All about molecular markers like - hybridization based markers (RFLP), pcr based markers (RAPD, SSR, SNP) etc. Morphological and biochemical markers also covered.
Biotechnology for Crop Improvement.
Molecular Plant Breeding-Marker Assisted Breeding/Selection.
Comparison between three main and commonly discussed marker systems- RFLP, RAPD and AFLP.
Basic Understanding for Simple Sequence Repeats, SCAR and CAPS.
Strategies to overcome food shortages using molecular plant breeding approaches, Application of various molecular marker systems and examples.
Reference List.
Presenter: Brenda Chong
The presentation was done as part of the course STAT 504 titled Quantitative Genetics in Second Semester of MSc. Agricultural Statistics at Agricultural College, Bapatla under ANGRAU, Andhra Pradesh
Biotechnology for Crop Improvement.
Molecular Plant Breeding-Marker Assisted Breeding/Selection.
Comparison between three main and commonly discussed marker systems- RFLP, RAPD and AFLP.
Basic Understanding for Simple Sequence Repeats, SCAR and CAPS.
Strategies to overcome food shortages using molecular plant breeding approaches, Application of various molecular marker systems and examples.
Reference List.
Presenter: Brenda Chong
The presentation was done as part of the course STAT 504 titled Quantitative Genetics in Second Semester of MSc. Agricultural Statistics at Agricultural College, Bapatla under ANGRAU, Andhra Pradesh
Marker assisted selection is the breeding strategy in which selection for a gene is based on molecular markers closely linked to the gene of interest rather than the gene itself, and the markers are used to monitor the incorporation of the desirable allele from the donor source. Selection of a genotype carrying desirable gene via linked marker (s) is called Marker Assisted Selection. MAS can be applied to possible to use this kind of information.
The prerequisites for the classical procedure of MAS are the tight linkage between molecular marker and gene of interest and high heritability of the gene of interest. It is noteworthy that the “quality” and the number of markers have a major impact on the success of MAS. The quality of markers relates to their characteristics and to the cost and the efficiency of the genotyping process. The number of markers affects the reliability of the linkage between them and the gene(s). In other words, screening a large number of markers has the potential to identify close and reliable linkage between the marker and the gene of interest. MAS has greater potential for efficient gene pyramiding combining several important genes in one cultivar. MAS is gaining considerable importance as it can improve the efficiency of plant breeding through precise transfer of genomic regions of interest and acceleration of the recovery of the recurrent parent genome. Marker-assisted selection is gaining considerable importance as it would improve the efficiency of plant breeding through precise transfer of genomic regions of interest (foreground selection) and accelerating the recovery of the recurrent parent genome (background selection). The use of MAS in crop improvement will not only reduce the cost of developing new varieties but will also increase the precision and efficiency of selection in the breeding program as well as lessen the number of years required to come up with a new crop variety.
I would like to share this presentation file.
Some basics information regarding to molecular plant breeding, hope this help the beginner who start working in this field.
Thanks for many original source of information (mainly from slideshare.net, IRRI, CIMMYT and any paper received from professor and some over the internet)
Linkage and QTL mapping Populations and Association mapping population.
F2, Immortalized F2, Backcross (BC), Near isogenic lines (NIL), RIL, Double haploids(DH), Nested Association mapping (NAM), MAGIC and Interconnected populations.
Molecular Markers: Indispensable Tools for Genetic Diversity Analysis and Cro...Premier Publishers
Recent progress in molecular biology has led to the development of new molecular tools that offer the promise of making plant breeding faster. Molecular markers are segments of DNA associated with agronomically important traits and can be used by plant breeders as selection tools. Breeders can use marker-assisted selection (MAS) to bypass the traditional phenotype-based selection methods in order to improve crop varieties with pyramiding the desirable traits within short time. Various molecular markers such as RAPD, SSR, ISSR, RFLP, AFLP, SNP, SCAR, CAPS, etc. are extensively used for plant genetic diversity studies and crop improvement biotechnology. These markers are different in characteristic properties, applicability to various plants, unique in the resolving power and also have own advantages and disadvantages. This review article provides a valuable insight into different molecular marker techniques, classification, their advantages, disadvantages, ways of actions, uses of molecular markers in plant genetic diversity analysis and quantitative trait loci (QTL) mapping. It could be helpful for plant scientists and breeders in MAS breeding and crop improvement biotechnology in the post-genomic era.
