Downloaded 202 times
![General NGS Workflow
2
DNA DNA Shearing
Adaptor and
Barcode [opt]
Attachment
Enrichment [optional]
Template/Library Preparation
Sequencing Analysis
Why enrich?](https://image.slidesharecdn.com/2013-07-30behlkengstargetenrichmentproductstokyo-130808100449-phpapp02/75/Improved-Reagents-Methods-for-Target-Enrichment-in-Next-Generation-Sequencing-2-2048.jpg)
Uploaded byIntegrated DNA Technologies
Improved Reagents & Methods for Target Enrichment in Next Generation Sequencing
The presentation discussed advancements in next-generation sequencing, specifically focusing on improved reagents and methods for target enrichment. It compared various enrichment methods, highlighting the benefits of IDT's xgen lockdowntm probes over traditional approaches like Agilent SureSelect. The new xgen blocking oligos further enhance capture efficiency by addressing issues with index mismatches, improving on-target rates, and allowing for rapid hybridization protocols.
More Related Content
Similar to Improved Reagents & Methods for Target Enrichment in Next Generation Sequencing
Improved Reagents & Methods for Target Enrichment in Next Generation Sequencing
- 1. Integrated DNA Technologies MarkBehlke MD, PhD Chief Scientific Officer Ootemachi First Square Conference July 30, 2013 MBL/IDT Next Gen Sequencing Symposium Improved Reagents & Methods for Target Enrichment in Next Generation Sequencing
- 2. General NGS Workflow 2 DNADNA Shearing Adaptor and Barcode [opt] Attachment Enrichment [optional] Template/Library Preparation Sequencing Analysis Why enrich?
- 3. Detecting rare variantsrequires enrichment + cost/time savings 3 1. Achieve many times greater coverage than with whole genome sequencing 2. Multiplex many samples on 1 lane Less cost per sample Many samples analyzed in a single run
- 4. Enrichment Methods 4 HybridCapture Amplicon PCR Micro droplet PCR Haloplex™ AmpliSeq™ Panels TruSeq™ Custom Amplicon
- 5. Comparing enrichment methods 5 HybridCapture Amplicon Enrichment Workflow More complex Slower (1-2 days) New fast protocol … Less complex Fast (< 1 day) Cost Higher upfront cost Lower cost per sample Lower upfront cost Higher cost per sample Problems Sequence / GC content bias Amplicon failures SNPs in primer sites Input DNA needed Med to High Low Capture size 5 KB to Whole Exome 5 KB to 1 MB New whole exome available Applications Variant analysis Gene expression / CNV Splice variants Translocations Variant analysis
- 6. Two different approachesto capture probes 6 • Agilent or NimbleGen whole exome kits • Low quality, low yield oligo probes made on microarray chips • Advantage = cheap to make a million probes (capture >50 Mb) • Perfect way to make whole exome sets • Disadvantage = low quality probes, cannot QC, no idea about individual probe concentration • Variable capture efficiency between target loci, big “GC” bias effect • Difficult, slow and costly to change content • IDT xGenTM LockdownTM Probes • High quality, high yield oligos made individually • Advantage = QC each oligo, measure and normalize yield prior to pooling • Improved capture efficiency between many loci • Disadvantage = higher price per probe (but high yield) • Use for small focused sets or to spike into whole exome sets • Easy to change content just make another oligo and add to pool! • High yield makes it cheaper when running lots of samples
- 7. IDT UltramerTM synthesis:the key to xGenTM LockdownTM probes 7 • Ultramers = ultra long oligos made on a specialized synthesis platform with custom supports and its own synthesis cycle • Highest possible coupling efficiency = long oligos can be made that otherwise could not be made. For 120mers, no need to purify! • 60-200mers sold to customers (size limit is set by our ability to perform ESI MS QC); within IDT, we use 60-300mers in our gene synthesis group
