Staphylococcus epidermidis is an opportunistic pathogen that commonly forms biofilms on medical devices. These biofilms make infections very difficult to treat as bacteria in biofilms are up to 1000 times more resistant to antibiotics. The document discusses various strategies to control S. epidermidis biofilms, including using antibiotic combinations to prevent resistance development, targeting mechanisms of biofilm antibiotic resistance, and exploring natural compounds and their synergistic effects with antibiotics.

1. Prepared By Amjad Khan Submitted to
1
StaphylococcusEpidermidis
Introduction
Staphylococcus epidermidis is a Gram-positive bacterium that normally colonizes the human
skin and mucous membranes. Previously regarded as an innocuous commensal microorganism
it is now seen as an important opportunistic pathogen, becoming,in the past few decades, the
most frequent causative agent of nosocomial infections. This is mainly due to the increasing use
of medical devices, allowing for biofilm formation in such surfaces 1. S. epidermidis biofilm-
related infections normally begin with the introduction of bacteria from the skin of the patient
or health care personnel during device insertion.
While these infections rarely lead to mortality, they are associated with increased patient
morbidity 1.An important aspect of the biofilm-related infections is their economic burden on
the public health system at an annual cost of over 2 billion Dollar in the US alone 2. Microbial
biofilms are communities of bacteria that live adhered to a surface and are surrounded by an
extracellular polymeric matrix, in an increased antibiotic resistance and tolerance to the
immune system3. Multiple mechanisms have been proposed for the high resistance of bacterial
biofilms to antibiotics, including 1) the low diffusivity of antibiotics through the matrix, 2) the
inactivation of the antibiotics by matrix components, 3) the presence of a sub-population of
bacteria, known as persisters, that are unaffected by antibiotics, or 4) the heterogeneous
nature of the biofilm composition and tridimensional structure 4.These mechanisms only
partially explain the increased resistance and probably this phenotype is the result of more than
one specific mechanism. Increased bacterial resistance toward antibiotics has led to the search
for new antimicrobial therapeutic agents such as essential oils fromplants. Farnesol is a
naturally-occurring sesquiterpene that was originally isolated from essential oils found in many
plants 5. Farnesol has also been found to be produced by Candida spp, being involved in
quorum sensing 6. Of high importance is the fact that farnesol has been shown to have
antimicrobial potential against several bacteria, including S. epidermidis7.However, the
mechanism of action of farnesol is not yet fully understood, but it seems to
be related to cell membrane integrity 8.
We recently described a bacterial strain where farnesol had no detectable antibiotic effect but
strongly reduced biofilm biomass. We hypothesized that farnesol could be inducing biofilm
detachment9. In this manuscript we tested this hypothesis and assayed the effect of farnesol in
biofilm-forming clinical isolates of S. epidermidis, representing a wide diversity in terms of
genetic background, geographic and clinical origins.
General introduction
The coagulase-negative staphylococci Staphylococcus epidermidis is a human skin commensal
microorganism.
However, this bacterium can become an opportunistic pathogen and as such is often associated
with bacteremia and hospital acquired infections, particularly in patients with catheters or

2. Prepared By Amjad Khan Submitted to
2
others medical devices [1]. The main cause of their pathogenicity is their ability to adhere and
form biofilms on the surfaces of the medical devices formerly mentioned. A biofilm is an
aggregate of cells adhered to living or non-living surfaces and embedded in a self-produced
matrix of extracellular polymeric substances (EPS). In biofilm form, bacteria are protected from
antimicrobial agents and the host immune system contributing to the persistence of biofilm
infections, and can be up to 1 000 fold more resistant to antibiotics and other antimicrobial
agents, than their planktonic counterparts [2-4].
The high resistance presented by
Staphylococcus epidermidis biofilm cells to antimicrobial agents boosted the persistant demand
for new control strategies against this pathogenic bacterium in this mode of growth.
In fact, new strategies to control S. epidermidis biofilm-mediated infections have attracted the
attention of many research groups and several studies have and are being done in order to find
antimicrobial agents effective against this bacterium, specifically in this mode of growth.
Natural subtances with possible antimicrobial properties have raised
researchers’ interest and are pointed as potential alternatives to antibiotics. Some examples
are farnesol and other terpene alcohols, N-acetylcysteine (NAC), berberine, casbane diterpene,
salvipisone, etc. that have been tested as novel agents against several pathogenic
microorganisms such as bacteria, fungi and also virus, and namely against S.
epidermidis. The development of adaptative resistance to antibiotics used in common clinical
practice has also increased the interest on the new generation of antibiotics such as tigecycline,
daptomycin, linezolid, arylomycins, etc.,
which are seen as therapeutic alternatives. Furthermore, the rapid emergence of resistance has
highlighted the importance of antibiotics combination or with other antimicrobial agents,
aiming at the reduction of the likelihood of
resistance development and the enhancement of the effects of individual antimicrobial agents
by synergistic action. Some of these strategies showed encouraging in vitro results in controlling
S. epidermidis biofilms and appear to be promising alternatives to standard antibiotics usually
used in the treatment of S. epidermidis related infections.
Due to the increased involvement of S. epidermidis in foreignbody-related infections, the rapid
development and exhibition of multiple antibiotic resistance as well as its great propensity to
lead to persistent, chronic and recurrent infections, this pathogen remains a challenge and a
subject of study by several research groups and continues to receive significant attention.
Materials and Methods
Bacterial strains
Two well known biofilm-forming strains were selected to be used as control strains, based on
our previous work:S. epidermidis 9142 biofilm biomass is reduced by farnesol while S.