Marker assisted selection is the breeding strategy in which selection for a gene is based on molecular markers closely linked to the gene of interest rather than the gene itself, and the markers are used to monitor the incorporation of the desirable allele from the donor source. Selection of a genotype carrying desirable gene via linked marker (s) is called Marker Assisted Selection. MAS can be applied to possible to use this kind of information.
The prerequisites for the classical procedure of MAS are the tight linkage between molecular marker and gene of interest and high heritability of the gene of interest. It is noteworthy that the “quality” and the number of markers have a major impact on the success of MAS. The quality of markers relates to their characteristics and to the cost and the efficiency of the genotyping process. The number of markers affects the reliability of the linkage between them and the gene(s). In other words, screening a large number of markers has the potential to identify close and reliable linkage between the marker and the gene of interest. MAS has greater potential for efficient gene pyramiding combining several important genes in one cultivar. MAS is gaining considerable importance as it can improve the efficiency of plant breeding through precise transfer of genomic regions of interest and acceleration of the recovery of the recurrent parent genome. Marker-assisted selection is gaining considerable importance as it would improve the efficiency of plant breeding through precise transfer of genomic regions of interest (foreground selection) and accelerating the recovery of the recurrent parent genome (background selection). The use of MAS in crop improvement will not only reduce the cost of developing new varieties but will also increase the precision and efficiency of selection in the breeding program as well as lessen the number of years required to come up with a new crop variety.
I would like to share this presentation file.
Some basics information regarding to molecular plant breeding, hope this help the beginner who start working in this field.
Thanks for many original source of information (mainly from slideshare.net, IRRI, CIMMYT and any paper received from professor and some over the internet)
Linkage and QTL mapping Populations and Association mapping population.
F2, Immortalized F2, Backcross (BC), Near isogenic lines (NIL), RIL, Double haploids(DH), Nested Association mapping (NAM), MAGIC and Interconnected populations.
Molecular Markers: Indispensable Tools for Genetic Diversity Analysis and Cro...Premier Publishers
Recent progress in molecular biology has led to the development of new molecular tools that offer the promise of making plant breeding faster. Molecular markers are segments of DNA associated with agronomically important traits and can be used by plant breeders as selection tools. Breeders can use marker-assisted selection (MAS) to bypass the traditional phenotype-based selection methods in order to improve crop varieties with pyramiding the desirable traits within short time. Various molecular markers such as RAPD, SSR, ISSR, RFLP, AFLP, SNP, SCAR, CAPS, etc. are extensively used for plant genetic diversity studies and crop improvement biotechnology. These markers are different in characteristic properties, applicability to various plants, unique in the resolving power and also have own advantages and disadvantages. This review article provides a valuable insight into different molecular marker techniques, classification, their advantages, disadvantages, ways of actions, uses of molecular markers in plant genetic diversity analysis and quantitative trait loci (QTL) mapping. It could be helpful for plant scientists and breeders in MAS breeding and crop improvement biotechnology in the post-genomic era.
A genetic marker is a gene or DNA sequence with a known location on a chromosome and associated with a particular gene or trait. It can be described as a variation, which may arise due to mutation or alteration in the genomic loci that can be observed. A genetic marker may be a short DNA sequence, such as a sequence surrounding a single base-pair change (single nucleotide polymorphism, SNP), or a long one, like mini & microsatellites.
Role of Marker Assisted Selection in Plant Resistance RandeepChoudhary2
Topic Role of Marker Assisted Selection in Plant Resistance is described in detail including some case studies.
Types of markers used in genetic engineering and biotechnology are described in detail.
