Recommended
More Related Content
What's hot
What's hot (20)
Viewers also liked
Viewers also liked (20)
Similar to Reduction of cost of Genetics diagnosis test through FISH & PRINS
Similar to Reduction of cost of Genetics diagnosis test through FISH & PRINS (20)
More from nisaiims
More from nisaiims (20)
Recently uploaded
Recently uploaded (20)
Reduction of cost of Genetics diagnosis test through FISH & PRINS
- 1. CEUTEH‘16 Dr.Manish Jain • Scientist,Department of Reproductive Biology All India Institute of Medical Sciences New Delhi Publication: • Research Papers (Indexed Journals): 15 • Chapters in Books : 2 • Poster Presentation in National & International Conferences: 8 • Demostrator cum tutor in National Workshop on Molecular • Cytogenetic techniques: 7 times
- 2. Reduction of cost of Genetics diagnosis test through FISH & PRINS Dr. Manish Jain Scientist Department of Reproductive Biology All India Institute of Medical Sciences New Delhi
- 3. • A genetic disorder is a genetic problem caused by one or more abnormalities in the genome, especially a condition that is present by birth (congenital). • Defects may occur during gamete formation or fetal development due to endogenous or exogenous factors. • These may cause birth defects like developmental delay, behavioral problems and intellectual disability; abortions or infertility compromising with reproductive health. Genetics Disorders
- 4. GENETIC DEFECTS DURING GAMETE FORMATION AND FETAL DEVELOPMENT CHROMOSOMAL DEFECTS GENE DEFECTS Change in the structure of chromosome Change in number of chromosomes Addition or deletion of a nucleotide Replacement of one nucleotide by another
- 5. SAMPLE COLLECTION (BLOOD/ AMNIOTIC FLUID/ SOLID TISSUE/ BONE MARROW) CYTOGENETIC TESTING KARYOTYPE FISH PRINS aCGH Methods of Investigations
- 6. Karyotype • Advantages – Whole genome scan – Relative low cost • Disadvantages – Labor intensive – Detection above 5 Mb 46, XY chromosome
- 7. Drawback of Karyotype • The material doesn't contain metaphase chromosomes – Unsuccessful cultivation – It isn't possible to cultivate the tissue from patient (preimplantation analysis, rapid prenatal examinations, examinations of solid tumors or autopsy material) • Analysis of complicated chromosomal rearrangements • Identification of marker chromosomes • Analysis of low-frequency mosaic • Diagnosis of submicroscopic (cryptic) chromosomal rearrangements – Microdeletion syndromes – Amplification of oncogenes and microdeletion of tumor- suppressor genes in malignancies
- 8. • A technique that hybridizes a DNA nucleic acid probe to a target DNA sequence contained within a cell nucleus. FISH
- 9. FISH for Detection of Single to Multiple Genetic Events Single Target One color Dual Targets Two colors Multiple Targets Multi- colors Allows one to look at multiple genomic changes within a single cell, without destruction of the cellular morphology.
- 10. A G G C T A T T C C G A T A COVALENT BOND F F Specimen DNA FISH Probe DNA • Probe is a nucleic acid (DNA or RNA) that o labeled with a marker which allows identification and quantitation o hybridize to another nucleic acid on the basis of base complementarity Probes
- 11. Types of probes Centromeric (satellite) probes Locus specific probes Whole chromosome painting probes
- 12. Company Probe Cost • Vysis • Kreatech • Cytocell Per slide cost : Rs.8000 – 12000 ?
- 13. Human Probe Preparation BAC/PAC/Plasmid DNA Probe cloning • Clones are shipped as bacterial LB agar stab culture. • DH5α E.coli host is harboring a DNA insert that has been placed into LB agar. • Recommended to streak the culture to single colonies on a LB agar plate with a specific antibiotic and prepare a glycerol stock of the clones for long-term storage at - 80°C. • Amplification of BAC/PAC/Plasmid DNA for probe preparation • Extraction of BAC/PAC/Plasmid DNA for FISH Probe Preparation 1.a 1.b 1.c 1.d 1.e 1.f
- 14. Labeling of Probes Nick translation labeling • No need for linearization or denaturation of DNA. • DNA is nicked by DNAse and DNA polymerase I replace excised nucleotides by labeled/unlabeled nucleotides.
