The document discusses various methods for studying gene expression and function, including analyzing RNA transcripts. It describes techniques like northern hybridization, DNA-mRNA hybridization, S1 nuclease mapping, primer extension, and PCR that can be used to study transcripts and locate start/stop points. The document also covers methods for studying gene regulation, such as identifying protein binding sites through gel retardation assays and footprinting, and using deletion analysis to identify control sequences.
Lectut btn-202-ppt-l20. genomic and c dna librariesRishabh Jain
Genomic and cDNA libraries are collections of clones containing DNA fragments from an organism. A genomic DNA library contains all fragments of the genomic DNA, while a cDNA library contains only coding sequences synthesized from expressed mRNA. Genomic libraries are suitable for prokaryotes due to their small genomes but eukaryotic genomes require too many clones, so cDNA libraries are preferred for eukaryotic gene cloning. cDNA libraries represent the expressed genes and contain only coding regions without introns.
Site-directed mutagenesis is a molecular biology technique used to make specific changes to DNA sequences. It involves using a primer containing the desired mutation in a PCR reaction to introduce the mutation into the gene of interest. There are different approaches for site-directed mutagenesis using PCR, including using a mutated primer in normal PCR or a primer extension method. The technique is used for applications like protein engineering to study the impact of sequence changes or insert restriction sites. However, it can be difficult to replicate the mutated DNA and screening mutations requires sequencing.
Sequence tagged sites (STSs) are short DNA sequences that can be used as genetic markers. STSs were introduced in 1989 as a way to map genes along chromosomes using PCR. They serve as landmarks on physical maps of genomes. STSs are mapped by breaking genomes into fragments, replicating the fragments in bacterial cells to create libraries, and using PCR to determine which fragments contain STSs. Different types of STS markers include microsatellites, SCARs, CAPs, and ISSRs, each of which has distinct characteristics and applications in genetic mapping, population studies, and other areas.
This document discusses nucleic acid probes and their use in hybridization experiments. It notes that probes are short sequences of nucleotides that bind to specific target sequences. The degree of homology between the probe and target determines how stable the hybridization is. Probes can range in size from 10 to over 10,000 nucleotide bases, with most common probes being 14 to 40 bases. Short probes hybridize quickly but have less specificity, while longer probes hybridize more stably. The document then describes different methods for labeling probes, including nick translation, primer extension, RNA polymerase transcription, end-labeling, and direct labeling. It also discusses factors that affect probe specificity and hybridization conditions.
S1 nuclease mapping is a laboratory technique used to locate the 5' end of an RNA transcript within a mixture by using the S1 nuclease. The S1 nuclease is an endonuclease that degrades single-stranded DNA and RNA but does not degrade double-stranded DNA or RNA-DNA hybrids. In S1 mapping, a transcript is hybridized to a DNA template and treated with S1 nuclease, which degrades any unhybridized RNA. This allows mapping the 5' end of the transcript to the DNA template. S1 nuclease mapping can determine the exact locations of start and end points of transcription and any splice points within transcripts.
Genome sequencing is the process of determining the order of nucleotide bases - A, C, G, and T - that make up an organism's DNA. Shotgun sequencing involves randomly breaking the genome into small fragments, sequencing those pieces, and reassembling the sequence by identifying overlapping regions. It was originally used by Sanger to sequence small genomes like viruses and bacteria. There are two main methods - hierarchical shotgun sequencing for larger genomes containing repeats, and whole genome shotgun sequencing for smaller genomes.
SAGE (Serial analysis of Gene Expression)talhakhat
SAGE (Serial Analysis of Gene Expression) is a technique that allows for the rapid and comprehensive analysis of gene expression patterns in a given cell population. It works by isolating mRNA, synthesizing cDNA, ligating short sequence tags to the cDNA, and then counting the number of times each tag is observed to quantify gene expression levels. The tags are concatenated and sequenced to generate vast amounts of data that must be analyzed computationally to identify which genes particular tags correspond to and to compare expression profiles between cell types. SAGE provides an overview of a cell's complete transcriptional activity and has been applied to study differences in cancer vs normal cells and to identify targets of oncogenes and tumor suppressor genes.
The document summarizes a seminar on the Ti plasmid. It discusses that the Ti plasmid is found in Agrobacterium tumefaciens and is responsible for crown gall tumor formation in plants. It describes the organization and structure of the Ti plasmid, including the T-DNA region flanked by borders that is transferred to plant cells. Two common vector systems used for plant transformation, the cointegrate vector and binary vector, are explained. The cointegrate vector involves integration of an intermediate vector with the Ti plasmid, while the binary vector separates the plasmid and virulence genes. Finally, the general process of Agrobacterium-mediated plant transformation is outlined.
Lectut btn-202-ppt-l20. genomic and c dna librariesRishabh Jain
Genomic and cDNA libraries are collections of clones containing DNA fragments from an organism. A genomic DNA library contains all fragments of the genomic DNA, while a cDNA library contains only coding sequences synthesized from expressed mRNA. Genomic libraries are suitable for prokaryotes due to their small genomes but eukaryotic genomes require too many clones, so cDNA libraries are preferred for eukaryotic gene cloning. cDNA libraries represent the expressed genes and contain only coding regions without introns.
Site-directed mutagenesis is a molecular biology technique used to make specific changes to DNA sequences. It involves using a primer containing the desired mutation in a PCR reaction to introduce the mutation into the gene of interest. There are different approaches for site-directed mutagenesis using PCR, including using a mutated primer in normal PCR or a primer extension method. The technique is used for applications like protein engineering to study the impact of sequence changes or insert restriction sites. However, it can be difficult to replicate the mutated DNA and screening mutations requires sequencing.
Sequence tagged sites (STSs) are short DNA sequences that can be used as genetic markers. STSs were introduced in 1989 as a way to map genes along chromosomes using PCR. They serve as landmarks on physical maps of genomes. STSs are mapped by breaking genomes into fragments, replicating the fragments in bacterial cells to create libraries, and using PCR to determine which fragments contain STSs. Different types of STS markers include microsatellites, SCARs, CAPs, and ISSRs, each of which has distinct characteristics and applications in genetic mapping, population studies, and other areas.
This document discusses nucleic acid probes and their use in hybridization experiments. It notes that probes are short sequences of nucleotides that bind to specific target sequences. The degree of homology between the probe and target determines how stable the hybridization is. Probes can range in size from 10 to over 10,000 nucleotide bases, with most common probes being 14 to 40 bases. Short probes hybridize quickly but have less specificity, while longer probes hybridize more stably. The document then describes different methods for labeling probes, including nick translation, primer extension, RNA polymerase transcription, end-labeling, and direct labeling. It also discusses factors that affect probe specificity and hybridization conditions.
S1 nuclease mapping is a laboratory technique used to locate the 5' end of an RNA transcript within a mixture by using the S1 nuclease. The S1 nuclease is an endonuclease that degrades single-stranded DNA and RNA but does not degrade double-stranded DNA or RNA-DNA hybrids. In S1 mapping, a transcript is hybridized to a DNA template and treated with S1 nuclease, which degrades any unhybridized RNA. This allows mapping the 5' end of the transcript to the DNA template. S1 nuclease mapping can determine the exact locations of start and end points of transcription and any splice points within transcripts.
Genome sequencing is the process of determining the order of nucleotide bases - A, C, G, and T - that make up an organism's DNA. Shotgun sequencing involves randomly breaking the genome into small fragments, sequencing those pieces, and reassembling the sequence by identifying overlapping regions. It was originally used by Sanger to sequence small genomes like viruses and bacteria. There are two main methods - hierarchical shotgun sequencing for larger genomes containing repeats, and whole genome shotgun sequencing for smaller genomes.
SAGE (Serial analysis of Gene Expression)talhakhat
SAGE (Serial Analysis of Gene Expression) is a technique that allows for the rapid and comprehensive analysis of gene expression patterns in a given cell population. It works by isolating mRNA, synthesizing cDNA, ligating short sequence tags to the cDNA, and then counting the number of times each tag is observed to quantify gene expression levels. The tags are concatenated and sequenced to generate vast amounts of data that must be analyzed computationally to identify which genes particular tags correspond to and to compare expression profiles between cell types. SAGE provides an overview of a cell's complete transcriptional activity and has been applied to study differences in cancer vs normal cells and to identify targets of oncogenes and tumor suppressor genes.
The document summarizes a seminar on the Ti plasmid. It discusses that the Ti plasmid is found in Agrobacterium tumefaciens and is responsible for crown gall tumor formation in plants. It describes the organization and structure of the Ti plasmid, including the T-DNA region flanked by borders that is transferred to plant cells. Two common vector systems used for plant transformation, the cointegrate vector and binary vector, are explained. The cointegrate vector involves integration of an intermediate vector with the Ti plasmid, while the binary vector separates the plasmid and virulence genes. Finally, the general process of Agrobacterium-mediated plant transformation is outlined.
This is technique used widely for protein separation from a mixture and is very easy and less costly method. Slides cover all essential points about EMSA and it is quite interesting to know that how it detect and separate different proteins and their mobility shift assay.
Site-directed mutagenesis is a technique used to introduce specific changes to the DNA sequence of a gene by altering the nucleotide sequence. It allows researchers to study the impact of mutations by changing individual bases, deleting bases, or inserting new bases. There are different methods of site-directed mutagenesis including oligonucleotide-based methods and PCR-based methods. Site-directed mutagenesis has applications in research, production of desired proteins, and development of engineered proteins for commercial uses like detergents.