Marker assisted selection is a process whereby a marker (morphological, biochemical or one
based on DNA/RNA variation) is used for indirect selection of a genetic determinant of a trait
of interest. Since the first reported linkage of an agronomically important trait (a quantitative
trait locus affecting seed weight) to a simply controlled gene (seed colour) in common bean by
Sax (1923), it has taken more than 60 years for genetic markers to become a qualified tool for
plant breeding programs. In rice, the Xieyou 218 hybrid was the first to be developed through
MAS to select individuals carrying a bacterial blight-resistant gene. Marker-assisted selection
(MAS) can be applied at the seedling stage, with high precision and reductions in cost. Genetic
mapping of major genes and quantitative traits loci (QTLs) for agricultural traits is increasing
the integration of biotechnology with the conventional breeding process. Traits related to
disease resistance to pathogens and to the quality of some crop products are offering some
important examples of a possible routinary application of MAS. For more complex traits, like
yield and abiotic stress tolerance, a number of constraints have severe limitations on an efficient
utilization of MAS in plant breeding. However, the economic and biological constraints such
as a low return of investment in small-grain cereal breeding, lack of diagnostic markers, and
the prevalence of QTL-background effects hinder the broad implementation of MAS but over
the past 2 decades, a number of R-genes conferring resistance to a diverse range of pathogens
have been mapped in many crops using molecular markers.
Taxonomy is the branch of science concerned with the classification of organisms. A taxonomic designation is more than just a name. Ideally, it reflects evolutionary history and the relationship between organisms. Traditionally, taxonomic classification has relied upon morphological features and physiological characteristics. However, for bacterial taxonomy, phenotypic approaches have proven insufficient. Unrelated bacteria can exhibit identical traits, closely related bacteria can have divergent features, and methods for accurate identification may be too cumbersome for routine use. In contrast, molecular taxonomy approaches use data derived from hereditary material and provide a robust view of genetic relatedness. Advances in technology have been accompanied by improvements in the cost, speed, and availability of molecular methods. Here, we provide a brief history of approaches to prokaryotic classification and describe how molecular taxonomy is redefining our understanding of bacterial evolution and the tree of life.
this is a presentation on molecular markers that include what is molecular marker, it's types, biochemical markets (alloenzyme), it's classification, data analysis and it's applications
Role of molecular marker play a significant supplementary role in enhancing yield along with conventional plant breeding methods. the result obtain through molecular method are more accurate and at genotypic level. It had wider applications in field of plant breeding, biotechnology, physiology, pathology, entamology, etc. The mapping information obtained from these markers had created a revolution in the sequencing sector and open many pathways for developments, innovations and research.
Molecular markers for measuring genetic diversity Zohaib HUSSAIN
Molecular markers for measuring genetic diversity
Introduction:
The molecular basis of the essential biological phenomena in plants is crucial for the effective conservation, management, and efficient utilization of plant genetic resources (PGR).
Determining genetic diversity can be based on morphological, biochemical, and molecular types of information. However, molecular markers have advantages over other kinds, where they show genetic differences on a more detailed level without interferences from environmental factors, and where they involve techniques that provide fast results detailing genetic diversity
Comparison of different methods
Morphological characterization does not require expensive technology but large tracts of land are often required for these experiments, making it possibly more expensive than molecular assessment. These traits are often susceptible to phenotypic plasticity; conversely, this allows assessment of diversity in the presence of environmental variation.
Biochemical analysis is based on the separation of proteins into specific banding patterns. It is a fast method which requires only small amounts of biological material. However, only a limited number of enzymes are available and thus, the resolution of diversity is limited.
Molecular analyses comprise a large variety of DNA molecular markers, which can be employed for analysis of variation. Different markers have different genetic qualities (they can be dominant or co-dominant, can amplify anonymous or characterized loci, can contain expressed or non-expressed sequences, etc.).
Genetic marker
The concept of genetic markers is not a new one; in the nineteenth century, Gregor Mendel employed phenotype-based genetic markers in his experiments. Later, phenotype-based genetic markers for Drosophila melanogaster led to the founding of the theory of genetic linkage. A genetic marker is an easily identifiable piece of genetic material, usually DNA that can be used in the laboratory to tell apart cells, individuals, populations, or species. The use of genetic markers begins with extracting proteins or chemicals (for biochemical markers) or DNA (for molecular markers) from tissues of the plant (for example, seeds, foliage, pollen, sometimes woody tissues).
Molecular markers In genetics, a molecular marker (identified as genetic marker) is a fragment of DNA that is associated with a certain location within the genome. Molecular markers which detect variation at the DNA level such as nucleotide changes: deletion, duplication, inversion and/or insertion. Markers can exhibit two modes of inheritance, i.e. dominant/recessive or co-dominant. If the genetic pattern of homozygotes can be distinguished from that of heterozygotes, then a marker is said to be co-dominant. Generally co-dominant markers are more informative than the
Introduction:
RNA interference (RNAi) or Post-Transcriptional Gene Silencing (PTGS) is an important biological process for modulating eukaryotic gene expression.
