1. Phylogenetic trees illustrate the evolutionary relationships and degree of relatedness between organisms. They are based on Darwin's idea that all life shares a common ancestor. 2. Characteristics used to construct phylogenetic trees include morphological similarities, fossil evidence, developmental patterns, and molecular sequences. Comparisons are made to determine shared derived characteristics versus analogous structures. 3. Phylogenetic trees are constantly revised as new evidence emerges from fossils, genetics and other data. Earlier trees may look quite different than current understanding.

1. 2.3 Phylogenetic Trees –Illustrating Relatedness
Learning Outcomes:
5. Interpret a phylogenetic tree to identify the degree of relatedness.
6. Explain why the tree of life is constantly revised.1
Reminders: Next reading Quiz for Week 3 due Monday Sept 21st ( see syllabus for pages)
Complete Attitudes about Biology Survey due Monday Sept 21st
Complete Welcome Survey by Wednesday Sept 23rd
Optional Field Trips Sat Sept 19th and Sunday Sept 20th from noon-2pm 16th Ave and Sasamat
Digital Collection and Classification Due Wednesday Sept 23rd
Phylogenetic trees:
-used to describe relatedness between organisms from an evolutionary standpoint
 Darwin’s tree of life from Origin of the Species FYI: This is
the only figure in his whole book.
His idea was that all living things have diverged from a shared
common ancestor. All phylogenetic trees are based on this
idea.
Characteristics for comparison and group are chosen for their evolutionary significance.
1. Morphological similarities
-Need to be cautious of analogous structures (with similar function but from different origins) eg fins
Walleye (Sander vitreus) Killer whale (Orcinus orca) Waterboatman (Corixa punctata)
-Need to choose homologous structures (which have a common ancestral origin, but may have
different functions) eg Fig 9.12
Fossil evidence is used to fill in missing early steps in phylogenetic trees

2. Although all our previous
ancestors are not all known, a
large number of fossils have
been found which have
allowed us to create a
phylogenetic tree for humans.
Although we are part of a
large multi-branched tree,
Homo sapiens is the only
member of the tree which is
not extinct.
Note that the chimpanzee is
what is known as an
“outgroup” –a species which
is quite distantly related in
comparison to all the others.
2. Developmental similarities
In the earliest stages of
development distantly related
organisms look quite similar and as
development proceeds differences
emerge..the sooner within embryo
development which the differences
are seen, the more distantly related
the organisms.
Charles Darwin proposed that study of the early development of embryos would allow identification of
evolutionary relationships between organisms. This has proven to be true. This illustration was drawn by one
of his early supporters, the famous naturalist Ernst Haeckel (1874). A figure of real vertebrate embryos is
shown in Fig 9.111 (p234).
3. Molecular similarities

3. Our genetic material is composed of DNA (deoxyribonucleic acid). DNA is composed of four types of molecules
called nucleotides. The sequence of these nucleotides stores all the information for making an organism. The
information in one individual gene is used to make a specific protein. Proteins are composed of amino acids.
Each protein has a specific chemical function and this in term determines some characteristic of an organism.
We can compare specific nucleotide sequences of a gene or the amino acid sequences of a protein between
different organisms.
DNA RNA protein  cellular processes  specific characteristics
QUESTIONS: What if you find another
organism which had an A and T in the
first two highlighted spots but a T and G
in the latter two highlighted spots? How
would you resolve the evolutionary
relationships? This third organism has 2
ATTGCAACTGGTATCGTGGTTCGAC differences also, but now which one
would you say the “distant relative”
evolved from? What would you do to
resolve this?
Mutations (substitutions, deletions, insertions) in nucleotides can result in new forms of a characteristic. The
greater the number of changes between the sequences of two organisms the greater the time since these
organisms diverged into separate lineages. The fewer sequence differences between two organisms the more
recently these organisms diverged.
Today classifications of organisms largely depend on molecular information
Phylogenetic tree of Life
QUESTION: When you consider how vastly these organisms differ in appearance and habitat, what genes do
they all share which could be compared? What do they all have in common (hint: think at the cellular level)?

4. QUESTIONS: The phylogenetic tree of life shown on the previous page is vastly different from one drawn 50
years ago. Why? Do you expect the tree to look the same 50 years from now? Why or why not?
Characteristics of a phylogenetic tree
1. Indicates our current understanding of
the evolutionary history of species
2. The common ancestor is at the base
of the tree.
3. Branches indicate a divergence in a
characteristic.
4. The farther up the branch occurs, the
more recent the divergence.
Parsimony (Occam’s razor) the simplest
explanation is best for the available
evidence.
QUESTION: No “outgroup” is shown in the above tree. What is a possible much more distantly related
carnivore that could be used as an outgroup for comparison to all others in the tree above?
QUESTION: Which species is more closely related to the Giant panda, the polar bear or the lesser panda?
5. Although not shown in the bear tree
above, it is helpful when drawing your own
tree to indicate shared characteristics
below each branch point as in the
mammalian tree shown at right.

5. YOUR TURN: Use the cards provided to develop a phylogenetic tree of the flowering plants. To sketch out
your tree you should indicate the shared characteristics below the branch points as in the example above.
Decide on the most general characteristics first (at the lowest branchpoints).
Making a phylogenetic tree of local organisms
Without DNA sequences you must rely on morphological characteristics and assume they are homologous
(derived from a common ancestral form). Your phylogenetic tree may be incorrect from an evolutionary
standpoint, but you should strive to represent how similar and dissimilar two species are from one another. In
many ways a phylogenetic tree resembles a dichotomous key (with the first decisions at the base). Again, you
will find it helpful to indicate the shared characteristics below each branchpoint or the diverging characteristics
just after each branchpoint. This will help indicate your logic.