The document discusses DNA microarrays, including their applications, history, major steps, methods of construction, and technical issues. DNA microarrays allow analysis of gene expression across thousands of genes simultaneously. They have been used since the 1990s and are constructed by attaching DNA probes to a solid surface in a high-density array. Two main types are cDNA-based microarrays using amplified cDNA and oligonucleotide-based arrays like Affymetrix GeneChips containing short DNA sequences.

1. Division of Plant Pathology
Indian Agricultural Research Institute
New Delhi 110012
Devendra Kumar Choudhary
Roll No. – 10511
Microarray

2. A DNA microarray (also commonly known as DNA chip or biochip) is a
collection of microscopic DNA spots attached to a solid surface.
The main applications of microarrays include:
Comparative genome analysis (Healthy and
infected cell)
Functional genome analysis (to describe
interactions between genes at different
time point)
Developing knowledge of gene function
Discovery of drugs
Diagnostics and genetic engineering
Toxicological research (Toxicogenomics)

3. History
in 1965 Gillespie and Spiegelman described
methods for DNA blotting hybridization, in which
DNA immobilized on a membrane can bind to
complementary RNA or DNA strand through specific
hybridization.
Southern blotting developed by E. M. Southern's
1975

4. In 1982 RNA was isolated from normal and cancer tissue of mice,
cDNA synthesized, cloned on E. Coli and 378 colonies were arrayed.
Scientists at the California-based biotech company Affymetrix produce
the first DNA chips. (1991) [publically since 1996]
Quantitative monitoring of gene expression patterns with a
complementary DNA microarray. (Science 1995)
microarrays for gene expression profiling was used in 1995 using
complete eukaryotic genome (Saccharomyces cerevisiae) on a
microarray chip. (Published in 1997)

5. 1. Preparation of microarray
2. Preparation of labelled probes
3. Hybridization
4. Scanning, imaging and data analysis
Major steps

6. Methods for constructing the arrays:
Probe Type Advantages Disadvantages
PCR products Inexpensive Handling problems
Hard to design to avoid cross-
hybridization
Unequal amplification
Oligos Can be designed for many
criteria
Easy to handle
Normalized concentrations
Expensive
(Dkk. 100-150 per oligo)
Affymetrix
GeneChip
High quality data
Standardized arrays
Fast to set up
Multiple probes per gene
Expensive
Arrays available for limited
number of species

7. Microspotting Techniques
• Conventional methods can be used to produce the sequences
(oligonucleotides), and these can then be printed directly onto the
microscope slide (which is first overlaid with a coating that is
positively charged).

8. Microspotting Techniques
• After the first spotting cycle, the pin is washed and a second sample
is loaded and deposited to an adjacent address.
• Robotic control systems and multiplexed printheads allow
automated microarray fabrication.

9. •First used by AGILENT
•This is a non-contact process.
•Minute volumes of reagents are delivered to
defined locations on the slide similar to ‘ink-jet’
printing methods.
•A biochemical sample is loaded into a miniature
nozzle equipped with a piezoelectric fitting
(rectangles) and an electrical current is used to
expel a precise amount of liquid from the jet
onto the substrate.
Piezoelectric Printing

10. After the first jetting step, the jet is washed and
a second sample is loaded and deposited to an
adjacent address. A repeated series of cycles
with multiple jets enables rapid microarray
production.

11. Photolithography
• This makes use of semiconductor technologies.
• This ‘in situ’ fabrication technique was developed by
Affymetrix, and is used to produce their GeneChips.
• A mercury lamp is used activates DNA bases.

12. •A glass wafer modified with photolabile protecting groups is selectively activated
for DNA synthesis by shining light through a photomask.
•The wafer is then flooded with a photoprotected DNA base, resulting in spatially
defined coupling on the chip surface.
•A second photomask is used to deprotect defined regions of the wafer.
•Repeated deprotection and coupling cycles enable the preparation of high-
density oligonucleotide microarrays.