It is highly conserved process of posttranscriptional gene silencing by which double stranded RNA (dsRNA) causes sequence-specific degradation of mRNA sequences.
dsRNA-induced gene silencing (RNAi) is reported in a wide range of eukaryotes ranging from worms, insects, mammals and plants.
This process mediates resistance to both endogenous parasitic and exogenous pathogenic nucleic acids, and regulates the expression of protein-coding genes.
What are small ncRNAs?
micro RNA (miRNA)
short interfering RNA (siRNA)
Properties of small non-coding RNA:
Involved in silencing mRNA transcripts.
Called “small” because they are usually only about 21-24 nucleotides long.
Synthesized by first cutting up longer precursor sequences (like the 61nt one that Lee discovered).
Silence an mRNA by base pairing with some sequence on the mRNA.
Discovery of siRNA?
The first small RNA:
In 1993 Rosalind Lee (Victor Ambros lab) was studying a non- coding gene in C. elegans, lin-4, that was involved in silencing of another gene, lin-14, at the appropriate time in the
development of the worm C. elegans.
Two small transcripts of lin-4 (22nt and 61nt) were found to be complementary to a sequence in the 3' UTR of lin-14.
Because lin-4 encoded no protein, she deduced that it must be these transcripts that are causing the silencing by RNA-RNA interactions.
Types of RNAi ( non coding RNA)
MiRNA
Length (23-25 nt)
Trans acting
Binds with target MRNA in mismatch
Translation inhibition
Si RNA
Length 21 nt.
Cis acting
Bind with target Mrna in perfect complementary sequence
Piwi-RNA
Length ; 25 to 36 nt.
Expressed in Germ Cells
Regulates trnasposomes activity
MECHANISM OF RNAI:
First the double-stranded RNA teams up with a protein complex named Dicer, which cuts the long RNA into short pieces.
Then another protein complex called RISC (RNA-induced silencing complex) discards one of the two RNA strands.
The RISC-docked, single-stranded RNA then pairs with the homologous mRNA and destroys it.
THE RISC COMPLEX:
RISC is large(>500kD) RNA multi- protein Binding complex which triggers MRNA degradation in response to MRNA
Unwinding of double stranded Si RNA by ATP independent Helicase
Active component of RISC is Ago proteins( ENDONUCLEASE) which cleave target MRNA.
DICER: endonuclease (RNase Family III)
Argonaute: Central Component of the RNA-Induced Silencing Complex (RISC)
One strand of the dsRNA produced by Dicer is retained in the RISC complex in association with Argonaute
ARGONAUTE PROTEIN :
1.PAZ(PIWI/Argonaute/ Zwille)- Recognition of target MRNA
2.PIWI (p-element induced wimpy Testis)- breaks Phosphodiester bond of mRNA.)RNAse H activity.
MiRNA:
The Double-stranded RNAs are naturally produced in eukaryotic cells during development, and they have a key role in regulating gene expression .
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Sérgio Sacani
Since volcanic activity was first discovered on Io from Voyager images in 1979, changes
on Io’s surface have been monitored from both spacecraft and ground-based telescopes.
Here, we present the highest spatial resolution images of Io ever obtained from a groundbased telescope. These images, acquired by the SHARK-VIS instrument on the Large
Binocular Telescope, show evidence of a major resurfacing event on Io’s trailing hemisphere. When compared to the most recent spacecraft images, the SHARK-VIS images
show that a plume deposit from a powerful eruption at Pillan Patera has covered part
of the long-lived Pele plume deposit. Although this type of resurfacing event may be common on Io, few have been detected due to the rarity of spacecraft visits and the previously low spatial resolution available from Earth-based telescopes. The SHARK-VIS instrument ushers in a new era of high resolution imaging of Io’s surface using adaptive
optics at visible wavelengths.
Slide 1: Title Slide
Extrachromosomal Inheritance
Slide 2: Introduction to Extrachromosomal Inheritance
Definition: Extrachromosomal inheritance refers to the transmission of genetic material that is not found within the nucleus.
