This chapter discusses DNA fingerprinting, which involves analyzing variable regions of DNA, like VNTRs and STRs, to develop a unique genetic profile that can identify individuals and determine relationships. The key steps are extracting DNA from samples, cutting the DNA into fragments using restriction enzymes, amplifying the fragments via PCR, and then separating the fragments by size via gel electrophoresis to view the band pattern DNA fingerprint. DNA fingerprinting is used in forensics to match crime scene evidence to suspects and establish familial connections through patterns of inheritance.
Define DNA fingerprint and DNA fingerprinting.
Explain some terms related to DNA fingerprinting.
Describe the method of collection and preservation of biological samples.
Describe the uses of DNA fingerprinting.
Describe the types of DNA fingerprinting.
Describe the steps of DNA fingerprinting.
DNA profiling process, RFLP analysis, STR analysis by PCR, basic principle of dna fingerprinting, advantages and disadvantages of RFLP and STR analysis
Define DNA fingerprint and DNA fingerprinting.
Explain some terms related to DNA fingerprinting.
Describe the method of collection and preservation of biological samples.
Describe the uses of DNA fingerprinting.
Describe the types of DNA fingerprinting.
Describe the steps of DNA fingerprinting.
DNA profiling process, RFLP analysis, STR analysis by PCR, basic principle of dna fingerprinting, advantages and disadvantages of RFLP and STR analysis
DNA fingerprinting is a method used to identify living things based on samples of their DNA. Instead of looking at the whole sequence of a person’s DNA, these techniques look at the presence or absence of common markers that can be quickly and easily identified.
DNA Fingerprinting Explained, Techniques Used, Usage, Limitations and Contradictions.
*I won an Award for the Best Power Point Project Presentation in class 12th for this project. :D
DNA fingerprinting is a method used to identify living things based on samples of their DNA. Instead of looking at the whole sequence of a person’s DNA, these techniques look at the presence or absence of common markers that can be quickly and easily identified.
DNA Fingerprinting Explained, Techniques Used, Usage, Limitations and Contradictions.
*I won an Award for the Best Power Point Project Presentation in class 12th for this project. :D
This presentation is about DNA fingerprinting, a brief description is given about its principle, working, technique and its application with a example.
Dna fingerprinting the future of forensic dentistryMadhurima Kundu
The realization that DNA lies behind all the cell's activities led to the development of molecular biology. The technology that uses tandem repeats of individuals is known as DNA fingerprinting. DNA fingerprinting or DNA profile are encrypted sets of numbers that reflect a person's DNA makeup, which can also be used as the person's identifier. DNA fingerprinting is a tool used to unravel all the mysteries associated with the oral cavity and its manifestations during diseased conditions. The technical advances in molecular biology have propelled the analysis of the DNA into routine usage in crime laboratories for rapid and early diagnosis. The anatomical location of teeth and the extent to which teeth may suffer environmental changes and still provide useful DNA material has propelled forensic odontology. The arrival of DNA fingerprinting has revolutionised the concept of identification. It is reasonable to anticipate the future advances in DNA technology will reduce the time and cost factor for identification of unknown deceased.
The power point presentation consists of 36 slides explaining about history, principle, different steps involved and applications of DNA fingerprinting. Recent Developments and the Future prospects of DNA profiling have also been mentioned
This presentation is regarding the technology involved in the polygraph machine. It describes the procedures involved in carrying out the so called 'Lie detector ' test for criminal investigation and other purposes.
a machine designed to detect and record changes in physiological characteristics, such as a person's pulse and breathing rates, used especially as a lie detector.
The increased availability of biomedical data, particularly in the public domain, offers the opportunity to better understand human health and to develop effective therapeutics for a wide range of unmet medical needs. However, data scientists remain stymied by the fact that data remain hard to find and to productively reuse because data and their metadata i) are wholly inaccessible, ii) are in non-standard or incompatible representations, iii) do not conform to community standards, and iv) have unclear or highly restricted terms and conditions that preclude legitimate reuse. These limitations require a rethink on data can be made machine and AI-ready - the key motivation behind the FAIR Guiding Principles. Concurrently, while recent efforts have explored the use of deep learning to fuse disparate data into predictive models for a wide range of biomedical applications, these models often fail even when the correct answer is already known, and fail to explain individual predictions in terms that data scientists can appreciate. These limitations suggest that new methods to produce practical artificial intelligence are still needed.