3. Prepared By Amjad Khan Submitted to
3
epidermidis 1457 biofilms shows no reduction7.Furthermore, we also used 25 clinical strains
previously characterized by several different molecular typing techniques, namely
staphylococcal chromosome cassette mec (SCCmec) and multilocus sequence typing (MLST),
were selected from a total of 217 nosocomial isolates collected between 1996 and 2001 in 17
different countries, from disease (107 isolates) and from carriage (87 isolates). Isolates were
selected in order to include the highest diversity as possible in terms of genetic backgrounds,
geographic and clinical origins. Finally a subset of 9 clinical strains isolated from indwelling
devices in Boston, MA, USA, were also included. All strains are listed in the results section.
Biofilm quantification
Biofilms were quantified using 3 different approaches. TSB was inoculated with one single
colony of each S. epidermidis control strain, in a 10 mL sterile tube, and incubated at 37°C in a
shaker at 120 rpm for 24 ± 2 h. Then a 1:200 dilution was performed in fresh TSB supplemented
with 1% (w/v) of glucose (TSBG), and incubated at 37°C in a shaker at 120 rpm in 96 well culture
plates (Orange Scientific, Braine-l’Alleud, Belgium) for 24 h. Biofilms were then washed twice
with 0.9% NaCl and fresh TSBG was added with or without 300 μM of farnesol and allowed to
incubate in the same conditions for further 24 h. For biofilm biomass determination, the
standard crystal violet staining method was used as described elsewhere 10. To determine cell
viability, biofilms were washed twice with 0.9% NaCl and resuspended in 0.9% NaCl followed by
gentle sonication as described above. CFUs were determined by the standard plating method,
using TSA plates. To determine the percentage of growth of bacteria inside the biofilm after 48
h, we quantified the relative population density of biofilms and the respective suspension
formed during the last 24 h of growth, on each 96 well, as described before 11. These
experiments were repeated three to five times with 8 replicates.
Molecular characterization of the clinical
strains
All strains were characterized by multilocus sequence typing (MLST)following the scheme
proposed by Thomas et al.12. The MLST data wereanalysed using the goeBURST algorithm
(http://goeBURST.phylowiz.net).This analysis was performed on March 21st, 2012. Isolates
were considered as belonging to the same clonal complex (CC) if sharing six out of seven
loci.The SCCmec type was determined by the combination of the class of mec complex and the
type of ccr complex. SCCmec was considered non-typable when either mec complex or ccr
complex, or both, were nontypable by the methods used or when the isolate carried more than
one ccr type. SCCmec was considered to be new if a new combination of mec complex and ccr
complex was found. The presence of the genes associated to biofilm formation, namely icaA,
aap and bhp was detected by PCR, using DyNAzyme II PCR mix (Finnzymes, Vantaa, Finland), in
the following thermal conditions: initial denaturation at 94ºC for 5 min followed by 35 cycles of
94ºC at 30 s, 54ºC at 30 s and 72ºC at 45 s. A final extension step was performed for 10 min at
72 ºC. Negative results were re-checked with a second set of primers. Oligonucleotide primers