The document summarizes the ara operon, which regulates genes involved in the metabolism of arabinose sugar. It consists of 3 key components: structural genes that encode enzymes for arabinose catabolism, an operator site that binds a repressor protein, and a promoter that enables transcription. Specifically, the ara operon contains 3 structural genes - araB, araA, araD - that code for enzymes converting arabinose into an intermediate. It is regulated by the araC gene product, which can act as both a repressor and activator depending on arabinose and glucose levels. When arabinose is low and glucose high, the araC repressor binds the operator sites, forming a DNA loop that
RNA editing is a post-transcriptional process that makes discrete changes to RNA sequences. There are three main types of RNA editing: cytosine to uracil deamination, adenine to inosine deamination, and guide RNA-mediated insertion/deletion of uridine bases. Cytidine deamination is site-specific and involves enzymes like cytidine deaminase. Adenine deamination occurs in RNA secondary structures and involves enzymes like ADAR. Guide RNA editing involves hybridization of RNA to guide RNA, cleavage by an endonuclease, addition of uridine by TuTase, and ligation. RNA editing increases protein diversity and is essential for organelle development in eukaryotes.
Creation of a cDNA library starts with mRNA instead of DNA. Messenger RNA carries encoded information from DNA to ribosomes for translation into protein. To create a cDNA library, these mRNA molecules are treated with the enzyme reverse transcriptase, which is used to make a DNA copy of an mRNA (i.e., cDNA). A cDNA library represents a sampling of the transcribed genes, but a genomic library includes untranscribed regions.
This document discusses yeast artificial chromosomes (YACs) and bacterial artificial chromosomes (BACs). YACs are engineered chromosomes derived from yeast DNA that can clone very large DNA sequences in yeast cells of up to 1 megabase. BACs are cloning vectors derived from bacterial DNA that can clone DNA fragments of up to 300 kilobases in E. coli. Both systems allow cloning and propagation of large DNA fragments, but YACs can hold more DNA while BACs are more stable and better for functional analysis in mammalian cells.
Comparative genomics involves comparing genomes to discover similarities and differences. It can provide insights into evolutionary relationships, help predict gene function, and aid in drug discovery. The first step is often aligning genome sequences using tools like BLAST or MUMmer. Genomes can then be compared at various levels, such as overall nucleotide statistics, genome structure, and coding/non-coding regions. Comparing gene and protein content across genomes helps predict functions. Conserved genomic features across species also aid prediction. Insights into genome evolution come from studying molecular events like inversions and duplications. Comparative genomics has impacted phylogenetics and drug target identification.
BAC & YAC are artificially prepared chromosomes to clone DNA sequences.yeast artificial chromosome is capable of carrying upto 1000 kbp of inserted DNA sequence
A DNA library is a collection of DNA fragments that have been cloned into vectors. DNA libraries allow researchers to isolate and study specific DNA fragments of interest. To create a genomic library, DNA is extracted from an organism, cut into fragments, inserted into vectors, and introduced into host bacteria to generate clones containing all the organism's DNA sequences. This library can then be screened to identify and study particular genes. DNA libraries provide an efficient way to store, isolate, and analyze DNA sequences.
What is Genome,Genome mapping,types of Genome mapping,linkage or genetic mapping,Physical mapping,Somatic cell hybridization
Radiation hybridization ,Fish( =fluorescence in - situ hybridization),Types of probes for FISH,applications,Molecular markers,Rflp(= Restriction fragment length polymorphism),RFLPs may have the following Applications;Advantages of rflp,disAdvantages of rflp, Rapd(=Random amplification of polymorphic DNA),Process of rapd, Difference between rflp &rapd
The document discusses different expression vectors and systems used for recombinant protein expression. It describes key elements required for an expression vector including an origin of replication, selective marker, promoter, multiple cloning site, and terminator. It provides details on commonly used expression systems in E. coli such as the lac, tac, lambda PL, and T7 promoters. It also summarizes protein expression in yeast using the galactose-inducible GAL promoter system.
This document discusses various enzymes used for genetic engineering and DNA manipulation. It describes restriction endonucleases and DNA ligase which cut and join DNA fragments. It also discusses other DNA modifying enzymes like nucleases which degrade DNA, and polymerases which synthesize DNA copies. Specific enzymes covered in detail include DNA polymerase I, T4 DNA polymerase, T7 DNA polymerase, terminal transferase, T4 DNA ligase, and T4 RNA ligase.
This document discusses different types of reporter genes that are used in plant functional genomics studies. It describes scorable reporter genes like green fluorescent protein (GFP), yellow fluorescent protein (YFP), and β-glucuronidase (GUS) which produce quantifiable phenotypes through enzyme assays. It also describes selectable reporter genes like antibiotic and herbicide resistance genes which allow for selection of transformed cells. Reporter genes are useful for identifying gene expression patterns, performing gene expression assays by fusing the reporter to a gene of interest, and assessing transformation/transfection efficiency. The document provides examples of using GFP fused to the XPR1 gene to study its subcellular localization in tobacco cells.
This document discusses enzymes used in genetic engineering, specifically focusing on restriction enzymes and DNA modifying enzymes. It provides details on various types of modifying enzymes including nucleases, polymerases, phosphatases, kinases, ligases and others. Restriction enzymes are described as molecular scissors that cut DNA at specific recognition sequences. DNA ligase is presented as the molecular glue that joins cut DNA fragments. The document outlines the classification, nomenclature, mechanisms and applications of various restriction enzymes and modifying enzymes used in genetic engineering techniques.
1. mRNA isolation is the process of extracting messenger RNA from biological samples. It is important for research and industry applications as mRNA provides insight into which genes are being expressed and translated into proteins.
2. Total RNA is first extracted using Trizol, which separates RNA, DNA and proteins. mRNA is then isolated from total RNA using biotin-labeled oligo dT probes that selectively bind to the poly-A tail of mRNA molecules.
3. The mRNA-probe complexes are immobilized on magnetic beads coated with streptavidin. This allows the mRNA to be separated and purified from other RNAs through magnetic separation washes. The purified mRNA can then be used in applications like RT-PCR and protein
This document discusses different strategies for cloning DNA fragments from complex sources like genomic DNA or cDNA. There are two major approaches - cell-based cloning, which divides the DNA into fragments that are cloned to create a library, and directly amplifying target sequences using PCR. The document focuses on cDNA library construction, explaining that cDNA libraries reveal gene expression profiles. It describes early cDNA cloning methods and their limitations, as well as improved directional and non-directional cloning techniques. Finally, it discusses various screening methods for identifying clones of interest from cDNA libraries, including colony hybridization, plaque lifts and immunological screening.
This document discusses DNA sequencing methods. It describes the Maxam-Gilbert sequencing method developed in 1976-1977 which uses chemical modification and cleavage of DNA at specific bases, followed by electrophoresis to separate fragments by size. It also mentions the popular Sanger sequencing method. The procedure for Maxam-Gilbert sequencing involves labeling DNA, cleaving it with chemicals, running the fragments on a gel, and analyzing the results to deduce the DNA sequence. Advantages include no premature termination and ability to sequence stretches not possible with enzymatic methods, while disadvantages include use of radioactivity and toxic chemicals.
Short cut rules for filling gaps with right forms of verbM A Kabir
Important Rules For Filling Gaps With Right Forms Of Verb (এখানে ১২ টি ক্যাটগরিতে মোট ৬০ টি রুল বা নিয়ম আছে প্রত্যেকটি নিয়মের সাথে ১৫ টি করে উদাহরন ও ১৫ টি “Exercise” এবং কাছাকাছি নিয়মের প্রতি ৫ টি Rule এর আলোকে ৫টি করে Passage Exercise দেওয়া আছে)
গ্রামার ব্যখ্যা সহ ৫০ টি Right Form of Verb রিলেটেড় এমসিকিউ
Complete the passage with suitable verbs from the list (প্রত্যেক টেস্টের বাংলা অনুবাদ সহ দেওয়া আছে )
33 Model Test of Right Forms Of Verb (টেস্টের প্রত্যেক উত্তরের গ্রামাটিক্যাল ব্যাখ্যা ও গঠন সহ দেওয়া আছে )
50 Magic Rules of Subject- Verb Agreement (ইংরেজি বাক্যের যে সকল clue দেখে শূন্যস্থানে Verb সঠিক যে গ্রামার ফরম্যাট হবে তার শর্টকাট টেকনিক ও জাদুকরি নিয়ম )
ব্যখ্যা সহ ৫০ টি Subject- Verb Agreement রিলেটেড় এমসিকিউ
This document provides words with their synonyms and antonyms. It lists words alphabetically and for each word provides synonyms under "-SYN-" and antonyms under "-ANT-". There are no definitions provided for the words, just lists of related terms. The document contains over 100 entries in this format.
This is technique used widely for protein separation from a mixture and is very easy and less costly method. Slides cover all essential points about EMSA and it is quite interesting to know that how it detect and separate different proteins and their mobility shift assay.
Site-directed mutagenesis is a technique used to introduce specific changes to the DNA sequence of a gene by altering the nucleotide sequence. It allows researchers to study the impact of mutations by changing individual bases, deleting bases, or inserting new bases. There are different methods of site-directed mutagenesis including oligonucleotide-based methods and PCR-based methods. Site-directed mutagenesis has applications in research, production of desired proteins, and development of engineered proteins for commercial uses like detergents.