Key Components: Involves genes located in mitochondria, chloroplasts, and plasmids.
Slide 3: Mitochondrial Inheritance
Mitochondria: Organelles responsible for energy production.
Mitochondrial DNA (mtDNA): Circular DNA molecule found in mitochondria.
Inheritance Pattern: Maternally inherited, meaning it is passed from mothers to all their offspring.
Diseases: Examples include Leber’s hereditary optic neuropathy (LHON) and mitochondrial myopathy.
Slide 4: Chloroplast Inheritance
Chloroplasts: Organelles responsible for photosynthesis in plants.
Chloroplast DNA (cpDNA): Circular DNA molecule found in chloroplasts.
Inheritance Pattern: Often maternally inherited in most plants, but can vary in some species.
Examples: Variegation in plants, where leaf color patterns are determined by chloroplast DNA.
Slide 5: Plasmid Inheritance
Plasmids: Small, circular DNA molecules found in bacteria and some eukaryotes.
Features: Can carry antibiotic resistance genes and can be transferred between cells through processes like conjugation.
Significance: Important in biotechnology for gene cloning and genetic engineering.
Slide 6: Mechanisms of Extrachromosomal Inheritance
Non-Mendelian Patterns: Do not follow Mendel’s laws of inheritance.
Cytoplasmic Segregation: During cell division, organelles like mitochondria and chloroplasts are randomly distributed to daughter cells.
Heteroplasmy: Presence of more than one type of organellar genome within a cell, leading to variation in expression.
Slide 7: Examples of Extrachromosomal Inheritance
Four O’clock Plant (Mirabilis jalapa): Shows variegated leaves due to different cpDNA in leaf cells.
Petite Mutants in Yeast: Result from mutations in mitochondrial DNA affecting respiration.
Slide 8: Importance of Extrachromosomal Inheritance
Evolution: Provides insight into the evolution of eukaryotic cells.
Medicine: Understanding mitochondrial inheritance helps in diagnosing and treating mitochondrial diseases.
Agriculture: Chloroplast inheritance can be used in plant breeding and genetic modification.
Slide 9: Recent Research and Advances
Gene Editing: Techniques like CRISPR-Cas9 are being used to edit mitochondrial and chloroplast DNA.
Therapies: Development of mitochondrial replacement therapy (MRT) for preventing mitochondrial diseases.
Slide 10: Conclusion
Summary: Extrachromosomal inheritance involves the transmission of genetic material outside the nucleus and plays a crucial role in genetics, medicine, and biotechnology.
Future Directions: Continued research and technological advancements hold promise for new treatments and applications.
Slide 11: Questions and Discussion
Invite Audience: Open the floor for any questions or further discussion on the topic.
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Sérgio Sacani
We characterize the earliest galaxy population in the JADES Origins Field (JOF), the deepest
imaging field observed with JWST. We make use of the ancillary Hubble optical images (5 filters
spanning 0.4−0.9µm) and novel JWST images with 14 filters spanning 0.8−5µm, including 7 mediumband filters, and reaching total exposure times of up to 46 hours per filter. We combine all our data
at > 2.3µm to construct an ultradeep image, reaching as deep as ≈ 31.4 AB mag in the stack and
30.3-31.0 AB mag (5σ, r = 0.1” circular aperture) in individual filters. We measure photometric
redshifts and use robust selection criteria to identify a sample of eight galaxy candidates at redshifts
z = 11.5 − 15. These objects show compact half-light radii of R1/2 ∼ 50 − 200pc, stellar masses of
M⋆ ∼ 107−108M⊙, and star-formation rates of SFR ∼ 0.1−1 M⊙ yr−1
. Our search finds no candidates
at 15 < z < 20, placing upper limits at these redshifts. We develop a forward modeling approach to
infer the properties of the evolving luminosity function without binning in redshift or luminosity that
marginalizes over the photometric redshift uncertainty of our candidate galaxies and incorporates the
impact of non-detections. We find a z = 12 luminosity function in good agreement with prior results,
and that the luminosity function normalization and UV luminosity density decline by a factor of ∼ 2.5
from z = 12 to z = 14. We discuss the possible implications of our results in the context of theoretical
models for evolution of the dark matter halo mass function.
