SlideShare a Scribd company logo
A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations Paul Fisher Dr. Robert Stevens Prof. Andrew Brass
[object Object],Genotype DNA ACTGCACTGACTGTACGTATATCT ACTGCACTG TG TGTACGTATATCT Mutations Genes
[object Object],[object Object],Phenotype vs. Brown White and Brown
Genotype  to  Phenotype
Genotype Phenotype ? Current Methods 200 What processes to investigate?
? 200 Microarray + QTL Genes captured in microarray experiment and present in QTL ( Quantitative Trait Loci  )  region Genotype Phenotype Metabolic pathways Phenotypic response investigated using microarray in form of expressed genes or evidence provided through QTL mapping
CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype
Issues with current approaches
Huge amounts of data 200+ Genes QTL region on chromosome Microarray 1000+ Genes How do I look at ALL the genes systematically?
Hypothesis-Driven Analyses 200 QTL genes Case: African Sleeping sickness - parasitic infection - Known immune response Pick the genes involved in immunological process 40 QTL genes Pick the genes that I am most familiar with 2 QTL genes Biased view ,[object Object],[object Object],[object Object],[object Object]
Manual Methods of data analysis Navigating through hyperlinks No explicit methods Human error Tedious and repetitive
Implicit methods
Issues with current approaches ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
The Two W’s ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Taverna Workflow Workbench http://taverna.sf.net
Hypothesis ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
Replicated original chain of data analysis
Trypanosomiasis in Africa http://www.genomics.liv.ac.uk/tryps/trypsindex.html Andy Brass Steve Kemp + many Others
Preliminary Results ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Shameless Plug! ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Recycling, Reuse, Repurposing ,[object Object],[object Object],[object Object],Here’s the  Science ! Here’s the  e-Science ! ,[object Object],[object Object],[object Object],Workflows now being run over  Colitis/ Inflammatory Bowel Disease in Mice   (without change)
Recycling, Reuse, Repurposing http://www.myexperiment.org/ ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
What next? ,[object Object],[object Object],[object Object],[object Object],[object Object]
Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype DONE MANUALLY
It can’t be that hard, right? ,[object Object],[object Object],[object Object],Computers can help with data gathering and information extraction – that’s their job !!!
Text Mining ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],NOT A REPLACEMENT FOR  DOMAIN EXPERTISE
To Sum Up …. ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Many thanks to: including: Joanne Pennock, EPSRC, OMII, myGrid, and lots more people

More Related Content

What's hot

Functional annotation
Functional annotationFunctional annotation
Functional annotation
Ravi Gandham
 
Molecular basis of genetic disease
Molecular basis of genetic diseaseMolecular basis of genetic disease
Molecular basis of genetic disease
Mary Achakolong
 
Bioinformatics - Discovering the Bio Logic Of Nature
Bioinformatics - Discovering the Bio Logic Of NatureBioinformatics - Discovering the Bio Logic Of Nature
Bioinformatics - Discovering the Bio Logic Of Nature
Robert Cormia
 
Functional genomics
Functional genomicsFunctional genomics
Functional genomics
ajay301
 
Microsatellite
MicrosatelliteMicrosatellite
Microsatellite
subramaniam sethupathy
 
Metabolomics
MetabolomicsMetabolomics
Comparative genomic hybridization
Comparative genomic hybridizationComparative genomic hybridization
Comparative genomic hybridization
vlmawia
 
prediction methods for ORF
prediction methods for ORFprediction methods for ORF
prediction methods for ORF
karamveer prajapat
 
Protein-Protein Interactions (PPIs)
Protein-Protein Interactions (PPIs)Protein-Protein Interactions (PPIs)
Protein-Protein Interactions (PPIs)
Sai Ram
 
Introduction to Bioinformatics
Introduction to BioinformaticsIntroduction to Bioinformatics
Introduction to Bioinformatics
Asad Afridi
 
Genome annotation 2013
Genome annotation 2013Genome annotation 2013
Genome annotation 2013
Karan Veer Singh
 
Proteomics ppt
Proteomics pptProteomics ppt
Proteomics ppt
Shashikala Chinnaswamy
 