The document summarizes the ara operon, which regulates genes involved in the metabolism of arabinose sugar. It consists of 3 key components: structural genes that encode enzymes for arabinose catabolism, an operator site that binds a repressor protein, and a promoter that enables transcription. Specifically, the ara operon contains 3 structural genes - araB, araA, araD - that code for enzymes converting arabinose into an intermediate. It is regulated by the araC gene product, which can act as both a repressor and activator depending on arabinose and glucose levels. When arabinose is low and glucose high, the araC repressor binds the operator sites, forming a DNA loop that
RNA editing is a post-transcriptional process that makes discrete changes to RNA sequences. There are three main types of RNA editing: cytosine to uracil deamination, adenine to inosine deamination, and guide RNA-mediated insertion/deletion of uridine bases. Cytidine deamination is site-specific and involves enzymes like cytidine deaminase. Adenine deamination occurs in RNA secondary structures and involves enzymes like ADAR. Guide RNA editing involves hybridization of RNA to guide RNA, cleavage by an endonuclease, addition of uridine by TuTase, and ligation. RNA editing increases protein diversity and is essential for organelle development in eukaryotes.
Creation of a cDNA library starts with mRNA instead of DNA. Messenger RNA carries encoded information from DNA to ribosomes for translation into protein. To create a cDNA library, these mRNA molecules are treated with the enzyme reverse transcriptase, which is used to make a DNA copy of an mRNA (i.e., cDNA). A cDNA library represents a sampling of the transcribed genes, but a genomic library includes untranscribed regions.
This document discusses yeast artificial chromosomes (YACs) and bacterial artificial chromosomes (BACs). YACs are engineered chromosomes derived from yeast DNA that can clone very large DNA sequences in yeast cells of up to 1 megabase. BACs are cloning vectors derived from bacterial DNA that can clone DNA fragments of up to 300 kilobases in E. coli. Both systems allow cloning and propagation of large DNA fragments, but YACs can hold more DNA while BACs are more stable and better for functional analysis in mammalian cells.
Comparative genomics involves comparing genomes to discover similarities and differences. It can provide insights into evolutionary relationships, help predict gene function, and aid in drug discovery. The first step is often aligning genome sequences using tools like BLAST or MUMmer. Genomes can then be compared at various levels, such as overall nucleotide statistics, genome structure, and coding/non-coding regions. Comparing gene and protein content across genomes helps predict functions. Conserved genomic features across species also aid prediction. Insights into genome evolution come from studying molecular events like inversions and duplications. Comparative genomics has impacted phylogenetics and drug target identification.
BAC & YAC are artificially prepared chromosomes to clone DNA sequences.yeast artificial chromosome is capable of carrying upto 1000 kbp of inserted DNA sequence
A DNA library is a collection of DNA fragments that have been cloned into vectors. DNA libraries allow researchers to isolate and study specific DNA fragments of interest. To create a genomic library, DNA is extracted from an organism, cut into fragments, inserted into vectors, and introduced into host bacteria to generate clones containing all the organism's DNA sequences. This library can then be screened to identify and study particular genes. DNA libraries provide an efficient way to store, isolate, and analyze DNA sequences.
What is Genome,Genome mapping,types of Genome mapping,linkage or genetic mapping,Physical mapping,Somatic cell hybridization
Radiation hybridization ,Fish( =fluorescence in - situ hybridization),Types of probes for FISH,applications,Molecular markers,Rflp(= Restriction fragment length polymorphism),RFLPs may have the following Applications;Advantages of rflp,disAdvantages of rflp, Rapd(=Random amplification of polymorphic DNA),Process of rapd, Difference between rflp &rapd
The document discusses different expression vectors and systems used for recombinant protein expression. It describes key elements required for an expression vector including an origin of replication, selective marker, promoter, multiple cloning site, and terminator. It provides details on commonly used expression systems in E. coli such as the lac, tac, lambda PL, and T7 promoters. It also summarizes protein expression in yeast using the galactose-inducible GAL promoter system.
This document discusses various enzymes used for genetic engineering and DNA manipulation. It describes restriction endonucleases and DNA ligase which cut and join DNA fragments. It also discusses other DNA modifying enzymes like nucleases which degrade DNA, and polymerases which synthesize DNA copies. Specific enzymes covered in detail include DNA polymerase I, T4 DNA polymerase, T7 DNA polymerase, terminal transferase, T4 DNA ligase, and T4 RNA ligase.
This document discusses different types of reporter genes that are used in plant functional genomics studies. It describes scorable reporter genes like green fluorescent protein (GFP), yellow fluorescent protein (YFP), and β-glucuronidase (GUS) which produce quantifiable phenotypes through enzyme assays. It also describes selectable reporter genes like antibiotic and herbicide resistance genes which allow for selection of transformed cells. Reporter genes are useful for identifying gene expression patterns, performing gene expression assays by fusing the reporter to a gene of interest, and assessing transformation/transfection efficiency. The document provides examples of using GFP fused to the XPR1 gene to study its subcellular localization in tobacco cells.
This document discusses enzymes used in genetic engineering, specifically focusing on restriction enzymes and DNA modifying enzymes. It provides details on various types of modifying enzymes including nucleases, polymerases, phosphatases, kinases, ligases and others. Restriction enzymes are described as molecular scissors that cut DNA at specific recognition sequences. DNA ligase is presented as the molecular glue that joins cut DNA fragments. The document outlines the classification, nomenclature, mechanisms and applications of various restriction enzymes and modifying enzymes used in genetic engineering techniques.
1. mRNA isolation is the process of extracting messenger RNA from biological samples. It is important for research and industry applications as mRNA provides insight into which genes are being expressed and translated into proteins.
2. Total RNA is first extracted using Trizol, which separates RNA, DNA and proteins. mRNA is then isolated from total RNA using biotin-labeled oligo dT probes that selectively bind to the poly-A tail of mRNA molecules.
3. The mRNA-probe complexes are immobilized on magnetic beads coated with streptavidin. This allows the mRNA to be separated and purified from other RNAs through magnetic separation washes. The purified mRNA can then be used in applications like RT-PCR and protein
This document discusses different strategies for cloning DNA fragments from complex sources like genomic DNA or cDNA. There are two major approaches - cell-based cloning, which divides the DNA into fragments that are cloned to create a library, and directly amplifying target sequences using PCR. The document focuses on cDNA library construction, explaining that cDNA libraries reveal gene expression profiles. It describes early cDNA cloning methods and their limitations, as well as improved directional and non-directional cloning techniques. Finally, it discusses various screening methods for identifying clones of interest from cDNA libraries, including colony hybridization, plaque lifts and immunological screening.
This document discusses DNA sequencing methods. It describes the Maxam-Gilbert sequencing method developed in 1976-1977 which uses chemical modification and cleavage of DNA at specific bases, followed by electrophoresis to separate fragments by size. It also mentions the popular Sanger sequencing method. The procedure for Maxam-Gilbert sequencing involves labeling DNA, cleaving it with chemicals, running the fragments on a gel, and analyzing the results to deduce the DNA sequence. Advantages include no premature termination and ability to sequence stretches not possible with enzymatic methods, while disadvantages include use of radioactivity and toxic chemicals.
Short cut rules for filling gaps with right forms of verbM A Kabir
Important Rules For Filling Gaps With Right Forms Of Verb (এখানে ১২ টি ক্যাটগরিতে মোট ৬০ টি রুল বা নিয়ম আছে প্রত্যেকটি নিয়মের সাথে ১৫ টি করে উদাহরন ও ১৫ টি “Exercise” এবং কাছাকাছি নিয়মের প্রতি ৫ টি Rule এর আলোকে ৫টি করে Passage Exercise দেওয়া আছে)
গ্রামার ব্যখ্যা সহ ৫০ টি Right Form of Verb রিলেটেড় এমসিকিউ
Complete the passage with suitable verbs from the list (প্রত্যেক টেস্টের বাংলা অনুবাদ সহ দেওয়া আছে )
33 Model Test of Right Forms Of Verb (টেস্টের প্রত্যেক উত্তরের গ্রামাটিক্যাল ব্যাখ্যা ও গঠন সহ দেওয়া আছে )
50 Magic Rules of Subject- Verb Agreement (ইংরেজি বাক্যের যে সকল clue দেখে শূন্যস্থানে Verb সঠিক যে গ্রামার ফরম্যাট হবে তার শর্টকাট টেকনিক ও জাদুকরি নিয়ম )
ব্যখ্যা সহ ৫০ টি Subject- Verb Agreement রিলেটেড় এমসিকিউ
This document provides words with their synonyms and antonyms. It lists words alphabetically and for each word provides synonyms under "-SYN-" and antonyms under "-ANT-". There are no definitions provided for the words, just lists of related terms. The document contains over 100 entries in this format.
Essay & composition writing technique by tanbircoxNuruzzaman Nobin
1) The essay discusses a serious problem called [Name]. It has become a major concern in [location] and is growing more acute over time.
2) Several causes of the problem are mentioned, including [Cause 1], [Cause 2], and [Cause 3], which collectively contribute to the issue.
3) The effects of the problem are difficult to endure and have resulted in hardship, loss of sleep, and anxiety as people strive to find a solution.
