Improved Reagents & Methods for Target Enrichment in Next Generation Sequencing, presented by Dr Mark Behlke, Chief Scientific Officer at Integrated DNA Technologies

1. Integrated DNA Technologies
Mark Behlke MD, PhD Chief Scientific Officer
Ootemachi First Square Conference July 30, 2013
MBL/IDT Next Gen Sequencing Symposium
Improved Reagents & Methods for Target
Enrichment in Next Generation Sequencing

2. General NGS Workflow
2
DNA DNA Shearing
Adaptor and
Barcode [opt]
Attachment
Enrichment [optional]
Template/Library Preparation
Sequencing Analysis
Why enrich?

3. Detecting rare variants requires enrichment + cost/time savings
3
1. Achieve many times greater coverage than with whole genome sequencing
2. Multiplex many samples on 1 lane
Less cost per sample
Many samples analyzed in a single run

4. Enrichment Methods
4
 Hybrid Capture  Amplicon
PCR
Micro droplet PCR
Haloplex™
AmpliSeq™ Panels
TruSeq™ Custom Amplicon

5. Comparing enrichment methods
5
Hybrid Capture Amplicon Enrichment
Workflow
More complex
Slower (1-2 days)
New fast protocol …
Less complex
Fast (< 1 day)
Cost
Higher upfront cost
Lower cost per sample
Lower upfront cost
Higher cost per sample
Problems Sequence / GC content bias
Amplicon failures
SNPs in primer sites
Input DNA needed Med to High Low
Capture size 5 KB to Whole Exome
5 KB to 1 MB
New whole exome
available
Applications
Variant analysis
Gene expression / CNV
Splice variants
Translocations
Variant analysis

6. Two different approaches to capture probes
6
• Agilent or NimbleGen whole exome kits
• Low quality, low yield oligo probes made on microarray chips
• Advantage = cheap to make a million probes (capture >50 Mb)
• Perfect way to make whole exome sets
• Disadvantage = low quality probes, cannot QC, no idea about individual
probe concentration
• Variable capture efficiency between target loci, big “GC” bias effect
• Difficult, slow and costly to change content
• IDT xGenTM LockdownTM Probes
• High quality, high yield oligos made individually
• Advantage = QC each oligo, measure and normalize yield prior to pooling
• Improved capture efficiency between many loci
• Disadvantage = higher price per probe (but high yield)
• Use for small focused sets or to spike into whole exome sets
• Easy to change content  just make another oligo and add to pool!
• High yield makes it cheaper when running lots of samples

7. IDT UltramerTM synthesis: the key to xGenTM LockdownTM probes
7
• Ultramers = ultra long oligos made on a specialized synthesis platform with
custom supports and its own synthesis cycle
• Highest possible coupling efficiency = long oligos can be made that
otherwise could not be made. For 120mers, no need to purify!
• 60-200mers sold to customers (size limit is set by our ability to perform ESI
MS QC); within IDT, we use 60-300mers in our gene synthesis group

8. UltramersTM can be made with high GC content (unlike arrays)
8
Calc. mass 37786.3 Da
Measured 37789.6 Da
BioGCGGCGAGCGGAGATCCGGGGCCTGCGCTGCGCACTCGAGCCTGGCGGGCCGGCACGGTGCGGGCC
ATGAGCGGGGCGGTGCCCCAGGACCTAGCGGTGAGTGGCGGCCGAGTCGGGCAC
ESI-MS trace of an
xGENTM LockdownTM probe
with 78% GC content

9. Two ways to use xGenTM LockdownTM Probes
9
1. Make your own small focused sets with 5-2000 KB coverage
2. Spike into whole exome array oligo sets to improve performance of
products you may already be using
1. NimbleGen
2. Agilent

10. Improve Agilent SureSelectTM – example from Foundation Medicine
10
• Custom Agilent SureSelectTM 1.1 Mbp capture array for Foundation Medicine
• Prototype in development for oncology medical re-sequencing panel
• Problems seen with getting complete coverage of desired exons
• Spike in 1100 IDT xGenTM LockdownTM probes (5’-biotin, 120mers)
• 135 Kbp coverage, duplicates what should already be in tiled array
• Sequence on Illumina HiSeq2000 platform
Foundation Medicine
Boston, Massachusetts

11. Improve performance of whole exome capture kits (spike-in)
11
Foundation Medicine
Boston, Massachusetts
Before supplementation with
xGenTM LockdownTM probes
After supplementation with
xGenTM LockdownTM Probes

12. Replace SureSelectTM with custom xGenTM LockdownTM Probe Library
12
Foundation Medicine
Boston, Massachusetts
Results from Foundation Medicine comparing results of a large set of
IDT xGenTM LockdownTM probes with a focused Agilent SureSelectTM set.
IDT xGEN: 100% >150x coverage
Agilent: 80.7% >150x coverage
# Reads
IDT
Agilent

13. xGenTM LockdownTM Probes show less GC bias
13
Foundation Medicine
Boston, Massachusetts
IDT
Agilent

14. Design of capture probes
14
xGenTM LockdownTM probes are high quality UltramerTM synthesis. Each oligo gets
mass spec QC and is OD260 measured with quantity normalized.
SureSelectTM and other low quality array oligos need large overlaps. You cannot QC
each oligo so you need to have high overlap to help ensure coverage.