- 15. Protocol for Direct Nick Translation • 1.5 ml microcentrifuge tube is placed on ice and to the tube, following ingredients added: • Sterile distilled H2O Y µl • 10X conc. nick translation buffer (NTB) 5µl • [NTB-500 mM Tris-HCL (pH 7.8), 50mM Mg Cl2, 0.5 mg/ml BSA (nuclease-free) • 100 mM Dithiothreitol 5 µl • dNTP Nucleotide mixture 4µl • [dNTP-0.5 mM each of d ATP, dGTP, and d CTP; 0.1 mM dTTP] • 1 mM fluorochrome –labeled dUTP( DIG/Biotin) 0.5µl • 1 µg template DNA X µl • DNase I 5µl • DNA polymerase I (2 units) 0.5 µl The ingredients are mixed and tube is centrifuged briefly. It is incubated at 15°C for 45 minutes. After 45 mins, 5µl of Diluted DNase is added. Further incubated at 15°C for 45 minutes. Immediately after incubation, chilling of the reaction tube is done on ice. To Stop reaction • Add • 0.5 M EDTA 2.5l • Herring sperm DNA (blocks repetitive sequences) 2.5l • 3 M sodium acetate (0.1vol) 3.0l • Cold absolute alcohol 100% (2.5 vol) 500l
- 16. Microdeletion DNA Probe Clones (non commercial) in our library
- 17. S.N Chromosome Probe Type Site Clone type 1 X Alphoid Centromere Plasmid 2 Y Alphoid, Heterochroma. Centromere, qh Plasmid 3 1 Hetrochroma. qh Plasmid 4 2 Alphoid Centromere Plasmid 5 3 Alphoid Centromere Plasmid 6 4 Alphoid Centromere Plasmid 7 6 Alphoid Centromere Plasmid 8 7 Alphoid Centromere Plasmid 9 8 Alphoid Centromere Plasmid 10 9 Hetrochroma. qh Plasmid 11 10 Alphoid Centromere Plasmid 12 11 Alphoid Centromere Plasmid 13 12 Alphoid Centromere Plasmid 14 13/21 Alphoid Centromere Plasmid 15 14/22 Alphoid Centromere Plasmid 16 15 Alphoid Centromere Plasmid 17 16 Alphoid Centromere Plasmid 18 17 Alphoid Centromere Plasmid 19 18 Alphoid Centromere Plasmid 20 20 Alphoid Centromere Plasmid 21 21 Alphoid Centromere Plasmid 22 22 Alphoid Centromere Plasmid 23 NOR Alphoid Satellite Plasmid Alphoid DNA Probe Clones (non commercial) in our library
- 18. Locus Specific DNA Probe Clones (non commercial) in our library S.N Chromosome Probe Type Clone type 1 1p36.33 Locus sp. BAC 2 2p24.3 Locus sp. BAC 3 3p25.1 Locus sp. BAC 4 3q29 Locus sp. BAC 5 7q31.1 Locus sp. BAC 6 8q22 Locus sp. BAC 7 8q24.21 Locus sp. BAC 8 8q24.23 Locus sp. BAC 9 9p21.1 Locus sp. BAC 10 9q34 ABL1 BAC 11 9q34.12 ABL1 BAC 12 9q34.3 ABL1 BAC 13 11q25 ABL1 BAC 14 12q24.33 ABL1 BAC 15 13q14.2 Locus sp. YAC, BAC 16 15q24.1 PML1 BAC 17 17q12 Locus sp. BAC 18 17q12 Locus sp. BAC 19 17q21.2 RARA BAC 20 20p12.2 Locus sp. BAC 21 21 Locus sp. YAC 22 21 Locus sp. BAC 23 21q22 AML1 BAC 24 Xp22.31 Locus sp. BAC 25 Xq28 Locus sp. BAC 26 Yp11.2 Locus sp. BAC 27 Yp11.2 Locus sp. BAC 28 Yp11.31 Locus sp. BAC 29 Yp11.221 Locus sp. BAC 30 Yq11.223 Locus sp. BAC 31 Yq11.23 AZFb/AZFc BAC
- 19. 7q chromosome Normal in metaphase & interphase7q chromosome Mosaic in metaphase & interphase William Syndrome (7q11.2)
- 20. 22q chromosome Normal in metaphase & interphase 22q chromosome Mosaic in metaphase & interphase 22q chromosome Mosaic in metaphase & interphase 22q chromosome Deletion in metaphase & interphase Digeorge Syndrome (22q11.2)
- 21. 15q11-13 chromosome deletion in Buccal cell 15q11-13 chromosome Mosaic metaphase & interphase 15q11-13 chromosome deletion in Urine cell 15q11-13 chromosome deletion in metaphase & interphase cells Praderwilli Syndrome (15q11-13)
- 22. XY SRY FISH Y –ve/SRY +ve SRY FISH SRY on Xp XY FISH MKFS XY FISH KFS XY FISH N Gonosomal (XY) FISH
- 25. Breast Cancer Tissue (after digestion)
- 26. Breast Cancer Tissue (after digestion)
- 28. Cervical Cancer Tissue (after digestion)
- 29. Cervical Cancer Tissue (after digestion)
- 30. Cervical Carcinoma: C-MYC amplification
- 31. Embryo at different cell stage Embryo