Magic Rules of Tense (বাংলা ও ইংলিশ শব্দ ও বাক্য দেখে চেনার উপায়, বিশেষ নিয়ম ও তার ব্যবহার)
The Magic Formula of Sentence Structure(একটি সূত্র বা ফর্মুলা দিয়ে যে কোন ইংলিশ বাক্য তৈরি, উদাহরন সহকারে বিবরণ )
Parts Of Speech চেনার (Identification) সহজ উপায় ও অবস্থান (Position) [Suffix (প্রত্যয়) দেখে চিনার উপায় বাংলা অর্থ সহ অসংখ্য উদাহরন , Function or Placement (বাক্যে তার অবস্থানের নিয়ম) , Some critical use of Parts Of Speech ]
100 Magic Rules of Cloze Test With & Without Clues (ইংরেজি বাক্যের যে সকল clue দেখে শূন্যস্থানে সঠিক ওয়ার্ড ও তার যে গ্রামার ফরম্যাট হবে তার শর্টকাট টেকনিক ও জাদুকরি নিয়ম )
75 Cloze Test With Clues (প্রত্যেক টেস্টের গুরুত্বপূর্ণ সব শব্দের বাংলা অর্থ ও প্রত্যেক উত্তরের গ্রামাটিক্যাল ব্যাখ্যা ও গঠন সহ দেওয়া আছে অর্থাৎ কেন হয়েছে তার ব্যাখ্যা )
65 Probable Cloze Test with clues for JSC/SSC/H.S.C Examination. (প্রত্যেক টেস্টের বাংলা অনুবাদ সহ দেওয়া আছে )
50 Cloze Test Without Clues (প্রত্যেক টেস্টের গুরুত্বপূর্ণ সব শব্দের বাংলা অর্থ ও প্রত্যেক উত্তরের গ্রামাটিক্যাল ব্যাখ্যা ও গঠন সহ দেওয়া আছে অর্থাৎ কেন হয়েছে তার ব্যাখ্যা )
বিসিএস , ব্যাংক জব ও যে কোন সরকারি চাকরির এমসিকিউ ম্যাথ অংশের পরীক্ষার জন্য খুভ গুরুত্বপূর্ণ একটা বই ...
এখানে প্রায় ১৫০০+ এমসিকিউ প্রশ্ন দেওয়া আছে ...
এবং গনিতে প্রয়োজনীয় ব্যসিক ও শর্টকাট সূত্র দেওয়া আছে ...
“ মাধ্যমিক বাংলা ভাষার ব্যাকরণ” বই ক্লাস ৯-১০ থেকে শুরু করে বিভিন্ন প্রতিযোগিতা-মূলক পরীক্ষা (যেমনঃ- বিসিএস প্রিলিমিনারির, ব্যাংক নিয়োগ পরীক্ষাসহ,বিভিন্ন সরকারি ও বেসরকারি চাকরির নিয়োগ ও মেডিকেল, বিশ্ববিদ্যালয় ভর্তি ) পরীক্ষার বাংলা অংশের পূর্ণাঙ্গ প্রস্তুতির জন্য খুবই গুরুত্বপূর্ণ।
The 500 Most Commonly Used Words in the English LanguageAntonio Minharro
Based on the combined results of British English, American English and Australian English surveys of contemporary sources in English: newspapers, magazines, books, TV, radio and real life conversations - the language as it is written and spoken today.
The document discusses various topics related to English grammar and language, including:
- The basic units of language such as letters, alphabets, vowels, consonants, words, and sentences.
- Parts of speech such as nouns, pronouns, verbs, adjectives, adverbs, prepositions, conjunctions, and interjections.
- Types of verbs such as transitive, intransitive, strong, weak, principal, and auxiliary verbs.
- Tenses including present, past, and future tenses, as well as continuous, perfect, and perfect continuous tenses.
- Types of sentences including assertive, interrogative, exclamatory, imperative, and optative
This document discusses how to learn spoken English in half the time. It explains that human speech is a closed-loop system involving the mind, mouth, and hearing providing feedback and control. To learn a new language like English, all of these components must be retrained simultaneously through exercises that involve both memory and physical practice of sounds. Traditional classroom methods focus only on memory, but to learn pronunciation and speaking skills, the tongue and hearing must be retrained at the same time through repetitive exercises.
English grammar (bcs,job,university exam)Him Chori
This document contains a collection of English idioms and phrases with their Bangla meanings and example sentences. It includes idioms from A-Z, covering topics such as idioms related to above/below, agreement/disagreement, animals, body, failure, feelings, money and more. The document aims to help learners improve their vocabulary, translation and grammar skills.
The document provides guidance on conducting a literature review. It discusses that a literature review aims to convey previous knowledge and facts established on a topic by summarizing, evaluating, and integrating primary sources. The literature review is conducted in 5 stages - annotating relevant sources, organizing sources thematically, additional reading, writing individual sections, and integrating all sections. When writing the literature review, an introduction defining the topic, a body summarizing and grouping sources thematically, and a conclusion evaluating the current state of research and identifying gaps are essential elements to include.
S1 Mapping is a laboratory method used for locating the start and end points of
transcripts and for mapping introns.
This technique is used for quantifying the amount of mRNA transcripts, it can therefore identify the level of transcription of the gene in the cell at a given time.
The document summarizes transcription in prokaryotes. It discusses that transcription is carried out by RNA polymerase, which copies DNA into RNA. In prokaryotes, a single RNA polymerase enzyme governs transcription. It consists of core subunits and a sigma factor that helps recognize promoter regions on DNA. Transcription occurs in three steps - initiation, elongation, and termination. Initiation involves the RNA polymerase binding to promoter sites on DNA. Elongation extends the RNA chain. Termination ends transcription as the RNA and polymerase dissociate via either rho-dependent or rho-independent mechanisms.
A hyperlinked and animated PowerPoint presentation on DNA transcription, its stages, units, etc.
Hope you will like it.
Please do share with your friends
GENE EXPRESSION AND IT’S REGULATION.pptxyogesh532361
Gene expression is the process by which information from a gene is used to direct protein synthesis. It involves replication, transcription, and translation. Regulation of gene expression controls the amount and timing of gene products. Regulation occurs through transcription factors binding to regulatory elements near gene promoters to turn genes on and off. This precise control of gene expression is vital for cellular differentiation and adaptation.
TYPES OF MOLECULAR MARKERS,ITS ADVANTAGES AND DISADVANTAGESANFAS KT
Types of molecular markers (genetics)
ITS ADVANTAGES AND DISADVANTAGES
What is a genetic marker?
RFLP: Restriction fragment length polymorphism
AFLP: Amplified fragment length polymorphism
RAPD: Random amplification of polymorphic DNA
ISSR: Inter simple sequence repeat
STR: Short tandem repeats
SCAR: Sequence characterized amplified region
SNP: Single nucleotide polymorphism
SSR: Simple sequence repeat
The document discusses several key aspects of gene prediction including:
1. Gene prediction algorithms use signals like start/stop codons, splice sites, and open reading frames to identify genes computationally with near 100% accuracy.
2. There are ab initio, homology-based, and probabilistic models like Hidden Markov Models that can predict prokaryotic and eukaryotic genes.
3. Eukaryotic gene prediction is more challenging due to larger genomes, fewer genes, and intron-exon structures. Programs must consider splicing, polyadenylation, and other post-transcriptional modifications.
Lectut btn-202-ppt-l30. applications of pcr-iiRishabh Jain
The document discusses various applications of polymerase chain reaction (PCR) including cDNA synthesis and rapid amplification of cDNA ends (RACE) to sequence mRNA ends, error-prone PCR for random mutagenesis, PCR-based molecular markers for genome mapping and analyzing genetic variation, analysis of fossil DNA and environments using PCR, medical diagnosis using PCR, and applications in forensic science.
The coding region of a BACTERIAL gene has the following sequence A.pdfmckenziecast21211
The coding region of a BACTERIAL gene has the following sequence:
\"AGAGCCAACATGTCGAGCATATGCTGATATACG\' Draw and label the DNA (including
ALLEABIS of the gene, sequence information) The info you need is in the sides. Label the
template/coding strands Label 5\' and 3\' ends of each DNA strand Label where RNA
polymerase binds \"Transcribe\" this gene into mRNA, as shown in Bb video. Write the mRNA
nucleotide sequence, starting at the correct nucleotide, starting at the correct nucleotide Show
the 5\' and 3\' ends of the RNA. Use the codon chart to \"translate\" the mRNA into a protein,
and write the correct amino acid sequence of the protein. Only translate the part of the gene that
a cell would translate. Label the N-terminus and C-terminus of the protein. If the sequence of
the gene were changed to: AGACCCAACATGTCGGACATATGCTGATATACG what would
happen to the properties of the protein? Explain why write out the entire process of bacterial
transcription step by step in the correct order, in detail.
Solution
4. Process of Bacterial Transcription:
Bacterial transcription is the process in which mRNA transcripts of genetic material in bacteria
are produced; it is further translated to produce proteins. Unlike in eukaryotes, bacterial
transcription and translation can occur simultaneously in the cytoplasm.
RNA polymerases are enzymes that transcribe DNA into RNA. Using a DNA template, RNA
polymerase builds a new RNA molecule through base pairing. For instance, if there is a G in the
DNA template, RNA polymerase will add a C to the new, growing RNA strand.
Three steps are involved in bacterial transcription:
Initiation: To begin transcribing a gene, RNA polymerase binds to the DNA of the gene at a
region called the promoter. Basically, the promoter tells the polymerase where to locate on the
DNA and begin transcribing.
Elongation:
Once RNA polymerase is in position at the promoter, the next step of
transcription—elongation—can begin. Basically, elongation is the stage when the RNA strand
gets longer, thanks to the addition of new nucleotides.