The increased availability of biomedical data, particularly in the public domain, offers the opportunity to better understand human health and to develop effective therapeutics for a wide range of unmet medical needs. However, data scientists remain stymied by the fact that data remain hard to find and to productively reuse because data and their metadata i) are wholly inaccessible, ii) are in non-standard or incompatible representations, iii) do not conform to community standards, and iv) have unclear or highly restricted terms and conditions that preclude legitimate reuse. These limitations require a rethink on data can be made machine and AI-ready - the key motivation behind the FAIR Guiding Principles. Concurrently, while recent efforts have explored the use of deep learning to fuse disparate data into predictive models for a wide range of biomedical applications, these models often fail even when the correct answer is already known, and fail to explain individual predictions in terms that data scientists can appreciate. These limitations suggest that new methods to produce practical artificial intelligence are still needed.
In this talk, I will discuss our work in (1) building an integrative knowledge infrastructure to prepare FAIR and "AI-ready" data and services along with (2) neurosymbolic AI methods to improve the quality of predictions and to generate plausible explanations. Attention is given to standards, platforms, and methods to wrangle knowledge into simple, but effective semantic and latent representations, and to make these available into standards-compliant and discoverable interfaces that can be used in model building, validation, and explanation. Our work, and those of others in the field, creates a baseline for building trustworthy and easy to deploy AI models in biomedicine.
Bio
Dr. Michel Dumontier is the Distinguished Professor of Data Science at Maastricht University, founder and executive director of the Institute of Data Science, and co-founder of the FAIR (Findable, Accessible, Interoperable and Reusable) data principles. His research explores socio-technological approaches for responsible discovery science, which includes collaborative multi-modal knowledge graphs, privacy-preserving distributed data mining, and AI methods for drug discovery and personalized medicine. His work is supported through the Dutch National Research Agenda, the Netherlands Organisation for Scientific Research, Horizon Europe, the European Open Science Cloud, the US National Institutes of Health, and a Marie-Curie Innovative Training Network. He is the editor-in-chief for the journal Data Science and is internationally recognized for his contributions in bioinformatics, biomedical informatics, and semantic technologies including ontologies and linked data.
2. Classification Of Markers
Molecular Markers
Biochemical
Markers
DNA Based
Markers
Morphological
Markers
Marker is generally defined as an object used to indicate a
position, place, or route.
4. Morphological markers
These markers are often detectable by eye, by simple visual
inspection .These are Classical markers which are also known as
“naked eye polymorphism”.
Selected based on the experience of the breeder to correlate a
phenotypic trait with a trait of interest.
Examples of this type of marker include the presence or absence of
an awn, leaf sheath coloration, height, grain color, aroma of rice etc.
In well characterized crops like maize, tomato, pea, barley & wheat
tens or hundreds of genes that determine morphological traits have
been mapped to specific chromosome locations.
A best example is to use leaf tip necrosis(LTN) as a phenotypic
marker to predict the presence of durable rust resistance gene pair
Lr34/Yr18 in wheat.
Another example is to use pseudo black chaff seen on glumes &
below the nodes color as a morphological marker to predict the
presence of stem rust resistance gene Sr2 in wheat.
5. Molecular markers
• A sequence of DNA or protein that can be screened
to reveal key attributes of its state or composition
and thus used to reveal genetic variation
Also known as “Genetic Marker”.
Genetic markers are the sequences of DNA which
have been traced to specific location on the
chromosomes and associated with particular traits.
Molecular Markers are classified as:
1. Protein Based Markers/ Biochemical Markers
2. DNA Based Markers
6. Comparison of molecular & morphological
markers
Represent the actual
polymorphism of the phenotype
important for the breeder.
Generally scored quickly, simply
and without laboratory
equipments.
Influenced by environment,
Time consuming, require large
population.
Represent naturally occurring
polymorphism in DNA
sequence (i.e. base pair
deletion, substitution, addition
or patterns)
Generally scored in laboratory.
Comparatively less time
consuming and do not require
large population.
7. Protein based or Biochemical
markers
Isozymes analysis has been used for over 60 years for various research
purposes in biology, viz. to delineate phylogenetic relationships, to
estimate genetic variability and taxonomy, to study population genetics and
developmental biology, to characterization in plant genetic resources
management and plant breeding.