Protein protein interaction
Protein protein interactionProtein protein interaction
Protein protein interaction
Aashish Patel
 
Comparative genomics
Comparative genomicsComparative genomics
Comparative genomics
prateek kumar
 
Open Reading Frames
Open Reading FramesOpen Reading Frames
Open Reading FramesOsama Zahid
 
Clustal W - Multiple Sequence alignment
Clustal W - Multiple Sequence alignment   Clustal W - Multiple Sequence alignment
Clustal W - Multiple Sequence alignment
The Oxford College Engineering
 
Dna typing methods
Dna typing methodsDna typing methods
Dna typing methods
Talha Iftikhar
 
Database in bioinformatics
Database in bioinformaticsDatabase in bioinformatics
Database in bioinformatics
VinaKhan1
 

What's hot (20)

Functional annotation
Functional annotationFunctional annotation
Functional annotation
 
Molecular basis of genetic disease
Molecular basis of genetic diseaseMolecular basis of genetic disease
Molecular basis of genetic disease
 
Bioinformatics - Discovering the Bio Logic Of Nature
Bioinformatics - Discovering the Bio Logic Of NatureBioinformatics - Discovering the Bio Logic Of Nature
Bioinformatics - Discovering the Bio Logic Of Nature
 
Functional genomics
Functional genomicsFunctional genomics
Functional genomics
 
Microsatellite
MicrosatelliteMicrosatellite
Microsatellite
 
Metabolomics
MetabolomicsMetabolomics
Metabolomics
 
Comparative genomic hybridization
Comparative genomic hybridizationComparative genomic hybridization
Comparative genomic hybridization
 
prediction methods for ORF
prediction methods for ORFprediction methods for ORF
prediction methods for ORF
 
Protein-Protein Interactions (PPIs)
Protein-Protein Interactions (PPIs)Protein-Protein Interactions (PPIs)
Protein-Protein Interactions (PPIs)
 
Introduction to Bioinformatics
Introduction to BioinformaticsIntroduction to Bioinformatics
Introduction to Bioinformatics
 
Genome annotation 2013
Genome annotation 2013Genome annotation 2013
Genome annotation 2013
 
Proteomics ppt
Proteomics pptProteomics ppt
Proteomics ppt
 
genomic comparison
genomic comparison genomic comparison
genomic comparison
 
Protein protein interaction
Protein protein interactionProtein protein interaction
Protein protein interaction
 
Comparative genomics
Comparative genomicsComparative genomics
Comparative genomics
 
Open Reading Frames
Open Reading FramesOpen Reading Frames
Open Reading Frames
 
Clustal W - Multiple Sequence alignment
Clustal W - Multiple Sequence alignment   Clustal W - Multiple Sequence alignment
Clustal W - Multiple Sequence alignment
 
Epigenomics
EpigenomicsEpigenomics
Epigenomics
 
Dna typing methods
Dna typing methodsDna typing methods
Dna typing methods
 
Database in bioinformatics
Database in bioinformaticsDatabase in bioinformatics
Database in bioinformatics
 

Viewers also liked

Genotypes and phenotypes
Genotypes and phenotypesGenotypes and phenotypes
Genotypes and phenotypes
Rosio DeLeon
 
Intro to genetics ppt
Intro to genetics pptIntro to genetics ppt
Intro to genetics pptmrimbiology
 
Genotype
GenotypeGenotype
Genotype
babar ali
 
Genotype and phenotype
Genotype and phenotypeGenotype and phenotype
Genotype and phenotype
Muhammad Fahad Saleh
 
Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Human Variome Project
 
Genetic Basis of Inheritance
Genetic Basis of InheritanceGenetic Basis of Inheritance
Genetic Basis of Inheritance
KISHOR SAWAIKAR
 
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
University of Technology, Sydney
 
Jay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in TransplantationJay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in Transplantation
Vall d'Hebron Institute of Research (VHIR)
 
Phyto-oils
Phyto-oilsPhyto-oils
Phyto-oils
PPRC AYUR
 
Functions of nucleus
Functions of nucleusFunctions of nucleus
Functions of nucleus
Mohsin Shad
 