- 8. UltramersTM can bemade with high GC content (unlike arrays) 8 Calc. mass 37786.3 Da Measured 37789.6 Da BioGCGGCGAGCGGAGATCCGGGGCCTGCGCTGCGCACTCGAGCCTGGCGGGCCGGCACGGTGCGGGCC ATGAGCGGGGCGGTGCCCCAGGACCTAGCGGTGAGTGGCGGCCGAGTCGGGCAC ESI-MS trace of an xGENTM LockdownTM probe with 78% GC content
- 9. Two ways touse xGenTM LockdownTM Probes 9 1. Make your own small focused sets with 5-2000 KB coverage 2. Spike into whole exome array oligo sets to improve performance of products you may already be using 1. NimbleGen 2. Agilent
- 10. Improve Agilent SureSelectTM– example from Foundation Medicine 10 • Custom Agilent SureSelectTM 1.1 Mbp capture array for Foundation Medicine • Prototype in development for oncology medical re-sequencing panel • Problems seen with getting complete coverage of desired exons • Spike in 1100 IDT xGenTM LockdownTM probes (5’-biotin, 120mers) • 135 Kbp coverage, duplicates what should already be in tiled array • Sequence on Illumina HiSeq2000 platform Foundation Medicine Boston, Massachusetts
- 11. Improve performance ofwhole exome capture kits (spike-in) 11 Foundation Medicine Boston, Massachusetts Before supplementation with xGenTM LockdownTM probes After supplementation with xGenTM LockdownTM Probes
- 12. Replace SureSelectTM withcustom xGenTM LockdownTM Probe Library 12 Foundation Medicine Boston, Massachusetts Results from Foundation Medicine comparing results of a large set of IDT xGenTM LockdownTM probes with a focused Agilent SureSelectTM set. IDT xGEN: 100% >150x coverage Agilent: 80.7% >150x coverage # Reads IDT Agilent
- 13. xGenTM LockdownTM Probesshow less GC bias 13 Foundation Medicine Boston, Massachusetts IDT Agilent
- 14. Design of captureprobes 14 xGenTM LockdownTM probes are high quality UltramerTM synthesis. Each oligo gets mass spec QC and is OD260 measured with quantity normalized. SureSelectTM and other low quality array oligos need large overlaps. You cannot QC each oligo so you need to have high overlap to help ensure coverage.
- 15. Do mutations intarget hurt capture efficiency? 15 • Short oligos can distinguish a single SNP site based on hybridization. Since the goal is to capture variants and detect these by sequencing, do we risk missing SNPs due to hybridization failure? • Long 120mers, however, are very tolerant to mismatch • How tolerant? • Studied Tm of hybridization of a single 120mer bait oligo to different targets having 0-7 bases mismatch (either permissive G:T pairing or more disruptive T:T pairings) • Also studied targets with 1, 3, or 7 base insertions (indels)
- 16. Design of 120merTm experiment 16
- 17. DTm with 1-7base mismatches (SNPs) 17 Mismatches Tm oC Measured DTm oC Mismatch Tm oC Predicted 0 85.7 -- 87.6 1 T-T 85.6 - 0.1 87.1 1 T-T 85.0 - 0.7 86.9 3 T-T 84.2 - 1.5 85.7 7 T-T 80.9 - 4.8 82.9 7 T-G 81.6 - 4.1 85.8
- 18. DTm with 1,3, or 7 base insertions (indels) 18 Bulge Tm oC Measured DTm oC Mismatch None 85.7 -- 1 T 85.3 - 0.4 3 T 84.8 - 0.9 7 T 83.9 - 1.8 7 T + 7 T 82.3 - 3.4 7 C + 7 C 82.4 - 3.3
- 19. Conclusions from Tmstudies 19 • 1-7 base mismatches had < 5oC DTm • 1 or 2 1-7 base insertions had < 4oC DTm • These small changes in Tm should not affect capture • Thus use of 120mer capture probes is sufficient and should be effective in capturing targets even when a significant level of polymorphism is present
- 20. Blocking oligos –another critical component of enrichment/capture 20 Two classes of blocking oligos are needed: 1) Cot1 DNA = Alu, LINE repeat elements 2) linkers/adaptors
- 21. Importance of usingHuman Cot1 blocking DNA 21 Example: Merkel Cell Polyomavirus study: Capture hyb with 1 ug Cot1 DNA Total Reads 7,603,264 Capture specific 520,304 Match to virus 6.8% Capture hyb without Cot1 DNA Total Reads 2,313,487 Capture specific 57,967 Match to virus 2.5%