In this talk, I will discuss our work in (1) building an integrative knowledge infrastructure to prepare FAIR and "AI-ready" data and services along with (2) neurosymbolic AI methods to improve the quality of predictions and to generate plausible explanations. Attention is given to standards, platforms, and methods to wrangle knowledge into simple, but effective semantic and latent representations, and to make these available into standards-compliant and discoverable interfaces that can be used in model building, validation, and explanation. Our work, and those of others in the field, creates a baseline for building trustworthy and easy to deploy AI models in biomedicine.
Bio
Dr. Michel Dumontier is the Distinguished Professor of Data Science at Maastricht University, founder and executive director of the Institute of Data Science, and co-founder of the FAIR (Findable, Accessible, Interoperable and Reusable) data principles. His research explores socio-technological approaches for responsible discovery science, which includes collaborative multi-modal knowledge graphs, privacy-preserving distributed data mining, and AI methods for drug discovery and personalized medicine. His work is supported through the Dutch National Research Agenda, the Netherlands Organisation for Scientific Research, Horizon Europe, the European Open Science Cloud, the US National Institutes of Health, and a Marie-Curie Innovative Training Network. He is the editor-in-chief for the journal Data Science and is internationally recognized for his contributions in bioinformatics, biomedical informatics, and semantic technologies including ontologies and linked data.
Professional air quality monitoring systems provide immediate, on-site data for analysis, compliance, and decision-making.
Monitor common gases, weather parameters, particulates.
Multi-source connectivity as the driver of solar wind variability in the heli...Sérgio Sacani
The ambient solar wind that flls the heliosphere originates from multiple
sources in the solar corona and is highly structured. It is often described
as high-speed, relatively homogeneous, plasma streams from coronal
holes and slow-speed, highly variable, streams whose source regions are
under debate. A key goal of ESA/NASA’s Solar Orbiter mission is to identify
solar wind sources and understand what drives the complexity seen in the
heliosphere. By combining magnetic feld modelling and spectroscopic
techniques with high-resolution observations and measurements, we show
that the solar wind variability detected in situ by Solar Orbiter in March
2022 is driven by spatio-temporal changes in the magnetic connectivity to
multiple sources in the solar atmosphere. The magnetic feld footpoints
connected to the spacecraft moved from the boundaries of a coronal hole
to one active region (12961) and then across to another region (12957). This
is refected in the in situ measurements, which show the transition from fast
to highly Alfvénic then to slow solar wind that is disrupted by the arrival of
a coronal mass ejection. Our results describe solar wind variability at 0.5 au
but are applicable to near-Earth observatories.
Nutraceutical market, scope and growth: Herbal drug technologyLokesh Patil
As consumer awareness of health and wellness rises, the nutraceutical market—which includes goods like functional meals, drinks, and dietary supplements that provide health advantages beyond basic nutrition—is growing significantly. As healthcare expenses rise, the population ages, and people want natural and preventative health solutions more and more, this industry is increasing quickly. Further driving market expansion are product formulation innovations and the use of cutting-edge technology for customized nutrition. With its worldwide reach, the nutraceutical industry is expected to keep growing and provide significant chances for research and investment in a number of categories, including vitamins, minerals, probiotics, and herbal supplements.
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...Scintica Instrumentation
Intravital microscopy (IVM) is a powerful tool utilized to study cellular behavior over time and space in vivo. Much of our understanding of cell biology has been accomplished using various in vitro and ex vivo methods; however, these studies do not necessarily reflect the natural dynamics of biological processes. Unlike traditional cell culture or fixed tissue imaging, IVM allows for the ultra-fast high-resolution imaging of cellular processes over time and space and were studied in its natural environment. Real-time visualization of biological processes in the context of an intact organism helps maintain physiological relevance and provide insights into the progression of disease, response to treatments or developmental processes.