During elongation, RNA polymerase \"walks\" along one strand of DNA, known as the template
strand, in the 3\' to 5\' direction. For each nucleotide in the template, RNA polymerase adds a
matching (complementary) RNA nucleotide to the 3\' end of the RNA strand.
Termination:
RNA polymerase will keep transcribing until it gets signals to stop. The process of ending
transcription is called termination, and it happens once the polymerase transcribes a sequence of
DNA known as a terminator.
There are two major termination strategies found in bacteria: Rho-dependent and Rho-
independent.
In Rho-dependent termination, the RNA contains a binding site for a protein called Rho factor.
Rho factor binds to this sequence and starts \"climbing\" up the transcript towards RNA
polymerase.
When it catches up with the polymerase at the transcription bubble, Rho pulls the RNA transcript
and the template DNA strand apart, releasing .
Replication, transcription, translation and its regulationAbhinava J V
This document summarizes key processes in DNA replication, transcription, translation, and their regulation in prokaryotes and eukaryotes. It describes how DNA makes copies of itself semiconservatively. Transcription involves RNA polymerase making an RNA copy of a DNA template. Translation uses ribosomes to convert the RNA into a polypeptide chain. Each process has initiation, elongation, and termination steps. Regulation ensures processes only occur at the right times and locations in the cell.
The document discusses nucleic acids and their components. Specifically:
- Nucleic acids are essential biomolecules composed of nucleotides, which contain a nitrogenous base, pentose sugar, and phosphate group.
- DNA and RNA are the two main types of nucleic acids. They are made up of nucleotides and have characteristic bases and pentoses.
- RNA has several types including mRNA, rRNA, and tRNA that play important roles in protein synthesis and ribosome structure.
1. RNA plays many roles in cells including functioning as biological catalysts and carrying genetic information.
2. RNA is synthesized using DNA as a template through the process of transcription. In transcription, RNA polymerase binds to DNA and synthesizes RNA in a 5' to 3' direction complementary to the DNA template.
3. Transcription is regulated through the use of promoters, which are DNA sequences that signal the start of transcription, as well as other transcriptional control elements.
Mapping and quantifying transcripts:
Northern blots
S1 mapping of 5’ and 3’ end transcripts
Primer extension
Runoff transcription and G –less cassette transcription
Nuclear Runon transcription
RNA polymerase carries out transcription by linking ribonucleotides to form RNA molecules using DNA as a template. Transcription initiates in both prokaryotic and eukaryotic cells and proceeds more slowly than DNA replication. In bacteria, transcription involves three main steps - initiation at promoter sequences, elongation as RNA polymerase moves along DNA, and termination. RNA polymerase requires sigma factors to bind promoters and initiate transcription accurately.
Transcription is the process by which RNA polymerase converts DNA into RNA. It involves 3 stages: initiation, elongation, and termination. Initiation begins at promoter sequences on DNA and requires a sigma factor. During elongation, RNA polymerase proofreads as it synthesizes RNA to ensure accuracy. Termination occurs when the polymerase reaches termination sequences and releases the RNA transcript.
Photosystem II captures and transfers energy.
– chlorophyll absorbs
energy from sunlight
– energized electrons
enter electron
transport chain
– water molecules are
split
– oxygen is released as
waste
– hydrogen ions are
transported across
thylakoid membrane
4.1 Chemical Energy and ATP
• Photosystem I captures energy and produces energycarrying molecules.
– chlorophyll absorbs
energy from sunlight
– energized electrons
are used to make
NADPH
– NADPH is transferred
to light-independent
reactions
4.1 Chemical Energy and ATP
• The light-dependent reactions produce ATP.
– hydrogen ions flow through a channel in the thylakoid
membrane
– ATP synthase attached to the channel makes ATP
4.1 Chemical Energy and ATP
• Light-independent
reactions occur in the
stroma and use CO2
molecules.
The second stage of photosynthesis uses energy from
the first stage to make sugars.
4.1 Chemical Energy and ATP
• A molecule of glucose is formed as it stores some of the
energy captured from sunlight.
– carbon dioxide molecules enter the Calvin Photosystem II captures and transfers energy.
– chlorophyll absorbs
energy from sunlight
– energized electrons
enter electron
transport chain
– water molecules are
split
– oxygen is released as
waste
– hydrogen ions are
transported across
thylakoid membrane
4.1 Chemical Energy and ATP
• Photosystem I captures energy and produces energycarrying molecules.
– chlorophyll absorbs
energy from sunlight
– energized electrons
are used to make
NADPH
– NADPH is transferred
to light-independent
reactions
4.1 Chemical Energy and ATP
• The light-dependent reactions produce ATP.
– hydrogen ions flow through a channel in the thylakoid
membrane
– ATP synthase attached to the channel makes ATP
4.1 Chemical Energy and ATP
• Light-independent
reactions occur in the
stroma and use CO2
molecules.
The second stage of photosynthesis uses energy from
the first stage to make sugars.
4.1 Chemical Energy and ATP
• A molecule of glucose is formed as it stores some of the
energy captured from sunlight.
– carbon dioxide molecules enter the Calvin Photosystem II captures and transfers energy.
– chlorophyll absorbs
energy from sunlight
– energized electrons
enter electron
transport chain
– water molecules are
split
– oxygen is released as
waste
– hydrogen ions are
transported across
thylakoid membrane
4.1 Chemical Energy and ATP
• Photosystem I captures energy and produces energycarrying molecules.
– chlorophyll absorbs
energy from sunlight
– energized electrons
are used to make
NADPH
– NADPH is transferred
to light-independent
reactions
4.1 Chemical Energy and ATP
• The light-dependent reactions produce ATP.
– hydrogen ions flow through a channel in the thylakoid
membrane
– ATP synthase attached to the channel makes ATP
4.1 Chemical Energy and ATP
• Light-independent
reactions occur in the
stroma and use CO2
molecules.
The second stage of photosynthesis uses energy frvf
1. Transcription is the process by which DNA is copied into messenger RNA (mRNA) by RNA polymerase. This involves three phases - initiation, elongation, and termination.
2. Eukaryotic transcription is more complex than prokaryotic transcription due to multiple RNA polymerases, nucleosomes, separation of transcription and translation, and intron-exon structure of genes.
3. Following transcription, eukaryotic mRNA undergoes processing including capping, polyadenylation, and splicing before being translated into protein by ribosomes.
Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product. It involves three main steps: replication, transcription, and translation. Replication copies DNA, transcription creates mRNA from DNA, and translation uses mRNA to produce proteins. The central dogma states that genetic information flows from DNA to RNA to protein. Mutations can occur and change the nucleotide sequence, potentially altering the amino acid sequence of the resulting protein.
Protein synthesis is the process whereby biological cells generate new proteins. Translation, the assembly of amino acids by ribosomes, is an essential part of the biosynthetic pathway, along with generation of messenger RNA (mRNA), aminoacylation of transfer RNA (tRNA), co-translational transport, and post-translational modification. Protein biosynthesis is strictly regulated at multiple steps. They are principally during transcription (phenomenon of RNA synthesis from DNA template) and translation (phenomenon of amino acid assembly from RNA). The cistron DNA is transcribed into the first of a series of RNA intermediates. The last version is used as a template in synthesis of a polypeptide chain. Protein will often be synthesized directly from genes by translating mRNA. A proprotein is an inactive protein containing one or more inhibitory peptides that can be activated when the inhibitory sequence is removed by proteolysis during post translational modification. A preprotein is a form that contains a signal sequence (an N-terminal signal peptide) that specifies its insertion into or through membranes, i.e., targets them for secretion. The signal peptide is cleaved off in the endoplasmic reticulum. Preproteins have both sequences (inhibitory and signal) still present. In protein synthesis, a succession of tRNA molecules charged with appropriate amino acids are brought together with an mRNA molecule and matched up by base-pairing through the anti-codons of the tRNA with successive codons of the mRNA. The amino acids are then linked together to extend the growing protein chain, and the tRNAs, no longer carrying amino acids, are released. This whole complex of processes is carried out by the ribosome, formed of two main chains of RNA, called ribosomal RNA (rRNA), and more than 50 different proteins. The ribosome latches onto the end of an mRNA molecule and moves along it, capturing loaded tRNA molecules and joining together their amino acids to form a new protein chain.
This document discusses transcription in prokaryotes and eukaryotes. In prokaryotes, transcription is carried out by RNA polymerase, which associates with sigma factors to form holoenzymes that recognize specific promoter sequences. The process involves initiation at promoters, elongation, and termination. In eukaryotes, there are three nuclear RNA polymerases that transcribe different genes. RNA polymerase II transcribes protein-coding genes using promoters that often contain TATA boxes and other recognition elements.
Similar to Studying gene expression and function (20)
Leveraging Generative AI to Drive Nonprofit InnovationTechSoup
In this webinar, participants learned how to utilize Generative AI to streamline operations and elevate member engagement. Amazon Web Service experts provided a customer specific use cases and dived into low/no-code tools that are quick and easy to deploy through Amazon Web Service (AWS.)
How to Setup Warehouse & Location in Odoo 17 InventoryCeline George
In this slide, we'll explore how to set up warehouses and locations in Odoo 17 Inventory. This will help us manage our stock effectively, track inventory levels, and streamline warehouse operations.
How to Make a Field Mandatory in Odoo 17Celine George
In Odoo, making a field required can be done through both Python code and XML views. When you set the required attribute to True in Python code, it makes the field required across all views where it's used. Conversely, when you set the required attribute in XML views, it makes the field required only in the context of that particular view.
