The document outlines a systematic approach for analyzing genotype-phenotype correlations, particularly in the context of African trypanosomiasis. It critiques current manual methods for their inefficiency and suggests automating analysis through workflows and text mining to improve accuracy and scalability. The case study demonstrates that a more structured methodology can lead to the discovery of significant candidate genes that traditional methods may overlook.

1. A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations Paul Fisher Dr. Robert Stevens Prof. Andrew Brass

2. The entire genetic identity of an individual that does not show any outward characteristics, e.g. Genes, mutations Genotype DNA ACTGCACTGACTGTACGTATATCT ACTGCACTG TG TGTACGTATATCT Mutations Genes

3. (harder to characterise) The observable expression of gene’s producing notable characteristics in an individual, e.g. Hair or eye colour, body mass, resistance to disease Phenotype vs. Brown White and Brown

4. Genotype to Phenotype

5. Genotype Phenotype ? Current Methods 200 What processes to investigate?

6. ? 200 Microarray + QTL Genes captured in microarray experiment and present in QTL ( Quantitative Trait Loci ) region Genotype Phenotype Metabolic pathways Phenotypic response investigated using microarray in form of expressed genes or evidence provided through QTL mapping

7. CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype

8. Issues with current approaches

9. Huge amounts of data 200+ Genes QTL region on chromosome Microarray 1000+ Genes How do I look at ALL the genes systematically?

10. Hypothesis-Driven Analyses 200 QTL genes Case: African Sleeping sickness - parasitic infection - Known immune response Pick the genes involved in immunological process 40 QTL genes Pick the genes that I am most familiar with 2 QTL genes Biased view Result: African Sleeping sickness Immune response Cholesterol control Cell death

11. Manual Methods of data analysis Navigating through hyperlinks No explicit methods Human error Tedious and repetitive

12. Implicit methods

13. Issues with current approaches Scale of analysis task User bias and premature filtering Hypothesis-Driven approach to data analysis Constant flux of data - problems with re-analysis of data Implicit methodologies (hyper-linking through web pages) Error proliferation from any of the listed issues Solution – Automate through workflows

14. The Two W’s Web Services Technology and standard for exposing code / database with an means that can be consumed by a third party remotely Describes how to interact with it Workflows General technique for describing and executing a process Describes what you want to do

15. Taverna Workflow Workbench http://taverna.sf.net

16. Hypothesis Utilising the capabilities of workflows and the pathway-driven approach, we are able to provide a more: - systematic - efficient - scalable - un-biased - unambiguous the benefit will be that new biology results will be derived, increasing community knowledge of genotype and phenotype interactions.

17. Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource

18. Replicated original chain of data analysis

19. Trypanosomiasis in Africa http://www.genomics.liv.ac.uk/tryps/trypsindex.html Andy Brass Steve Kemp + many Others

20. Preliminary Results Trypanosomiasis resistance A strong candidate gene was found Daxx gene not found using manual investigation methods The gene was identified from analysis of biological pathway information Possible candidate identified by Yan et al (2004): Daxx SNP info Sequencing of the Daxx gene in Wet Lab showed mutations that is thought to change the structure of the protein Mutation was published in scientific literature, noting its effect on the binding of Daxx protein to p53 protein – p53 plays direct role in cell death and apoptosis, one of the Trypanosomiasis phenotypes More genes to follow (hopefully) in publications being written

21. Shameless Plug! A Systematic Strategy for Large-Scale Analysis of Genotype-Phenotype Correlations: Identification of candidate genes involved in African Trypanosomiasis Fisher et al ., (2007) Nucleic Acids Research doi:10.1093/nar/ gkm623 Explicitly discusses the methods we used for the Trypanosomiasis use case Discussion of the results for Daxx and shows mutation Sharing of workflows for re-use, re-purposing

22. Recycling, Reuse, Repurposing Identified a candidate gene (Daxx) for Trypanosomiasis resistance. Manual analysis on the microarray and QTL data failed to identify this gene as a candidate. Unbiased analysis. Confirmed by the wet lab. Here’s the Science ! Here’s the e-Science ! Trypanosomiasis mouse workflow reused without change in Trichuris muris infection in mice Identified biological pathways involved in sex dependence Previous manual two year study of candidate genes had failed to do this. Workflows now being run over Colitis/ Inflammatory Bowel Disease in Mice (without change)

23. Recycling, Reuse, Repurposing http://www.myexperiment.org/ Share Search Re-use Re-purpose Execute Communicate Record

24. What next? More use cases?? Can be done, but not for my project Text Mining !!! Aid biologists in identifying novel links between pathways Link pathways to phenotype through literature

25. Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource

26. CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype DONE MANUALLY

27. It can’t be that hard, right? PubMed contains ~17,787,763 journals to date Manually searching is tedious and frustrating Can be hard finding the links Computers can help with data gathering and information extraction – that’s their job !!!

28. Text Mining A means of assisting the researcher Time Effort Narrow searches Hypothesis generation and verification Suggested links Limited corpus, but its specific NOT A REPLACEMENT FOR DOMAIN EXPERTISE

29. To Sum Up …. Need for Genotype-Phenotype correlations with respect to disease control High-throughput data can provide links between Genotype and Phenotype Highlighted issues with manually conducted in silico experiments Improved the methods of current microarray and QTL based investigations through systematic nature Increased reproducibility of our methods - workflows stored in XML based schema - explicit declaration of services, parameters, and methods of data analysis Shown workflows are capable of deriving new biologically significant results African Trypanosomiasis in the mouse Infection of mice with Trichuris muris The workflows require expansion to accommodate new analysis techniques – text mining

30. Many thanks to: including: Joanne Pennock, EPSRC, OMII, myGrid, and lots more people