In this webinar we give an overview of advanced applications of the IVM system in preclinical research. IVIM technology is a provider of all-in-one intravital microscopy systems and solutions optimized for in vivo imaging of live animal models at sub-micron resolution. The system’s unique features and user-friendly software enables researchers to probe fast dynamic biological processes such as immune cell tracking, cell-cell interaction as well as vascularization and tumor metastasis with exceptional detail. This webinar will also give an overview of IVM being utilized in drug development, offering a view into the intricate interaction between drugs/nanoparticles and tissues in vivo and allows for the evaluation of therapeutic intervention in a variety of tissues and organs. This interdisciplinary collaboration continues to drive the advancements of novel therapeutic strategies.
THE IMPORTANCE OF MARTIAN ATMOSPHERE SAMPLE RETURN.Sérgio Sacani
The return of a sample of near-surface atmosphere from Mars would facilitate answers to several first-order science questions surrounding the formation and evolution of the planet. One of the important aspects of terrestrial planet formation in general is the role that primary atmospheres played in influencing the chemistry and structure of the planets and their antecedents. Studies of the martian atmosphere can be used to investigate the role of a primary atmosphere in its history. Atmosphere samples would also inform our understanding of the near-surface chemistry of the planet, and ultimately the prospects for life. High-precision isotopic analyses of constituent gases are needed to address these questions, requiring that the analyses are made on returned samples rather than in situ.
Seminar of U.V. Spectroscopy by SAMIR PANDASAMIR PANDA
Spectroscopy is a branch of science dealing the study of interaction of electromagnetic radiation with matter.
Ultraviolet-visible spectroscopy refers to absorption spectroscopy or reflect spectroscopy in the UV-VIS spectral region.
Ultraviolet-visible spectroscopy is an analytical method that can measure the amount of light received by the analyte.
2. Chapter 7 DNA Fingerprinting
Objectives and Vocabulary
Objectives
– Explain how crime scene
evidence is collected for DNA
analysis
– Describe how crime scene
evidence is processed to obtain
DNA
– Describe how radioactive probes
are used in DNA fingerprinting
– Explain how DNA is compared for
matching
– Explain how DNA fingerprinting is
used to determine if specimens
come from related or unrelated
individuals
– Explain how to use DNA
fingerprinting to identify DNA from
a parent, child, or relative of
another person
Vocabulary
– Allele
– Chromosome
– DNA fingerprint
– DNA probe
– Electrophoresis
– Gene
– PCR (polymerase chain reaction)
– Restriction enzyme
– STR (short tandem repeat)
– VNTR (variable number of tandem
repeats)
3. Chapter 7 DNA Fingerprinting
Introduction
Except for identical twins,
not two people have the
same DNA.
Since the 1980’s DNA
evidence has been used
to investigate crimes,
establish paternity, or
identify victims of large
scale disasters.
DNA evidence can only
be linked to only one
person
4. Chapter 7 DNA Fingerprinting
History of Biological Evidence in
Forensics
Types of biological evidence
– Skin
– Blood
– Saliva
– Urine
– Semen
– hair
Their chromosomes can be examined to determine,
karyotyping
Ex. blood typing
DNA fingerprinting is used in criminal and legal cases to
determine identity and parentage.