Formal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural GenomesFormal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural Genomes
madalladam
 
Inclination
InclinationInclination
Inclination
K S Ahluwalia
 
UTB - Project Perigee Presentation
UTB - Project Perigee PresentationUTB - Project Perigee Presentation
UTB - Project Perigee Presentation
tommygober
 
L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_MUBOSScz
 
Wireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commerceWireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commerce
desma abi
 
Incomplete and codominance
Incomplete and codominanceIncomplete and codominance
Incomplete and codominance
Rosio DeLeon
 
Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis
S'eclairer
 
Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)vanessawhitehawk
 

Viewers also liked (20)

Genotypes and phenotypes
Genotypes and phenotypesGenotypes and phenotypes
Genotypes and phenotypes
 
Intro to genetics ppt
Intro to genetics pptIntro to genetics ppt
Intro to genetics ppt
 
Genotype
GenotypeGenotype
Genotype
 
Genotype and phenotype
Genotype and phenotypeGenotype and phenotype
Genotype and phenotype
 
Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...
 
Genetic Basis of Inheritance
Genetic Basis of InheritanceGenetic Basis of Inheritance
Genetic Basis of Inheritance
 
11 u mutations
11 u mutations11 u mutations
11 u mutations
 
B10vrv4133
B10vrv4133B10vrv4133
B10vrv4133
 
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
 
Jay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in TransplantationJay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in Transplantation
 
Phyto-oils
Phyto-oilsPhyto-oils
Phyto-oils
 
Functions of nucleus
Functions of nucleusFunctions of nucleus
Functions of nucleus
 
Formal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural GenomesFormal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural Genomes
 
Inclination
InclinationInclination
Inclination
 
UTB - Project Perigee Presentation
UTB - Project Perigee PresentationUTB - Project Perigee Presentation
UTB - Project Perigee Presentation
 
L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_
 
Wireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commerceWireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commerce
 
Incomplete and codominance
Incomplete and codominanceIncomplete and codominance
Incomplete and codominance
 
Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis
 
Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)
 

Similar to A systematic approach to Genotype-Phenotype correlations

How to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationHow to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical information
Joaquin Dopazo
 
STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...
Lars Juhl Jensen
 
PadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptxPadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptx
DESMONDEZIEKE1
 
INBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria LópezINBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision
 
Gene hunting strategies
Gene hunting strategiesGene hunting strategies
Gene hunting strategies
Ashfaq Ahmad
 
BIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And ChallengesBIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And Challenges
Amos Watentena
 
Genome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleGenome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattle
Laurence Dawkins-Hall
 
OKC Grand Rounds 2009
OKC Grand Rounds 2009OKC Grand Rounds 2009
OKC Grand Rounds 2009Sean Davis
 
Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...
Joaquin Dopazo
 
Introducción a la bioinformatica
Introducción a la bioinformaticaIntroducción a la bioinformatica
Introducción a la bioinformaticaMartín Arrieta
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
Amna Jalil
 
bioinformatics simple
bioinformatics simple bioinformatics simple
bioinformatics simple nadeem akhter
 
Transgenic animal models & their
Transgenic animal models & theirTransgenic animal models & their
Transgenic animal models & their
kalpanatiwari17
 
From reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingFrom reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene finding
Joaquin Dopazo
 
rheumatoid arthritis
rheumatoid arthritisrheumatoid arthritis
rheumatoid arthritis
Ankit Bhardwaj
 
A New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The ClinicA New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The Clinic
Joaquin Dopazo
 
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Seattle DAML meetup
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
Aamir Wahab
 
provenance of microarray experiments
provenance of microarray experimentsprovenance of microarray experiments
provenance of microarray experimentsHelena Deus
 

Similar to A systematic approach to Genotype-Phenotype correlations (20)

How to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationHow to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical information
 
STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...
 
PadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptxPadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptx
 
INBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria LópezINBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria López
 
Gene hunting strategies
Gene hunting strategiesGene hunting strategies
Gene hunting strategies
 
BIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And ChallengesBIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And Challenges
 
Genome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleGenome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattle
 
OKC Grand Rounds 2009
OKC Grand Rounds 2009OKC Grand Rounds 2009
OKC Grand Rounds 2009
 
Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...
 
Introducción a la bioinformatica
Introducción a la bioinformaticaIntroducción a la bioinformatica
Introducción a la bioinformatica
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
bioinformatics simple
bioinformatics simple bioinformatics simple
bioinformatics simple
 
Transgenic animal models & their
Transgenic animal models & theirTransgenic animal models & their
Transgenic animal models & their
 
From reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingFrom reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene finding
 
rheumatoid arthritis
rheumatoid arthritisrheumatoid arthritis
rheumatoid arthritis
 
A New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The ClinicA New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The Clinic
 
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
 
provenance of microarray experiments
provenance of microarray experimentsprovenance of microarray experiments
provenance of microarray experiments
 
ASHG_2014_AP
ASHG_2014_APASHG_2014_AP
ASHG_2014_AP
 

Recently uploaded

How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...
Product School
 
Elizabeth Buie - Older adults: Are we really designing for our future selves?
Elizabeth Buie - Older adults: Are we really designing for our future selves?Elizabeth Buie - Older adults: Are we really designing for our future selves?
Elizabeth Buie - Older adults: Are we really designing for our future selves?
Nexer Digital
 
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
BookNet Canada
 
PCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase TeamPCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase Team
ControlCase
 
When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...
Elena Simperl
 
UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4
DianaGray10
 
Free Complete Python - A step towards Data Science
Free Complete Python - A step towards Data ScienceFree Complete Python - A step towards Data Science
Free Complete Python - A step towards Data Science
RinaMondal9
 
The Future of Platform Engineering
The Future of Platform EngineeringThe Future of Platform Engineering
The Future of Platform Engineering
Jemma Hussein Allen
 
Monitoring Java Application Security with JDK Tools and JFR Events
Monitoring Java Application Security with JDK Tools and JFR EventsMonitoring Java Application Security with JDK Tools and JFR Events
Monitoring Java Application Security with JDK Tools and JFR Events
Ana-Maria Mihalceanu
 
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Product School
 
Generative AI Deep Dive: Advancing from Proof of Concept to Production
Generative AI Deep Dive: Advancing from Proof of Concept to ProductionGenerative AI Deep Dive: Advancing from Proof of Concept to Production
Generative AI Deep Dive: Advancing from Proof of Concept to Production
Aggregage
 
UiPath Test Automation using UiPath Test Suite series, part 3
UiPath Test Automation using UiPath Test Suite series, part 3UiPath Test Automation using UiPath Test Suite series, part 3
UiPath Test Automation using UiPath Test Suite series, part 3
DianaGray10
 
PHP Frameworks: I want to break free (IPC Berlin 2024)
PHP Frameworks: I want to break free (IPC Berlin 2024)PHP Frameworks: I want to break free (IPC Berlin 2024)
PHP Frameworks: I want to break free (IPC Berlin 2024)
Ralf Eggert
 
Welocme to ViralQR, your best QR code generator.
Welocme to ViralQR, your best QR code generator.Welocme to ViralQR, your best QR code generator.
Welocme to ViralQR, your best QR code generator.
ViralQR
 
Assuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyesAssuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyes
ThousandEyes
 
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Thierry Lestable
 
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptx
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptxSecstrike : Reverse Engineering & Pwnable tools for CTF.pptx
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptx
nkrafacyberclub
 
By Design, not by Accident - Agile Venture Bolzano 2024
By Design, not by Accident - Agile Venture Bolzano 2024By Design, not by Accident - Agile Venture Bolzano 2024
By Design, not by Accident - Agile Venture Bolzano 2024
Pierluigi Pugliese
 
The Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and SalesThe Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and Sales
Laura Byrne
 
Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
Encryption in Microsoft 365 - ExpertsLive Netherlands 2024Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
Albert Hoitingh
 

Recently uploaded (20)

How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...
 