- 32. Embryo at different cell stage after XY FISH
- 33. Application of FISH • Microdeletion syndrome • Prenatal chromosome analysis • Hematologic Malignancies (ie, bcr/abl, PML/RARA) • Marker Chromosome Identification • Sex chromosome chimerism • Preimplantation chromosome analysis • Solid tissue tumor • Postnatal chromosome analysis Cryptic Chromosomal Rearrangements
- 34. • It is a method of target DNA sequence detection and localization that combines features of FISH and polymerase chain reaction • It is based on in situ annealing of a specific oligonucleotide primer followed by primer elongation by Taq DNA polymerase in the presence of labeled nucleotides. • It is specific, simple, cost effective and rapid technique. • It does not require a previously labeled probe. Primer In Situ Labelling • DNA is linearized and denatured (ssDNA), • primer anneals and synthesis of new strand of DNA (incorporating labeled nucleotides) by Taq DNA polymerase (size should be 200-1000 bp) PRINS (PRimed INSitu Labeling/Synthesis)
- 35. PRINS (PRimed INSitu Labeling/Synthesis) Principle Metaphase chromosome or Interphase Cell (DNA) onto microscope slide Oligonucleotide primer (specific for chromosomes) + nucleotides including labeled + Taq DNA polymerase + Buffer Denatured together onto a glass microscopic slide (93C for 3 min) Annealed at 60C for 10 min Extension/elongation (with Taq polymerase) at 72C for 15 min [One (simple) or many (cycling) cycles] Stop reaction by dipping into EDTA solution (0.2 M) at 65C for 1 min Washing of excess and unbound probes (room temperature few minutes) Visualization under fluorescent microscope (for direct PRINS or application of detection system for indirect PRINS)
- 36. One primer each specific for centromere/alphoid of chromosome X, Y, 13, 18 & 21 as follows: Primer Sequence (5’-3’) Concentration (pM) Annealing Temp X centromere GTTCAGCTCTGTGAGTGAAA 75 68ºC Yqh TCCATTCGATTCCATTTTTTTCGAGAA 100 56ºC 13 centromere TGATGTGTGTACCCAGCT 100 60ºC 18 centromere ATGTGTGTCCTCAACTAAAG 100 65ºC 21 centromere TGATGTGTGTACCCAGCC 150 61ºC Primers standardized in our lab Primed in situ labeling/synthesis images on metaphase as well as interphase cells
- 37. Conclusion • Lab made probes highly reduce the cost of FISH/PRINS test making the techniques approachable for patients • Alphoid, locus specific/Microdeletion syndromes & Amplification of oncogenes and microdeletion of tumor- suppressor genes in malignancies can be detected at a much lower price by using lab made probes as compared to the commercial probes.
- 38. ecTHANK YOU
- 39. Dr. Manish Jain Scientist Department of Reproductive Biology All India Institute of Medical Sciences New Delhi Publication: Research Papers (Indexed Journals): 15 Chapters in Books : 2 Poster Presentation in National & International Conferences: 8 Demostrator cum tutor in National Workshop on Molecular Cytogenetic techniques: 7 times
Editor's Notes
- It affects the functioning of the male and female during all stages of life. The birth of a healthy baby is the result of fertilization of good quality gametes and development of resulting zygote in mother’s womb. Genetic investigation includes the analysis of chromosomes, DNA, RNA, genes, and/or gene products to determine whether an alteration is present that is causing or is likely to cause a specific disease or condition. Genetic defects occur at the level of genes point mutations, deletion, microdeletion duplication chromosomes – change in number or structure of chromosomes.
- Libraries may have little contamination hence it would be wise, before initiating any experiments, to check 3-5 colonies on LB agar plates. This to make sure that the clone stock is pure.