4. Prepared By Amjad Khan Submitted to
4
were designed using the Primer3 software, having S. epidermidis RP62A genome as template:
icaA (Fw - tgcactcaatgagggaatca, Rv- tcaggcactaacatccagca; amplicon size of 417), aap (Fw -
gctctcataacgccacttgc, Rv - ggacagccacctggtacaac; amplicon size of 617), bhp (Fw -
tggactcgtagcttcgtcct, Rv - tctgcagatacccagacaacc; amplicon size of 213).For biofilm biomass
determination, the standard crystal violet staining method was used 10.
GRAPH
Effect of farnesolon S. epidermidisbiofilms. Bacteria were allowed to form
biofilms for 24 h, after which fresh medium was added with or without 300 μM of farnesol and
allowed to grow for further 24 h. Top: crystal violet staining; middle: CFUs determination;

5. Prepared By Amjad Khan Submitted to
5
bottom: percentage of planktonic cells living outside the biofilms.* significant difference, paired
samples t-student, p<0.05.
Staphylococcus epidermidis biofilm control strategies
Traditional antibiotic combination
As it was already referred, a worrying current problem is the increasing bacterial resistance to
traditional antibiotics commonly used in hospitals to treat coagulase-negative (CoNS)
infections, which is aggravated when the cells are in biofilms. Generally, antimicrobial agents
alone are ineffective against S. epidermidis biofilms. Rifampicin, a RNA
synthesis inhibitor, is among the most effective molecules for treating biofilm-related infections
[5,6]. However, this antibiotic has a high propensity for rapid development of resistance [7,8,9].
This fact makes rifampicin unfeasible as monotherapy. A solution to this problem is the
combination of antimicrobial agents, avoiding the use of monotherapy.
Antibiotic combination represents a therapeutic option in the treatment of S. epidermidis
infections [10]. In fact, some authors demonstrated that, for example, the combination of
rifampicin with quinolones or fusidic acid could prevent the emergence of rifampicin resistance
during therapy [8,11].
Furthermore to avoid resistance, this strategy can also potentiate the effect of individual
antimicrobial agents by synergic action. Gomes et al. tested the susceptibility of S. epidermidis
biofilms in vitro to traditional antibiotics alone and in double combinations at breakpoint
concentration and demonstrated that there are some combinations that can be
potentially considered for therapeutic use for an efficient control of S. epidermidis biofilm
related-infection (data not shown). Rifampicin is always present in these combinations, being
rifampicin+gentamicin and rifampicin+clindamycin the most active combinations in terms of
CFU reduction and with the broadest range of action
Stationary phase Log phase
Inoculum cell density control farnesol control farnesol
109 / mL 0.27 ± 0.13 0.14 ± 0.13 N/A N / A
108 / mL 0.24 ± 0.26 0.02 ± 0.30 N/A N / A
107 / m L 0.13 ± 0.26* -1.12 ± 0.41* 0.85 ± 0.10** 0.03 ±
0.07**
106/ mL 0.75 ± 0.56* -1.42 ± 0.76* 1.56 ± 0.27** 0.29 ±
0.27**
105 / mL 0.93 ± 0.13* -1.01 ± 0.47* 1.50 ± 0.06* -1.07 ±
0.07*
104 / mL 0.63 ± 0.38* -1.50 ± 0.39* 1.16 ± 0.08* -0.61 ±
0.09*
Antibiotic resistance of bacteria in biofilms