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
How to Build a Module in Odoo 17 Using the Scaffold MethodCeline George
Odoo provides an option for creating a module by using a single line command. By using this command the user can make a whole structure of a module. It is very easy for a beginner to make a module. There is no need to make each file manually. This slide will show how to create a module using the scaffold method.
Strategies for Effective Upskilling is a presentation by Chinwendu Peace in a Your Skill Boost Masterclass organisation by the Excellence Foundation for South Sudan on 08th and 09th June 2024 from 1 PM to 3 PM on each day.
This slide is special for master students (MIBS & MIFB) in UUM. Also useful for readers who are interested in the topic of contemporary Islamic banking.
Chapter wise All Notes of First year Basic Civil Engineering.pptxDenish Jangid
Chapter wise All Notes of First year Basic Civil Engineering
Syllabus
Chapter-1
Introduction to objective, scope and outcome the subject
Chapter 2
Introduction: Scope and Specialization of Civil Engineering, Role of civil Engineer in Society, Impact of infrastructural development on economy of country.
Chapter 3
Surveying: Object Principles & Types of Surveying; Site Plans, Plans & Maps; Scales & Unit of different Measurements.
Linear Measurements: Instruments used. Linear Measurement by Tape, Ranging out Survey Lines and overcoming Obstructions; Measurements on sloping ground; Tape corrections, conventional symbols. Angular Measurements: Instruments used; Introduction to Compass Surveying, Bearings and Longitude & Latitude of a Line, Introduction to total station.
Levelling: Instrument used Object of levelling, Methods of levelling in brief, and Contour maps.
Chapter 4
Buildings: Selection of site for Buildings, Layout of Building Plan, Types of buildings, Plinth area, carpet area, floor space index, Introduction to building byelaws, concept of sun light & ventilation. Components of Buildings & their functions, Basic concept of R.C.C., Introduction to types of foundation
Chapter 5
Transportation: Introduction to Transportation Engineering; Traffic and Road Safety: Types and Characteristics of Various Modes of Transportation; Various Road Traffic Signs, Causes of Accidents and Road Safety Measures.
Chapter 6
Environmental Engineering: Environmental Pollution, Environmental Acts and Regulations, Functional Concepts of Ecology, Basics of Species, Biodiversity, Ecosystem, Hydrological Cycle; Chemical Cycles: Carbon, Nitrogen & Phosphorus; Energy Flow in Ecosystems.
Water Pollution: Water Quality standards, Introduction to Treatment & Disposal of Waste Water. Reuse and Saving of Water, Rain Water Harvesting. Solid Waste Management: Classification of Solid Waste, Collection, Transportation and Disposal of Solid. Recycling of Solid Waste: Energy Recovery, Sanitary Landfill, On-Site Sanitation. Air & Noise Pollution: Primary and Secondary air pollutants, Harmful effects of Air Pollution, Control of Air Pollution. . Noise Pollution Harmful Effects of noise pollution, control of noise pollution, Global warming & Climate Change, Ozone depletion, Greenhouse effect
Text Books:
1. Palancharmy, Basic Civil Engineering, McGraw Hill publishers.
2. Satheesh Gopi, Basic Civil Engineering, Pearson Publishers.
3. Ketki Rangwala Dalal, Essentials of Civil Engineering, Charotar Publishing House.
4. BCP, Surveying volume 1
हिंदी वर्णमाला पीपीटी, hindi alphabet PPT presentation, hindi varnamala PPT, Hindi Varnamala pdf, हिंदी स्वर, हिंदी व्यंजन, sikhiye hindi varnmala, dr. mulla adam ali, hindi language and literature, hindi alphabet with drawing, hindi alphabet pdf, hindi varnamala for childrens, hindi language, hindi varnamala practice for kids, https://www.drmullaadamali.com
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
2. Introduction
All genes have to be expressed in order to function. Gene expression is the
combined process of the transcription of a gene into mRNA, the processing of that
mRNA, and its translation into protein (for protein-encoding genes).
Gene expression is the process by which the information encoded in a gene is
used in the synthesis of a functional gene product. These products are often
proteins, but in non-protein coding genes such as ribosomal RNA (rRNA), transfer
RNA (tRNA) or small nuclear RNA (snRNA) genes, the product is a functional RNA.
To understand how a gene is expressed, the RNA transcript must be studied, in
particularly:
the removal of introns,
the exact locations of the start and end points of transcription,
the signals that determine the start and finish of the transcription etc.
4. Studying the RNA Transcript of a Gene
Transcript analysis by northern hybridization:
Northern hybridization, the RNA equivalent of Southern hybridization, is used to measure
the length of a transcript.
An RNA extract is electrophoresed in an agarose gel, using a denaturing electrophoresis
buffer (e.g., one containing formaldehyde) to ensure that the RNAs do not form inter- or
intramolecular base pairs, as base pairing would affect the rate at which the molecules
migrate through the gel.
After electrophoresis, the gel is blotted onto a nylon or nitrocellulose membrane, and
hybridized with a labeled probe. If the probe is a cloned gene, the band that appears in the
autoradiograph is the transcript of that gene.
The size of the transcript can be determined from its position within the gel, and if RNA
from different tissues is run in different lanes of the gel, then the possibility that the gene is
differentially expressed can be examined.
5. Studying the RNA Transcript of a Gene
FIG: Northern hybridization. Three RNA extracts from different tissues have been electrophoresed in an
agarose gel. The extracts are made up of many RNAs of different lengths so each gives a smear of RNA, but
two distinct bands are seen, one for each of the abundant ribosomal RNAs. The sizes of these rRNAs are
known (e.g. 4718 and 1874 nucleotides in mammals), so they can be used as internal size markers. The
gel is transferred to a membrane, probed with a cloned gene, and the results visualized, for example by
autoradiography if the probe has been radioactively labeled. Only lane 1 gives a band, showing that the
cloned gene is expressed only in the tissue from which this RNA extract was obtained.
Northern Hybridization
6. Studying the RNA Transcript of a Gene
Transcript analysis by DNA-mRNA hybridization:
Nucleic acid hybridization occurs just as readily between complementary DNA
and RNA strands as between single-stranded DNA molecules. If a hybrid is formed
between a DNA strand, containing a gene, and its mRNA, then the boundaries
between the double- and single-stranded regions will mark the start and end
points of the mRNA.
Introns, which are present in the DNA but not in the mRNA, will “loop out” as
additional single-stranded regions.
Now consider the result of treating the DNA–RNA hybrid with a single-strand
specific nuclease such as S1. S1 nuclease degrades single-stranded DNA or RNA
polynucleotides, including single-stranded regions at the ends of predominantly
double stranded molecules, but has no effect on double-stranded DNA or on DNA–
RNA hybrids.
7. Studying the RNA Transcript of a Gene
FIG: A DNA-mRNA hybrid and the effect of treating this
hybrid with a single-strand-specific nuclease such as S1.
S1 nuclease will therefore digest the
non-hybridized single-stranded DNA
regions at each end of the DNA–RNA
hybrid, along with any looped-out
introns. The single-stranded DNA
fragments protected from S1 nuclease
digestion can be recovered if the RNA
strand is degraded by treatment with
alkali.
Limitation of the method:
Although the sizes of the protected
DNA fragments could be measured by
gel electrophoresis, this does not
allow their order or relative positions
in the DNA sequence to be
determined.
8. Studying the RNA Transcript of a Gene
Locating a transcription start point by S1 nuclease mapping:
A few subtle modifications to the previous technique allow
the precise start and end points of the transcript and of any
introns it contains to be mapped onto the DNA sequence. An
example of the way in which S1 nuclease mapping is used to
locate the start point of a transcript is shown in the figure.
Here, a Sau3A fragment that contains 100 bp of coding region,
along with 300 bp of the leader sequence preceding the gene,
has been cloned into an M13 vector and obtained as a single-
stranded molecule. A sample of the RNA transcript is added
and allowed to anneal to the DNA molecule.
FIG: Locating a transcription start
point by S1 nuclease mapping.
9. Studying the RNA Transcript of a Gene
The DNA molecule is still primarily single-stranded but now has a small region
protected by the RNA transcript. All but this protected region is digested by S1
nuclease and the RNA is degraded with alkali, leaving a short single-stranded DNA
fragment.
If these manipulations are examined closely it will become clear that the size of this
single stranded fragment corresponds to the distance between the transcription
start point and the right-hand Sau3A site. The size of the single-stranded fragment
is therefore determined by gel electrophoresis and this information is used to
locate the transcription start point on the DNA sequence. Exactly the same strategy
could locate the end point of transcription and the junction points between introns
and exons.
10. Studying the RNA Transcript of a Gene
Transcript analysis by primer extension:
Primer extension—is less adaptable, because it can only identify the 5′ end of an
RNA. It is, nonetheless, an important technique that is frequently used to check the
results of S1 analyses.
Primer extension can only be used if at least part of the sequence of the transcript
is known. This is because a short oligonucleotide primer must be annealed to the
RNA at a known position, ideally within 100–200 nucleotides of the 5′ end of the
transcript.
Once annealed, the primer is extended by reverse transcriptase . This is a cDNA
synthesis reaction, but one that is very likely to proceed to completion as only a
short segment of RNA has to be copied.
11. Studying the RNA Transcript of a Gene
The 3′ end of the newly synthesized
strand of DNA will therefore correspond
with the 5′ terminus of the transcript.