Isozymes were defined as structurally different molecular forms of an
enzyme with, qualitatively, the same catalytic function. Isozymes originate
through amino acid alterations, which cause changes in net charge, or the
spatial structure (conformation) of the enzyme molecules and also,
therefore, their electrophoretic mobility. After specific staining the isozyme
profile of individual samples can be observed.
Allozymes are allelic variants of enzymes encoded by structural genes.
Allelic variation can be detected by gel electrophoresis and subsequent
enzyme-specific stains that contain substrate for the enzyme.
8. Advantages:
• Allozyme analysis does not require DNA extraction or the
availability of sequence information, primers or probes,
they are quick and easy to use.
• Simple analytical procedures, allow some allozymes to be
applied at relatively low costs, depending on the enzyme
staining reagents used.
• Allozymes are codominant markers that have high
reproducibility. Zymograms (the banding pattern of
isozymes) can be readily interpreted in terms of loci and
alleles.
9. Disadvantages:
•The main weakness of allozymes is their relatively low
abundance and low level of polymorphism.
•Proteins with identical electrophoretic mobility (co-
migration) may not be homologous for distantly related
germplasm.
• Lastly, often allozymes are considered molecular markers
since they represent enzyme variants, and enzymes are
molecules. However, allozymes are in fact phenotypic
markers, and as such they may be affected by environmental
conditions. For example, the banding profile obtained for a
particular allozyme marker may change depending on the
type of tissue used for the analysis (e.g. root vs. leaf). This is
because a gene that is being expressed in one tissue might not
be expressed in other tissues. On the contrary molecular
markers, because they are based on differences in the DNA
sequence, are not environmentally influenced, which means
that the same banding profiles can be expected at all times for
10. DNA Based Markers
DNA marker = direct reflection of genotype.
“Any unique DNA sequence which can be used in DNA
hybridization, PCR or restriction mapping experiments
to identify target sequence.”
In 1980, variations in the pattern of DNA fragments
were observed , generated by restriction enzyme
digestion of genomic DNA , could be used as genetic
marker.
DNA-markers allow the breeder to introduce into their
cultivated plant only the gene(s) of interest from a
related species as compare to conventional breeding.
11. P1 x F1
P1 x P2
CONVENTIONAL BACKCROSSING
BC1
VISUAL SELECTION OF BC1 PLANTS THAT MOST
CLOSELY RESEMBLE RECURRENT PARENT
BC2
MARKER-ASSISTED BACKCROSSING
P1 x F1
P1 x P2
BC1
USE ‘BACKGROUND’ MARKERS TO SELECT PLANTS THAT
HAVE MOST RP MARKERS AND SMALLEST % OF
DONOR GENOME
BC2
12. Allow eliminating the undesired genomic regions in a
few generations .
Segregate as single genes.
Not affected by the environment.
DNA based markers are classified as:
1) Anonymous Markers
2) Defined Markers
Anonymous Markers:
“A cloned random DNA fragment whose function or
specific features are not known e.g. Microsatellites
and AFLP. These marker type generally measure
apparently neutral DNA variations.
13. Defined Marker OR Polymorphic marker:
“A defined marker may contain a gene or some other
specific features, e.g. restriction sites for cutting by
the restriction enzymes, etc.”
Polymorphism of DNA Marker:
“DNA markers representing polymorphism in the
actual base sequence of DNA.”
This can be represented by:
• Mutation at restriction site.
• Insertion or deletion between restriction sites.
• Mutations at single nucleotide.
• Changes in number of repeat unit between
restriction site or PCR primer sites.
14. Classification of Markers
Name of the technique Discoverer
A. Biochemical Markers Allozymes Tanksley and Orton
1983;Kephart1990; May 1992
B. Molecular Markers
i) Non-PCR based techniques
Restriction Fragment Length
Polymorphisms (RFLP)
Botstein et al. 1980; Neale
and Williams 1991
Minisatellites or Variable
Number of Tandem Repeats
(VNTR)
Jeffreys et al.. 1985
ii) PCR-based techniques
DNA sequencing
Multi-copy DNA, Internal
Transcribed Spacer regions of
nuclear ribosomal genes (ITS)
Takaiwa et al. 1985; Dillon et
al. 2001
Single-copy DNA, including
both introns and exons
Sanger et al. 1977; Clegg
1993a
15. Sequence Tagged Sites(STS) Microsatellites, Simple Sequence
Repeat (SSR), Short Tandem
Repeat (STR), Sequence Tagged
Microsatellite (STMS) or Simple
Sequence Length Polymorphism
(SSLP)
Litt and Lutty
(1989),Hearne et
al.