6. Prepared By Amjad Khan Submitted to
6
Bacteria that adhere to implanted medical devices or damaged tissue can encase themselves in
a hydrated matrix of polysaccharide and protein, and form a slimy layer known as a biofilm.
Antibiotic resistance of bacteria in the biofilm mode of growth contributes to the chronicity of
infections such as those associated with implanted medical devices.
The mechanisms of resistance in biofilms are different from the now familiar plasmids,
transposons, and mutations that confer innate resistance to individual bacterial cells. In
biofilms, resistance seems to depend on multicellular strategies. We summarise the features of
biofilm infections, review emerging mechanisms of resistance, and discuss potential therapies.
Resistance mechanisms
The familiar mechanisms of antibiotic resistance, such as efflux pumps, modifying enzymes, and
target mutations,12 do not seem to be responsible for the protection of bacteria in a biofilm. Even
sensitive bacteria that do not have a known genetic basis for resistance can have profoundly
reduced susceptibility when they form a biofilm. For example, a -lactamase-negative strain of
Klebsiella pneumoniae had a minimum inhibitory concentration of 2 _g/mL ampicillin in
aqueous suspension.13 The same strain, when grown as a biofilm, was scarcely affected (66%
survival) by 4 h treatment with 5000 _g/mL ampicillin, a dose that eradicated freefloating
bacteria.13 When bacteria are dispersed from a bacteria.13 When bacteria are dispersed from a
biofilm they usually rapidly become susceptible to biofilm they usually rapidly become
susceptible to antibiotics,14,15 which suggests that resistance of bacteria in biofilms is not
acquired via mutations or mobile genetic
Strategies to control Staphylococcus epidermidis biofilms
F. Gomes, B. Leite, P. Teixeira and R. Oliveira
IBB- Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, University
of Minho, Campus de Gualtar, 4710-057 Braga, Portugal Staphylococcus epidermidis is the
staphylococci species most commonly associated with bacteremia and hospital-acquired
infections and has recently arisen as the leading cause of infections related to indwelling
medical devices such as vascular catheters, prosthetic joints and artificial heart valves. The
prevalence of S. epidermidis in hospital-acquired infections is due to its ability to adhere and
form biofilms on biomaterial surfaces. This feature is one of the most important virulence
factors found in S. epidermidis. In biofilm form, bacteria are protected from antimicrobial
agents and the host immune system contributing to the persistence of biofilm infections. In
addition, the emergence of S. epidermidis resistance to conventional therapies, based in the
use of traditional antibiotics, leads to the failure of the current treatments used in the
combat of S. epidermidis infections and is becoming a major concern. These facts are
stimulating the continuous search for novel agents able to eradicate S. epidermidis biofilm
infections or that can work in synergy with the currently available antimicrobial agents. New
strategies have been showing encouraging in vitro results in controlling S. epidermidis biofilms
and seem to be promising alternatives to standard antibiotics usually used in the treatment of
S. epidermidis related infections.

7. Prepared By Amjad Khan Submitted to
7
Conclusions
Although new antibiotics have been developed in order to overcome the growing problem of
bacteria resistance, namely of S. epidermidis, this does not seem to be sufficient due to the rapid
emergence of resistance caused by the overuse of antibiotics, the high diversity of these bacteria,
their short replication time, the horizontal transfer of resistance genes, etc. Another problem to
take into consideration is the strain diversity and response to the different antimicrobial agents.
The effect of antimicrobial agents is highly strain-dependent and the rate of success will be
strongly dependent on the infectious S. epidermidis strain. The only way to avoid or slow the
rapid emergence of resistance remains the prudent use of antibiotics and/or the development of
alternatives to control S. epidermidis-related infections. Therefore it is still needed a continuous
search for new strategies against S. epidermidis biofilms. Overall, there are some promising
therapeutic strategies, such as some natural compounds and antimicrobial agents combinations,
that can be possibly used for medical purposes especially in the combat of infections caused by
S. epidermidis biofilms.
References
[1] Wang X, Yao X, Zhu Z, et al. Effect of berberine on Staphylococcus epidermidis biofilm
formation. International Journal of
Antimicrobial Agents. 2009;34:60-66.
[2] Cargill JS, Upton M. Low concentration of vancomycin stimulate biofilm formation in some
clinical isolates of Staphylococcus
epidermidis. Journal of Clinical Pathology. 2010; 62:1112-1116.
[3] Mah T-FC, O’Toole GA. Mechanisms of biofilm resistance to antimicrobials agents. Trends
in Microbiology. 2001;9 :34-39. [2]
[4] Gilbert P, Das J, Foley I. Biofilm susceptibility to antimicrobials. Advances in Dental
Research. 1997;11:160-167.
[5] Cerca N, Martins S, Cerca F, et al. Comparative assessment of antibiotic susceptibility of
coagulase-negative staphylococci in
biofilm versus planktonic culture as assessed by bacterial enumeration or rapid XTT colorimetry.
Journal of Antimicrobial
Chemotherapy. 2005;56:331-336.

8. Prepared By Amjad Khan Submitted to
8
[6] Saginur R, St. Denis M, Ferris W, et al. Multiple combination bactericidal testing of
Staphylococcal biofilms from implantassociated
infections. Antimicrobial Agents Chemotherapy. 2006;50:55-61.
[7] Hellmark B, Unemo M, Nilsdotter-Augustinsson Å, et al. Antibiotic susceptibility among
Staphylococcus epidermidis isolated
from prosthetic joint infections