Locating the position of this terminus on
the DNA sequence is achieved simply by
determining the length of the single-
stranded DNA molecule and correlating
this information with the annealing
position of the primer.
FIG: Locating a transcription start point by primer extension.
12. Studying the RNA Transcript of a Gene
Transcript analysis by PCR:
Rapid amplification of cDNA ends (RACE) can be used to identify the 5′ and 3′
termini of RNA molecules and so, like S1 analysis, can be used to map the ends of
transcripts. There are several variations to the RACE method. Here we will consider
how the 5′ end of an RNA molecule can be mapped.
This procedure uses a primer that is specific for an internal region of the RNA
molecule. The primer attaches to the RNA and directs the first, reverse
transcriptase catalyzed, stage of the process, during which a single-stranded cDNA
is made. As in the primer extension method, the 3′ end of the cDNA corresponds
with the 5′ end of the RNA.
13. Studying the RNA Transcript of a Gene
Terminal deoxynucleotidyl transferase is now used to
attach a series of A nucleotides to the 3′ end of the
cDNA, forming the priming site for a second PCR
primer, which is made up entirely of Ts and hence
anneals to the poly(A) tail created by terminal
transferase. Now the standard PCR begins, first
converting the single-stranded cDNA into a double-
stranded molecule, and then amplifying this molecule
as the PCR proceeds. The PCR product is then
sequenced to reveal the precise position of the start of
the transcript.
FIG: Identification of 5´ terminus by RACE.
14. Studying the Regulation of Gene Expression
Differentiation of cells involves wholesale changes in gene expression patterns, and
the process of development from fertilized egg cell to adult requires coordination
between different cells as well as time-dependent changes in gene expression.
A gene subject to regulation has one or more control sequences in its upstream
region and that the gene is switched on and off by the attachment of regulatory
proteins to these sequences.
A regulatory protein may repress gene expression, in which case the gene is
switched off when the protein is bound to the control sequence, or alternatively the
protein may have a positive or enhancing role, switching on or increasing
expression of the target gene.
FIG: Possible positions for control sequences in the region upstream of a gene.
15. Studying the Regulation of Gene Expression
Identifying protein binding sites on a DNA molecule:
A control sequence is a region of DNA that can bind a regulatory protein. It should therefore
be possible to identify control sequences upstream of a gene by searching the relevant
region for protein binding sites. There are three different ways of doing this.
(1) Gel retardation of DNA–protein complexes:
A gel retardation assay, also called electrophoretic mobility shift assay
(EMSA) or mobility shift electrophoresis or gel shift assay or gel
mobility shift assay or band shift assay, is a common electrophoresis
technique used to study DNA-protein interactions.
A DNA fragment carrying a bound protein is identified by gel
electrophoresis, as it has a lower mobility than the uncomplexed DNA
molecule. The procedure is referred to as gel retardation.
FIG: A bound protein decreases the
mobility of a DNA fragment during gel
electrophoresis.
16. Studying the Regulation of Gene Expression
The region of DNA upstream of the gene being studied is
digested with a restriction endonuclease and then mixed with
the regulatory protein or, if the protein has not yet been
purified, with an unfractionated extract of nuclear protein
(remember that gene regulation occurs in the nucleus).
The restriction fragment containing the control sequence forms
a complex with the regulatory protein: all the other fragments
remain as “naked” DNA. The location of the control sequence is
then determined by finding the position on the restriction map
of the fragment that is retarded during gel electrophoresis.
Limitation: A single control sequence may be less than 10 bp in
size, so gel retardation is rarely able to pinpoint it exactly.
FIG: Carrying out a gel retardation
experiment.
17. Studying the Regulation of Gene Expression
(2) Footprinting with DNase I:
The procedure generally called footprinting enables a
control region to be positioned within a restriction fragment
that has been identified by gel retardation.
Footprinting works on the basis that the interaction with a
regulatory protein protects the DNA in the region of a
control sequence from the degradative action of an
endonuclease such as deoxyribonuclease (DNase) I. This
phenomenon can be used to locate the protein binding site
on the DNA molecule.
The DNA fragment being studied is first labeled at one end,
and then complexed with the regulatory protein. Then
DNase I is added, but the amount used is limited so that
complete degradation of the DNA fragment does not occur.
Instead the aim is to cut each molecule at just a single
phosphodiester bond.
FIG: A bound protein protects a region of a
DNA molecule from degradation by a
nuclease such as DNase I.
18. Studying the Regulation of Gene Expression
If the DNA fragment has no protein attached to it, the
result of this treatment is a family of labeled fragments,
differing in size by just one nucleotide each.
After removal of the bound protein and separation on a
polyacrylamide gel, the family of labeled fragments
appears as a ladder of bands. However, the bound protein
protected certain phosphodiester bonds from being cut
by DNase I, meaning that in this case the family of
fragments is not complete, as the fragments resulting
from cleavage within the control sequence are absent.
Their absence shows up as a “footprint”, clearly seen in
Figure shown here.
FIG: DNase I footprinting.
19. Studying the Regulation of Gene Expression
(3) Modification interference assays:
Gel retardation analysis and footprinting enable control sequences to be located,
but do not give information about the interaction between the binding protein and
the DNA molecule.
The more precise of these two techniques—footprinting—only reveals the region
of DNA that is protected by the bound protein. Proteins are relatively large
compared with a DNA double helix, and can protect several tens of base pairs when
bound to a control sequence that is just a few base pairs in length. Footprinting
therefore does not delineate the control region itself, only the region within which
it is located.
FIG: A bound protein can protect a
region of DNA that is much longer than
the control sequence.
20. Studying the Regulation of Gene Expression
The DNA fragments must first be labeled at one end. Then
they are treated with a chemical that modifies specific
nucleotides, an example being dimethyl sulphate, which
attaches methyl groups to guanine nucleotides. This
modification is carried out under limiting conditions so an
average of just one nucleotide per DNA fragment is
modified. Now the DNA is mixed with the protein extract.
The key to the assay is that the binding protein will
probably not attach to the DNA if one of the guanines within
the control region is modified, because methylation of a
nucleotide interferes with the specific chemical reaction
that enables it to form an attachment with a protein.
FIG: A modification interference assay.
21. Studying the Regulation of Gene Expression
If the DNA and protein mixture is examined by agarose gel electrophoresis two
bands will be seen, one comprising the DNA–protein complex and one containing
DNA with no bound protein. The band made up of unbound DNA is purified from
the gel and treated with piperidine, a chemical which cleaves DNA molecules at
methylated nucleotides. The products of piperidine treatment are now separated in
a polyacrylamide gel and the labeled bands visualized.
The sizes of the bands that are seen indicate the position in the DNA fragment of
guanines whose methylation prevented protein binding. These guanines lie within
the control sequence. The modification assay can now be repeated with chemicals
that target A, T, or C nucleotides to determine the precise position of the control
sequence.
22. Studying the Regulation of Gene Expression
Identifying control sequences by deletion analysis:
Gel retardation, footprinting, and modification interference assays are able to
locate possible control sequences upstream of a gene, but they provide no
information on the function of the individual sequences. Deletion analysis is a
totally different approach that not only can locate control sequences (though only
with the precision of gel retardation) but importantly also can indicate the function
of each sequence.
The technique depends on the assumption that deletion of the control sequence
will result in a change in the way in which expression of a cloned gene is regulated.
For instance, deletion of a sequence that represses expression of a gene should
result in that gene being expressed at a higher level. Similarly, tissue-specific
control sequences can be identified as their deletion results in the target gene
being expressed in tissues other than the correct one.
24. Studying the Regulation of Gene Expression
Reporter gene is a test gene that is fused to the upstream region of the cloned
gene, replacing this gene. When cloned into the host organism the expression
pattern of the reporter gene should exactly mimic that of the original gene, as the
reporter gene is under the influence of exactly the same control sequences as the
original gene.
The reporter gene must be chosen with care. The first criterion is
that the reporter gene must code for a phenotype not already
displayed by the host organism. The phenotype of the reporter
gene must be relatively easy to detect after it has been cloned
into the host, and ideally it should be possible to assay the
phenotype quantitatively. These criteria have not proved difficult
to meet and a variety of different reporter genes have been used
in studies of gene regulation. FIG: A reporter gene.
25. Studying the Regulation of Gene Expression
Carrying out a deletion analysis:
Deletions can be made in the upstream region of the
construct by any one of several strategies, a simple example
being shown in Figure here. The effect of the deletion is
then assessed by cloning the deleted construct into the
host organism and determining the pattern and extent of
expression of the reporter gene. An increase in expression
will imply that a repressing or silencing sequence has been
removed, a decrease will indicate removal of an activator or
enhancer, and a change in tissue specificity will pinpoint a
tissue-responsive control sequence. FIG: Deletion analysis. A reporter gene has been attached
to the upstream region of a seed-specific gene from a
plant. Removal of the restriction fragment bounded by
the sites R deletes the control sequence that mediates
seed-specific gene expression, so that the reporter gene
is now expressed in all tissues of the plant.
26. Identifying and Studying the Translation Product of a Cloned Gene
HRT and HART can identify the translation product of a cloned gene:
Two related techniques, hybrid-release translation (HRT) and hybrid-arrest translation
(HART), are used to identify the translation product encoded by a cloned gene. Both
depend on the ability of purified mRNA to direct synthesis of proteins in cell-free
translation systems. These are cell extracts, usually prepared from germinating wheat
seeds or from rabbit reticulocyte cells (both of which are exceptionally active in protein
synthesis) and containing ribosomes, tRNAs, and all the other molecules needed for protein
synthesis.