5. Chapter 7 DNA Fingerprinting
The Function and Structure of
DNA
DNA is a blueprint of life, contains the genetic
material of the cell
Makes proteins and copies of itself
Genetic information is stored in molecules of
DNA making up structures called chromosomes
Made up of two strands, know as a double helix
James Watson and Francis Crick received the
1953 Nobel Prize for describing the structure of
DNA
6. Chapter 7 DNA Fingerprinting
The Function and Structure of
DNA
1. Sugar phosphate
backbone
2. Phosphate Group
3. Nitrogenous bases
joined by hydrogen
bonds
Adenine
Thymine
Guanine
Cytosine
7. Chapter 7 DNA Fingerprinting
The Different DNA Bases
DNA strands are considered to be
complementary
Following complementary base pairing
rules
– A pairs with T
– G pairs with C
A G C G C C G A T T A G C G C T A
AT AAC G C C C CG G T T G G T
8. Chapter 7 DNA Fingerprinting
The Different DNA Bases
There are 23 pairs of
chromosomes (a total of
46)
One chromosome of each
pair is inherited from the
mother and one from the
father
Two types of DNA
– Nuclear – virtually identical
in all cells of the human
body
– Mitochondrial – is passed
in the cytoplasm of the egg,
found in the mitochondrial,
circular
9. Chapter 7 DNA Fingerprinting
Genes and Alleles
Genes are DNA
sequences that have
instructions that
determine our inherited
characteristics or traits
Genes also make up
RNA
– RNA single stranded
– Does not include T, has
uracil (U)
An allele is one of two or
more alternative forms of
a gene (one allele from
the mother one allele
from the father)
10. Chapter 7 DNA Fingerprinting
Genes and Alleles
Entire human genome is contained in the
nucleus
Approx. 3 billion base pairs
DNA RNA proteins
Has exons (produces RNA and proteins)
and introns (“junk” DNA, may be useful in
gene splicing)
The nucleus of each human cell contains
23,688 genes, averaging 3,000 bp
Central
Dogma
12. Chapter 7 DNA Fingerprinting
DNA Identification
Most of the human genome is the same,
but there are some variations, this allows
us to identify individuals
Have unique sequences in non-coded
DNA
DNA sequences have different lengths
and different sequences, these differences
are called polymorphisms
13. Chapter 7 DNA Fingerprinting
DNA Identification
1984, Dr. Alec Jeffreys
developed a technique for
isolating and analyzing
these variable areas,
knows as DNA
fingerprinting or DNA
profiling
Unique patterns look like
bands
The examination of DNA
profiles can help forensic
scientists decide if two or
more DNA samples are
from the same individual
14. Chapter 7 DNA Fingerprinting
VNTR
Variable number of tandem repeats
(VNTR)
Certain short sequences of DNA are
repeated multiple times
The number of repeats differ from person
to person
Ex.
CATACAGACCATACAGACCATACAGAC
15. Chapter 7 DNA Fingerprinting
STR
Short tandem repeat (STR)
High degree of polymorphism and most useful
for DNA analysis
Much shorter than VNTR, usually only two to five
bp in length
Different number of copies of the repeat element
Ex.
GATAGATAGATAGATAGATAGATAGATAGATA
Preferred because of its accuracy and because
small and partially degraded DNA samples may
be analyzed still
16. Chapter 7 DNA Fingerprinting
DNA Profile
A DNA fingerprint can be developed with
several different VNTRs and STRs
For tissue matching, two samples that
have the same band pattern are from the
same person
For inheritance matching, each band in a
child’s DNA fingerprint must be present in
at least one parent
17. Chapter 7 DNA Fingerprinting
DNA Profile
Two main purposes
– Tissue matching
Exact same pattern
– Inheritance matching
Follows the rules of
inheritance
19. Chapter 7 DNA Fingerprinting
Population Genetics and DNA
Databases
Population genetics – the study of
variation in genes among a group of
individuals
Ex.
– Asian populations, blue eyes are rare (more
common among northern Europeans)
– Great Britain/US, 46% of people have O blood
but native South Americans, almost of 100%
of population has O blood
20. Chapter 7 DNA Fingerprinting
Collection and Preservation of DNA
Evidence
Attention to contamination issues is
necessary
Can occur if DNA from another source is
mixed into the DNA from the crime scene
21. Chapter 7 DNA Fingerprinting
Preparing DNA Samples for
Fingerprinting
Use gel
electrophoresis
– When different sized
DNA fragments are
separated with an
agarose gel
22. Chapter 7 DNA Fingerprinting
Steps of DNA Fingerprinting
1. Extraction.
extraction from the nucleus
2. Restriction fragments.
cuts into smaller pieces at specific sequences
3. Amplification.
PCR (polymerase chain reaction)
4. Electrophoresis
23. Chapter 7 DNA Fingerprinting
Electrophoresis
Movement based on
size and charge
– DNA is negatively
charged
Sample is placed in a
well
