16 BLC 17 BLC
- 34. 13 BLC 14 BLC 15BLC 16 BLC 17 BLC 18 BLC 19 IVM 20 DKO
- 35. # samples # markers MBD_Seq BT_Seq MSP Genome-widemethylation âŚ. by next generation sequencing Discovery Verification Validation
- 36. Confidential Information |Š2013 MDxHealth Inc. All rights reserved. Genetics 107 106 105 104 103 102 101 1108109 Full genome bp Whole-genome Bisulphite seq MSP Probes (450-27K) Enrichment Targeted Panels
- 37. Confidential Information |Š2013 MDxHealth Inc. All rights reserved. Genetics 107 106 105 104 103 102 101 1108109 Full genome bp G E N E T I C Whole-genome sequencing Enrichment seq (Exome) PCR Enrichment Targeted Panels Instrument and Assay providers CLIA Lab service providers
- 38. Sequencing Deep Seq Molecular Unification 107 106105 104 103 102 101 1108109 Full genome bp Whole-genome Bisulphite seq RUO Clinical E P I G E N E T I C Whole-genome sequencing Enrichment seq (MBD, RRBS) Enrichment seq (Exome) Probes (450-27K) Enrichment Targeted Panels Enrichment Targeted Panels Ultra Deep
- 39. Confidential Information |Š2013 MDxHealth Inc. All rights reserved. 236 cancer-related genes (3,769 exons) plus 47 introns from 19 genes often rearranged or altered in cancer. These genes are known to be somatically altered in human solid cancers based on recent scientific and clinical literature.
- 40. Confidential Information |Š2013 MDxHealth Inc. All rights reserved. PubMeth.org Reviewed methylation database in cancer
- 41. Epigenetic Alterations Associated withCancer Therapy Response PCFT â folate transport (MTX) WRN
- 42. Confidential Information |Š2013 MDxHealth Inc. All rights reserved. 440 cancer-related genes genes are known to be epigenetically altered in human solid cancers based on recent scientific and clinical literature.
- 43. Sequencing Deep Seq Molecular Unification 107 106105 104 103 102 101 1108109 Full genome bp Whole-genome Bisulphite seq RUO Clinical E P I G E N E T I C Whole-genome sequencing Enrichment seq (MBD, RRBS) Enrichment seq (Exome) Probes (450-27K) Enrichment Targeted Panels Enrichment Targeted Panels Ultra Deep
- 44. Acknowledgments 44 Geert Trooskens Simon Denil KlaasMensaert Jean-Pierre Renard Sarah De Keulenaer Ellen De Meester Tim De Meyer Olivier Thas Wim van den Berghe Manon Van Engeland Jurgen Veeck Monika Hegi Pierre Bady Sebastian Kurscheid
- 45.