The mRNA sample is added to the cell-free translation system, along with a mixture of the
20 amino acids found in proteins, one of which is labeled (often 35S-methionine is used).
The mRNA molecules are translated into a mixture of radioactive proteins, which can be
separated by gel electrophoresis and visualized by autoradiography. Each band represents a
single protein coded by one of the mRNA molecules present in the sample.
27. Identifying and Studying the Translation Product of a Cloned Gene
FIG: Cell-free translation. FIG: Hybrid-release translation. FIG: Hybrid-arrest translation.
28. Identifying and Studying the Translation Product of a Cloned Gene
Both HRT and HART work best when the gene being studied has been obtained as a cDNA
clone. For HRT the cDNA is denatured, immobilized on a nitrocellulose or nylon membrane,
and incubated with the mRNA sample. The specific mRNA counterpart of the cDNA
hybridizes and remains attached to the membrane. After discarding the unbound molecules,
the hybridized mRNA is recovered and translated in a cell-free system. This provides a pure
sample of the protein coded by the cDNA.
Hybrid-arrest translation is slightly different in that the denatured cDNA is added directly to
the mRNA sample. Hybridization again occurs between the cDNA and its mRNA
counterpart, but in this case the unbound mRNA is not discarded. Instead the entire sample
is translated in the cell-free system. The hybridized mRNA is unable to direct translation, so
all the proteins except the one coded by the cloned gene are synthesized. The cloned gene’s
translation product is therefore identified as the protein that is absent from the
autoradiograph.
29. Identifying and Studying the Translation Product of a Cloned Gene
Analysis of proteins by in vitro mutagenesis:
The best way of determining the relationship
between the structure of a protein and its mode
of structure is to induce a mutation in the gene
coding for the protein and then to determine
what effect the change in amino acid sequence
has on the properties of the translation product.
Under normal circumstances mutations occur
randomly and a large number may have to be
screened before one that gives useful
information is found. A solution to this problem
is provided by in vitro mutagenesis, a
technique that enables a directed mutation to be
made at a specific point in a cloned gene. FIG: A mutation may change the amino acid
sequence of a protein, possibly affecting its
properties.
30. Identifying and Studying the Translation Product of a Cloned Gene
Different types of in vitro mutagenesis techniques:
An almost unlimited variety of DNA manipulations can be used to introduce mutations into
cloned genes. The following are the simplest:
A restriction fragment can be deleted.
The gene can be opened at a unique restriction site, a few nucleotides removed with a
double-strand-specific endonuclease such as Bal31, and the gene religated.
A short, double-stranded oligonucleotide can be inserted at a restriction site. The sequence
of the oligonucleotide can be such that the additional stretch of amino acids inserted into the
protein produces, for example, a new structure such as an a-helix, or destabilizes an existing
structure.
Although potentially useful, these manipulations depend on the fortuitous
occurrence of a restriction site at the area of interest in the cloned gene.
Oligonucleotide-directed mutagenesis is a more versatile technique that can
create a mutation at any point in the gene.
31. Identifying and Studying the Translation Product of a Cloned Gene
FIG: Various in vitro mutagenesis techniques.
32. Identifying and Studying the Translation Product of a Cloned Gene
Using an oligonucleotide to create a point mutation in a cloned gene:
The gene to be mutated must be obtained in a single-stranded form and so is
generally cloned into an M13 vector. The single-stranded DNA is purified and the
region to be mutated identified by DNA sequencing. A short oligonucleotide is then
synthesized, complementary to the relevant region, but containing the desired
nucleotide alteration.
Despite this mismatch the oligonucleotide will anneal to the single-stranded DNA
and act as a primer for complementary strand synthesis by a DNA polymerase. This
strand synthesis reaction is continued until an entire new strand is made and the
recombinant molecule is completely double-stranded.
33. Identifying and Studying the Translation Product of a Cloned Gene
After introduction, by transfection, into competent E. coli cells, DNA replication
produces numerous copies of the recombinant DNA molecule. The semi-
conservative nature of DNA replication means that half the double-stranded
molecules that are produced are unmutated in both strands, whereas half are
mutated in both strands. Similarly, half the resulting phage progeny carry copies of
the unmutated molecule and half carry the mutation.
The phages produced by the transfected cells are plated onto solid agar so that
plaques are produced. Half the plaques should contain the original recombinant
molecule, and half the mutated version. Which are which is determined by plaque
hybridization, using the oligonucleotide as the probe, and employing very strict
conditions so that only the completely base-paired hybrid is stable.
34. Identifying and Studying the
Translation Product of a
Cloned Gene
Cells infected with M13 vectors do not
lyse, but instead continue to divide.
The mutated gene can therefore be
expressed in the host E. coli cells,
resulting in production of recombinant
protein. The protein coded by the
mutated gene can be purified from the
recombinant cells and its properties
studied. The effect of a single base pair
mutation on the activity of the protein
can therefore be assessed.
FIG: One method for oligonucleotide-directed mutagenesis.
35. Identifying and Studying the Translation Product of a Cloned Gene
Using PCR method to create a point mutation in a cloned gene:
The starting DNA molecule is amplified by two PCRs. In each of these, one primer is
normal and forms a fully base-paired hybrid with the template DNA, but the second
is mutagenic, as it contains a single base-pair mismatch corresponding to the
mutation that we wish to introduce into the DNA sequence. This mutation is
therefore present in the two PCR products, each of which represents one half of the
starting DNA molecule.
The two PCR products are mixed together and a final PCR cycle carried out. In this
cycle, complementary strands from the two products anneal to one another and are
then extended by the polymerase, producing the full-length, mutated DNA
molecule.
36. Identifying and Studying the Translation Product of a Cloned Gene
This technique, and related ones using
PCR, is very quick and easy to carry out
but a major problem is caused by the high
error rate of the Taq polymerase used in
PCR. This error rate makes it likely that
not only the desired mutation, but also
random ones, will be present at the end of
the experiment. The PCR product
therefore has to be cloned and the
sequences of individual clones checked to
find one that has just the desired
mutation.
FIG: One method for using PCR to create a
directed mutation.
37. Studying Protein–Protein Interactions
Within living cells, few if any proteins act in total isolation. Instead, proteins interact with
one another in biochemical pathways and in multiprotein complexes. Two important
techniques, phage display and the yeast two hybrid system, enable these protein–protein
interactions to be examined.
Phage display:
This technique is called phage display because it involves the “display” of proteins on the
surface of a bacteriophage, usually M13. This is achieved by cloning the gene for the protein
in a special type of M13 vector, one that results in the cloned gene becoming fused with a
gene for a phage coat protein.
After transfection of E. coli, this gene fusion directs synthesis of a hybrid protein, made up
partly of the coat protein and partly of the product of the cloned gene. With luck this hybrid
protein will be inserted into the phage coat so that the product of the cloned gene is now
located on the surface of the phage particles.
38. Studying Protein–Protein Interactions
Normally this technique is carried out with a phage display library made up of
many recombinant phages, each displaying a different protein. Large libraries can
be prepared by cloning a mixture of cDNAs from a particular tissue or, less easily,
by cloning genomic DNA fragments. The library consists of phages displaying a
range of different proteins and is used to identify those that interact with a test
protein. This test protein could be a pure protein or one that is itself displayed on a
phage surface.
The protein is immobilized in the wells of a microtiter tray or on particles that can
be used in an affinity chromatography column, and then mixed with the phage
display library. Phages that are retained in the microtiter tray or within the column
after a series of washes are ones that display proteins that interact with the
immobilized test protein.
39. Studying Protein–Protein Interactions
FIG: Phage display. (a) Display of proteins on the surface of a
recombinant filamentous phage. (b) The gene fusion used to display
a protein. (c) One way of detecting interactions between a test
protein and a phage from within a display library.
FIG: The yeast two hybrid system. (a) A pair of transcription factors
that must interact in order for a yeast gene to be expressed. (b)
Replacement of transcription factor 1 with the hybrid protein 1*
abolishes gene expression as 1* cannot interact with transcription
factor 2. (c) Replacement of transcription factor 2 with the hybrid
protein 2* restores gene expression if the hybrid parts of 1* and 2*
are able to interact.
40. Studying Protein–Protein Interactions
The yeast two hybrid system:
The yeast two hybrid system is very different to phage display. This procedure is
based on the discovery that gene expression in S. cerevisiae depends on
interactions between pairs of transcription factors.
In the two hybrid system, a pair of transcription factors responsible for expression
of a yeast gene is replaced by hybrid proteins, each one made partly of
transcription factor and partly of test protein. The ability of this pair of hybrids to
direct expression of the yeast target gene is then tested. To use the system, two
yeast cloning experiments must be carried out.
41. Studying Protein–Protein Interactions
The first cloning experiment involves the gene whose protein product is being
studied. This gene is ligated to the gene for one of the pair of transcription factors
and the construct inserted into a yeast vector. The recombinant yeasts that are
produced are not able to express the target gene, because this modified
transcription factor cannot interact with its partner.
In the second cloning experiment, a hybrid version of the partner is made and
cloned into the yeast cells. Restoration of expression of the target gene indicates
that the two hybrid transcription factors can interact. The fusions are designed in
such a way that this can only happen if the interactions occur between the test
protein components of the hybrids, not between the transcription factor segments.
Pairs of interacting test proteins are therefore identified. The second cloning
experiment can involve a library of recombinants representing different proteins,
so that one protein can be tested against many others.