13. Plate Preparation for PCR product
96-well Plate
– 8 x 12 wells
– 9mm spacing
384-well Plate
– 16 x 24 wells
– 4.5mm spacing
1536-well Plate
– 32 x 48 wells
– 2.25mm spacing

14. There are 2 types of DNA Chips/Microarrays:
1. cDNA based
microarray
2. Oligonucleotide based
microaaray

15. This type of chips are prepared by using cDNA, it is called
cDNA chips or cDNA microarray or probe DNA. The cDNAs
are amplified by using PCR. Then these immobilized on a solid
support made up of nylon filtre of glass slide (1 x 3 inches), or on
multiwell.
cDNA – based chips:

16. Preparation of the Sample
 mRNA has been extracted from the cells or tissues under
study, it is converted into DNA by the use of the reverse
transcriptase enzyme.
 During this reaction, the DNA is labelled by the
incorporation of fluorescent or radioactive nucleotides
into the DNA.
 The two samples are labelled using two different
fluorescent dyes - say, red or green. The most common
dyes in use are Cy3 (Green) and Cy5 (Red).

17. cDNA Spotted Array
red for experiment, green for control

18. Scanning
Yellow Both genes equally expressed
Red Genes from sample expressed
more (UP Regulation)
Green Genes from sample expressed less
(UP Regulation)

19. Affymetrix DNA microarray

20. Affymetrix GeneChip
Oligo design and arrangement
– several hundred thousand different oligos of up to 25
nucleotides long, each with millions of copies
– for each gene, choose a region that (presumably) has the
least similarity to other genes
– in that region, choose 11-20 oligos as perfect matches (PM)
– another 11-20 as mismatch oligos (MM)
to detect nonspecific and background hybridization

21. Oligo arrangement (schematic)
for gene A

22. perfect match probe cells
mismatch probe cells
5’ 3’
… GGTGGGAATTGGGTCAGAAGGACTGTGGCTAGGCGC …
GGAATTGGGTCAGAAGGACTGTGGC
GGAATTGGGTCACAAGGACTGTGGC
actually scattered on chip

23. Avoid self annealing oligos
Probes that form strong hybrids with it self i.e. probes
that fold should be avoided.

24. Procedure

26. Comparison
Affymetrix GeneChip
– high density, accurate, uniform, stable
– user can’t design probes
– designer can design arbitrary probes
– single channel only, but offset by its accuracy
– expensive, but getting cheaper
– (minor) differences in data analysis (due to its
single channel)

27. Technical Issues
• Initial amount of biomaterials (mRNA)
– Linear amplification
• Reliability
• Reproducibility
• New techniques
– slide type, slide coating

28. Performance
Spotted arrays
• starting material: 10-20 mg total RNA
• probes per gene: 1, but long
• gens per array: ~10000
Affymetrix GeneChip
• starting material: 2 ng total RNA
• probe pairs per gene: 20 (down to 4)
• genes per array: 12000 (up to 40000

29. Advantages of DNA
Microarrays

30. • Being able to study the behaviour of many genes simultaneously is a
great advantage.
• The technique is very fast:
• there can be as many as 150 copies of an array of 12,000
genes printed in only 1 day.
• DNA microarray technology is relatively cheap to use:
• the initial cost of constructing an arrayer is approximately $60,000;
• after this, the cost per copy of a microarray is small, usually less than
$100.

31. • A major advantage of DNA microarrays is that information
about the sequence of the DNA is not required to construct and
use the DNA microarrays.
• In fact, most of the human genes that have used microarray
technology in expression studies are only defined by partial EST
sequences at the moment.
• The technique of DNA microarrays is very user-friendly:
• the technique is neither radioactive nor toxic
• the microscope slide is a convenient base for the
technique
• arrays are cheap and easily replaced

32. Problems of DNA
Microarrays

33. Array Fabrication
• When working on the kind of scale necessary for microarrays -
micrometres - DNA can actually be very difficult to handle. It
has been described as acting 'almost like concrete coated with
superglue' (Marshall, 1998).

34. Equipment and the Associated Cost
• After the initial capital outlay, the cost in this technique comes
from the lengthy experimental procedure.
• The need for so many cDNAs to be printed is also a
disadvantage of this technique. To decrease the cost of this
technique, the number printed can be reduced.

35. Limitations of Equipment
• As well as the cost of robotics to perform the technique,
there may be technical limitations.
• The technique of DNA microarrays is currently limited not
by the number of probes on an array, but by the resolution
of the scanner used.
• Too much data all at once. Can take quite a while to
analyze all the results.
• The results may be too complex to interpret
• The results are not always reproducible
• The results are not always quantitative enough
• The technology is still too expensive