- 22. New product: xGen®Blocking Oligos 22 Two classes of blocking oligos are needed: 1) Cot1 DNA = Alu, Line repeat elements 2) linkers/adaptors A new generation of blockers to improve this step in the enrichment process
- 23. New xGen® BlockingOligos 23 In early experiment, simple DNA blockers proved to be effective. By adding excess blocker, ‘mass action’ drives hybridization in favor of the blocker-adaptor instead of the undesired blocker-blocker pairing. However, in most experiments done today, either one or both adaptors contains an “index” or “bar code” sequence of 6-8 bases. Highly multiplexed experiments now have mismatched blockers binding to adaptors, and on-target capture rates dropped. IDT offers a new solution to this problem: xGen® Blocking Oligos . The new generation of blockers incorporates Inosine bases to pair with index domains, so a single blocker can be used with all index variants. Further, the new blockers have additional improvements which increase effectiveness and give higher on-target capture rates.
- 24. Example of Inosineincorporation in one specific adaptor 24 TruSeq P7 Index 6 x I (also have 8 x I) CAAGCAGAAGACGGCATACGAGAT(IIIIII)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTx TruSeq P5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTx Note: Inosine is not a universal pairing base, as indicated by the decreasing stability (I·C > I·A > I·T ≈ I· G > I·I), it is most stable in a G-C base pair. However it does offer advantages over a N degenerate base, especially with longer indices. Norman E. Watkins, Jr and John SantaLucia, Jr Nucleic Acids Res. 2005; 33(19): 6258–6267 In addition to Inosine, the blockers have proprietary changes made which improve performance.
- 25. Performance of xGen®Blocking Oligos with an 11,000 probe capture set 25 The IDT xGen LockdownTM Cancer Panel bait set (264 genes, 11,738 probes, 1.2 Mbp coverage) was used to enrich 4 independent libraries with unique index adaptors. The libraries were mixed and capture was performed in a multiplex hybridization reaction with standard 48 hour hybridization.
- 26. Improved depth ofcoverage using xGen® Blocking Oligos 26 The IDT xGen LockdownTM Cancer Panel bait set was used to enrich 4 independent libraries with unique index adaptors. The libraries were mixed and capture was performed in a multiplex hybridization reaction with standard 48 hour hybridization.
- 27. New rapid 4hour hybridization/capture reaction 27 The IDT xGen LockdownTM Cancer Panel bait set was used to enrich 4 independent libraries with unique index adaptors. The libraries were mixed and capture was performed in a multiplex hybridization reaction using new buffers and protocols with only a 4 hour hybridization step.
- 28. Benefits of thenew blockers: Foundation Medicine 28 Standard blockers and new IDT xGen® Blocking Oligos were compared in an exon capture experiment using a focused set covering ~2Mb StandardStandard Blockers xGen® Blocking Oligos Foundation Medicine Boston, Massachusetts
- 29. Benefits of thenew blockers: Washington University 29 Standard blockers and new IDT xGen® Blocking Oligos were compared in an exon capture experiment using a NimbleGen whole exome array (44Mb) The Genome Institute, Washington University St. Louis, Missouri, USA UnMod #1 Mod #2 Mod #3 Mod #4UnmodStandard Blockers xGen® Blocking Oligos
- 30. Thanks to allthe scientists who contributed to these studies! 30 Foundation Medicine Mirna Jarosz Zac Zwirko Michele Nahas The Genome Institute Washington University Elaine Mardis Bob Fulton Vince Magrini Ryan Demeter Integrated DNA Technologies Scott Rose Ashley Dvorak Katie Popp Bailey Clark Stephen Groenewold Richard Owczarzy
- 31. LockdownTM Probe TechnologyDevelopment Group 31 Ashley DvorakBailey Clark Katie Popp