15. Do mutations in target hurt capture efficiency?
15
• Short oligos can distinguish a single SNP site based on hybridization.
Since the goal is to capture variants and detect these by sequencing, do
we risk missing SNPs due to hybridization failure?
• Long 120mers, however, are very tolerant to mismatch
• How tolerant?
• Studied Tm of hybridization of a single 120mer bait oligo to different
targets having 0-7 bases mismatch (either permissive G:T pairing or
more disruptive T:T pairings)
• Also studied targets with 1, 3, or 7 base insertions (indels)

16. Design of 120mer Tm experiment
16

17. DTm with 1-7 base mismatches (SNPs)
17
Mismatches
Tm oC
Measured
DTm oC
Mismatch
Tm oC
Predicted
0 85.7 -- 87.6
1 T-T 85.6 - 0.1 87.1
1 T-T 85.0 - 0.7 86.9
3 T-T 84.2 - 1.5 85.7
7 T-T 80.9 - 4.8 82.9
7 T-G 81.6 - 4.1 85.8

18. DTm with 1, 3, or 7 base insertions (indels)
18
Bulge
Tm oC
Measured
DTm oC
Mismatch
None 85.7 --
1 T 85.3 - 0.4
3 T 84.8 - 0.9
7 T 83.9 - 1.8
7 T + 7 T 82.3 - 3.4
7 C + 7 C 82.4 - 3.3

19. Conclusions from Tm studies
19
• 1-7 base mismatches had < 5oC DTm
• 1 or 2 1-7 base insertions had < 4oC DTm
• These small changes in Tm should not affect capture
• Thus use of 120mer capture probes is sufficient and should
be effective in capturing targets even when a significant level
of polymorphism is present

20. Blocking oligos – another critical component of enrichment/capture
20
Two classes of blocking
oligos are needed:
1) Cot1 DNA = Alu, LINE
repeat elements
2) linkers/adaptors

21. Importance of using Human Cot1 blocking DNA
21
Example: Merkel Cell Polyomavirus study:
Capture hyb with 1 ug Cot1 DNA
Total Reads 7,603,264
Capture specific 520,304
Match to virus 6.8%
Capture hyb without Cot1 DNA
Total Reads 2,313,487
Capture specific 57,967
Match to virus 2.5%

22. New product: xGen® Blocking Oligos
22
Two classes of blocking
oligos are needed:
1) Cot1 DNA = Alu, Line
repeat elements
2) linkers/adaptors
A new generation of
blockers to improve this
step in the enrichment
process

23. New xGen® Blocking Oligos
23
In early experiment, simple DNA blockers proved to be effective. By adding excess
blocker, ‘mass action’ drives hybridization in favor of the blocker-adaptor instead
of the undesired blocker-blocker pairing.
However, in most experiments done today, either one or both adaptors contains
an “index” or “bar code” sequence of 6-8 bases. Highly multiplexed experiments
now have mismatched blockers binding to adaptors, and on-target capture rates
dropped.
IDT offers a new solution to this problem: xGen® Blocking Oligos .
The new generation of blockers incorporates Inosine bases to pair with index
domains, so a single blocker can be used with all index variants. Further, the new
blockers have additional improvements which increase effectiveness and give
higher on-target capture rates.

24. Example of Inosine incorporation in one specific adaptor
24
TruSeq P7 Index 6 x I (also have 8 x I)
CAAGCAGAAGACGGCATACGAGAT(IIIIII)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTx
TruSeq P5
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTx
Note: Inosine is not a universal pairing base, as indicated by the decreasing stability
(I·C > I·A > I·T ≈ I· G > I·I), it is most stable in a G-C base pair.
However it does offer advantages over a N degenerate base, especially with longer indices.
Norman E. Watkins, Jr and John SantaLucia, Jr
Nucleic Acids Res. 2005; 33(19): 6258–6267
In addition to Inosine, the blockers have proprietary changes made which improve performance.

25. Performance of xGen® Blocking Oligos with an 11,000 probe capture set
25
The IDT xGen LockdownTM Cancer Panel bait set (264 genes, 11,738 probes, 1.2 Mbp
coverage) was used to enrich 4 independent libraries with unique index adaptors. The
libraries were mixed and capture was performed in a multiplex hybridization reaction
with standard 48 hour hybridization.

26. Improved depth of coverage using xGen® Blocking Oligos
26
The IDT xGen LockdownTM Cancer Panel bait set was used to enrich 4 independent
libraries with unique index adaptors. The libraries were mixed and capture was
performed in a multiplex hybridization reaction with standard 48 hour hybridization.

27. New rapid 4 hour hybridization/capture reaction
27
The IDT xGen LockdownTM Cancer Panel bait set was used to enrich 4
independent libraries with unique index adaptors. The libraries were
mixed and capture was performed in a multiplex hybridization reaction
using new buffers and protocols with only a 4 hour hybridization step.

28. Benefits of the new blockers: Foundation Medicine
28
Standard blockers and new IDT xGen® Blocking Oligos were compared in
an exon capture experiment using a focused set covering ~2Mb
StandardStandard Blockers xGen® Blocking Oligos
Foundation Medicine
Boston, Massachusetts

29. Benefits of the new blockers: Washington University
29
Standard blockers and new IDT xGen® Blocking Oligos were compared in an exon
capture experiment using a NimbleGen whole exome array (44Mb)
The Genome Institute, Washington University
St. Louis, Missouri, USA
UnMod #1 Mod #2 Mod #3 Mod #4UnmodStandard
Blockers
xGen® Blocking Oligos

30. Thanks to all the scientists who contributed to these studies!
30
Foundation Medicine
Mirna Jarosz
Zac Zwirko
Michele Nahas
The Genome Institute
Washington University
Elaine Mardis
Bob Fulton
Vince Magrini
Ryan Demeter
Integrated DNA Technologies
Scott Rose
Ashley Dvorak
Katie Popp
Bailey Clark
Stephen Groenewold
Richard Owczarzy

31. LockdownTM Probe Technology Development Group
31
Ashley DvorakBailey Clark Katie Popp