Elizabeth Buie - Older adults: Are we really designing for our future selves?
Elizabeth Buie - Older adults: Are we really designing for our future selves?Elizabeth Buie - Older adults: Are we really designing for our future selves?
Elizabeth Buie - Older adults: Are we really designing for our future selves?
 
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
 
PCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase TeamPCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase Team
 
When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...
 
UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4
 
Free Complete Python - A step towards Data Science
Free Complete Python - A step towards Data ScienceFree Complete Python - A step towards Data Science
Free Complete Python - A step towards Data Science
 
The Future of Platform Engineering
The Future of Platform EngineeringThe Future of Platform Engineering
The Future of Platform Engineering
 
Monitoring Java Application Security with JDK Tools and JFR Events
Monitoring Java Application Security with JDK Tools and JFR EventsMonitoring Java Application Security with JDK Tools and JFR Events
Monitoring Java Application Security with JDK Tools and JFR Events
 
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
 
Generative AI Deep Dive: Advancing from Proof of Concept to Production
Generative AI Deep Dive: Advancing from Proof of Concept to ProductionGenerative AI Deep Dive: Advancing from Proof of Concept to Production
Generative AI Deep Dive: Advancing from Proof of Concept to Production
 
UiPath Test Automation using UiPath Test Suite series, part 3
UiPath Test Automation using UiPath Test Suite series, part 3UiPath Test Automation using UiPath Test Suite series, part 3
UiPath Test Automation using UiPath Test Suite series, part 3
 
PHP Frameworks: I want to break free (IPC Berlin 2024)
PHP Frameworks: I want to break free (IPC Berlin 2024)PHP Frameworks: I want to break free (IPC Berlin 2024)
PHP Frameworks: I want to break free (IPC Berlin 2024)
 
Welocme to ViralQR, your best QR code generator.
Welocme to ViralQR, your best QR code generator.Welocme to ViralQR, your best QR code generator.
Welocme to ViralQR, your best QR code generator.
 
Assuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyesAssuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyes
 
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
 
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptx
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptxSecstrike : Reverse Engineering & Pwnable tools for CTF.pptx
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptx
 
By Design, not by Accident - Agile Venture Bolzano 2024
By Design, not by Accident - Agile Venture Bolzano 2024By Design, not by Accident - Agile Venture Bolzano 2024
By Design, not by Accident - Agile Venture Bolzano 2024
 
The Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and SalesThe Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and Sales
 
Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
Encryption in Microsoft 365 - ExpertsLive Netherlands 2024Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
 

A systematic approach to Genotype-Phenotype correlations

  • 1. A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations Paul Fisher Dr. Robert Stevens Prof. Andrew Brass
  • 2.
  • 3.
  • 4. Genotype to Phenotype
  • 5. Genotype Phenotype ? Current Methods 200 What processes to investigate?
  • 6. ? 200 Microarray + QTL Genes captured in microarray experiment and present in QTL ( Quantitative Trait Loci ) region Genotype Phenotype Metabolic pathways Phenotypic response investigated using microarray in form of expressed genes or evidence provided through QTL mapping
  • 7. CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype
  • 8. Issues with current approaches
  • 9. Huge amounts of data 200+ Genes QTL region on chromosome Microarray 1000+ Genes How do I look at ALL the genes systematically?
  • 10.
  • 11. Manual Methods of data analysis Navigating through hyperlinks No explicit methods Human error Tedious and repetitive
  • 13.
  • 14.
  • 15. Taverna Workflow Workbench http://taverna.sf.net
  • 16.
  • 17. Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
  • 18. Replicated original chain of data analysis
  • 19. Trypanosomiasis in Africa http://www.genomics.liv.ac.uk/tryps/trypsindex.html Andy Brass Steve Kemp + many Others
  • 20.
  • 21.
  • 22.
  • 23.
  • 24.
  • 25. Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
  • 26. CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype DONE MANUALLY
  • 27.
  • 28.
  • 29.
  • 30. Many thanks to: including: Joanne Pennock, EPSRC, OMII, myGrid, and lots more people

Editor's Notes

  1. Title slide A Systematic approach to large-scale analysis Genotype-Phenotype correlations