Downloaded 49 times
More Related Content
Similar to Map based cloning of genome
Map based cloning of genome
- 1. MapbasedCloningof Genome By KAUSHAL KUMARSAHU Assistant Professor (Ad Hoc) Department of Biotechnology Govt. Digvijay Autonomous P. G. College Raj-Nandgaon ( C. G. )
- 2. SYNOPSIS- • Introduction • History •Mapping of genome • 1. genetic mapping • 2. physical mapping • Map based cloning • Steps of MBC • Uses • Conclusion • References
- 3. INTRODUCTION Map based cloningof genome is a method to identify and to make unknown nucleotide sequence.
- 4. HISTORY- • In 1990,clone region around markers, make physical map(s), look for genes experimentally • In 2000, use better physical maps, at least in some organisms • In 2010, use sequencing, bioinformatic knowledge, experimental proof still necessary
- 5.
- 6. TYPES • Genetic mappingis based on the use of genetic techniques to construct maps showing the positions of genes and other sequence features on a genome. • Physical mapping uses molecular biology techniques to examine DNA molecules directly in order to construct maps showing the positions of sequence features, including genes.
- 7. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Genetic mapping I • Based on recombination frequencies – The further away two points are on a chromosome, the more recombination there is between them • Because recombination frequencies vary along a chromosome, we can obtain a relative position for the loci • Distance between the markers
- 8. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Genetic mapping II • Genetic mapping requires that a cross be performed between two related organisms – The organism should have phenotypic differences (contrasting characters like red and white or tall and short etc) resulting from allele differences at two or more loci • The frequency of recombination is determined by counting the F2 progeny with each phenotype
- 9. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping example I • Genes on two different chromosomes – Independent assortment during meiosis (Mendel) – No linkage – Dihybrid ratio F1 9 : 3 : 3 : 1 F2 P
- 10. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping example II • Genes very close together on same chromosome – Will usually end up together after meiosis – Tightly linked F1 1 : 2 : 1 F2 P
- 11. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping example III • Genes on same chromosome, but not very close together – Recombination will occur – Frequency of recombination proportional to distance between genes – Measured in centiMorgans =cM Recombinants Non-parental features One map unit = one centimorgan (cM) = 1% recombination between loci
- 12. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Genetic markers • Genetic mapping between positions on chromosomes – Positions can be genes • Responsible for phenotype – Examples: eye color or disease trait: limited – Positions can be physical markers • DNA sequence variation
- 13. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Physical markers • Physical markers are DNA sequences that vary between two related genomes • Referred to as a DNA polymorphism • Usually not in a gene – Examples • RFLP • SSLP • SNP
- 14. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 RFLP • Restriction-fragment length polymorphism – Cut genomic DNA from two individuals with restriction enzyme – Run Southern blot – Probe with different pieces of DNA – Sequence difference creates different band pattern GGATCC CCTAGG GTATCC GATAGG GGATCC CCTAGG 200 400 GGATCC CCTAGG GCATCC GGTAGG GGATCC CCTAGG 200 400* * 200 400 600 1 2 ** 2 1
- 15. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 SSLP/Microsatellites • Simple-sequence length polymorphism • Most genomes contain repeats of three or four nucleotides • Length of repeat varies due to slippage in replication • Use PCR with primers external to the repeat region • On gel, see difference in length of amplified fragment ATCCTACGACGACGACGATTGATGCT 12 18 1 2 2 1 ATCCTACGACGACGACGACGACGATTGATGCT
- 16. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 SNP • Single-nucleotide polymorphism – One-nucleotide difference in sequence of two organisms – Found by sequencing – Example: Between any two humans, on average one SNP every 1,000 base pairs ATCGATTGCCATGAC ATCGATGGCCATGAC2 1 SNP
- 17. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Physical mapping • Determination of physical distance between two points on chromosome – Distance in base pairs • Example: between physical marker and a gene • Need overlapping fragments of DNA – Requires vectors that accommodate large inserts • Examples: cosmids, YACs, and BACs
- 18. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Restriction mapping applied to large- insert clones • Generates a large number of fragments • Requires high-resolution separation of fragments – Can be done with gel electrophoresis
- 19. • FISH Technique-Fluorescentin situ hybridization • In FISH, the marker is a DNA sequence that is visualized by hybridization with a fluorescent probe. • Sequence tagged site (STS) mapping- • A sequence tagged site or STS is simply a short DNA sequence, generally between 100 and 500 bp in length
- 20. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Contigs • Contigs are groups of overlapping pieces of chromosomal DNA – Make contiguous clones • For sequencing one wants to create “minimum tiling path” – Contig of smallest number of inserts that covers a region of the chromosome genomic DNA contig minimum tiling path
- 21. © 2005 PrenticeHall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Contigs from overlapping restriction fragments • Cut inserts with restriction enzyme • Look for similar pattern of restriction fragments – Known as “fingerprinting” • Line up overlapping fragments • Continue until a contig is built
- 22. MAP BASED CLONING- Whatto Do Next? • Identify genes in this region • Then determine what is the gene of interest
- 23. Steps of MBC- •Identify a marker tightly linked to your gene in a "large" mapping population • Find a YAC or BAC clone to which the marker probe hybridizes • Create new markers from the large-insert clone and determine if they co-segregate with your gene • If necessary, re-screen the large-insert genomic library for other clones and search for co-segregating markers • Identify a candidate gene from large-inset clone whose markers co-segregate with the gene • Perform genetic complementation (transformation) to rescue the wild-type phenotype • Sequence the gene and determine if the function is known
- 24.
- 25. Find a YACor BAC clone to which the marker probe hybridizes
- 26. • Create newmarkers from the large-insert clone and determine if they co-segregate with your gene. Promoter Coding Region
- 27. • If necessary,re-screen the large-insert genomic library for other clones and search for co-segregating markers.
- 28. • Identify acandidate gene from large-inset clone whose markers co-segregate with the gene .
- 29. • Perform geneticcomplementation (transformation) to rescue the wild-type phenotype .
- 30. Map-based Cloning 1. Usegenetic techniques to find marker near gene Gene Marker 2. Find cosegregating marker Gene/Marker 3. Discover overlapping clones (or contig) that contains the marker Gene/Marker 4. Find ORFs on contig Gene/Marker 5. Prove one ORF is the gene by transformation or mutant analysis Mutant + ORF = Wild type? Yes? ORF = Gene
- 32. USES- • To makeresistance in plants and animals. • Diagnosis in diseases. • To make vaccines.
- 33. CONCLUSION • MBC isa new technology to create a clone of necessary nucleotide sequence. • It can be modified and changed , which depends on the type of the species.
- 34. REFERENCES • ta brown,Genomes ,2nd edition • Watson , Molecular Biology of the Gene (5th edition, 2004) • http://www.inia.org.uy/