1992; Morgante
and Olivieri 1993;
Jarne and Lagoda
1996
Sequence Characterized Amplified
Region (SCAR)
Michelmore et al.
(1991); Martin et
al. (1991); Paran
and Michelmore
1993
Cleaved Amplified Polymorphic
Sequence
(CAPS)
Akopyanz et al.
1992; Konieczny
and
Ausubel 1993
Single-Strand Conformation
Polymorphism (SSCP)
Hayashi 1992
16. Denaturing Gradient Gel
Electrophoresis (DGGE)
Riedel et al. 1990
Thermal Gradient Gel
Electrophoresis (TGGE) Riesner et al.
1989
Heteroduplex Analysis (HDA) Perez et al. 1999;
Schneider et al.
1999
Denaturing High Performance
Liquid Chromatography (DHPLC)
Hauser et al.
1998; Steinmetz
et al.
2000; Kota et al.
2001
Multiple Arbitrary Amplicon
Profiling (MAAP)
Caetano-Anolles
1996; Caetano-
Anolles et al.
1992
Random Amplified Polymorphic
DNA
(RAPD)
Williams et al.
1990; Hadrys et
al. 1992
17. DNA Amplification Fingerprinting (DAF) Caetano-Anolles et al. 1991
Arbitrarily Primed Polymerase Chain Reaction (AP-PCR) Welsh and McClelland 1990;
Williams et al. 1990
Inter-Simple Sequence Repeat (ISSR) Zietkiewicz et al. 1994;
Godwin et al. 1997
Single Primer Amplification Reaction (SPAR) Staub et al. 1996
Directed Amplification of Minisatellites DNA
(DAMD)
Heath et al. 1993; Somers and
Demmon 2002
Amplified Fragment Length Polymorphism
(AFLP)
Vos et al. 1995
Selectively Amplified Microsatellite
Polymorphic Loci (SAMPL)
Witsenboer et al. 1997
18. Non- PCR or Hybridization
Based Markers
“The variation in the length of DNA fragments produced by
specific Restriction Endonucleases from genomic DNA s of
two or more individuals of a species is called hybridization
and markers produced by this technique are called
hybridization based molecular markers.”
This type of hybridization marker includes-
RFLP
19. “RFLP is restriction fragment length
polymorphism, which are variations in the DNA
sequence of an individual which may be detected
by Restriction Endonucleases, which cut the
double stranded DNA whenever they recognize a
highly specific oligonucleotide sequence or a
restriction site.”
RFLP
“ A molecular method of genetic
analysis that allows individuals to
be identified on the basis of
unique patterns of restriction
enzymes cutting in specific regions
of DNA. It is an application of
Southern Hybridization Procedure.
”
RFLP Analysis
20.
21. They are co- dominant.
Measure variation at the level of DNA sequence, not protein
sequence.
RFLP loci are very large so even very small segments of
chromosomes can be mapped and also study phylogenetic
relationship.
Very reliable for linkage analysis and for detecting coupling phase
of DNA molecules.
Disadvantages of RFLP-
Requires relatively very large amount of DNA.
Requirement of radioactive probe makes the analysis expensive
and hazardous.
They are not useful for detecting single base change or point
mutations.
It is time consuming, laborious, and expensive.
The level of polymorphism is low.
Advantages of RFLP-
22. Polymerase Chain Reaction (PCR)-
Based Markers
1.Random Amplified Polymorphic DNA(RAPD)
Developed by Welsh and McClelland In 1991
• RAPDs are DNA fragments amplified by the PCR using short synthetic primers
(generally 10 bp) of random sequence.
• The method is based on enzymatic amplification of target or random DNA
segments with arbitrary primers.
• In this reaction, a single species of primer anneals to the genomic DNA at two
different sites on complementary strands of DNA template. If these priming sites
are within an amplifiable range of each other, a discrete DNA product is formed
through thermo cyclic amplification. . On an average, each primer directs
amplification of several discrete loci in the genome, making the assay useful for
efficient screening of nucleotide sequence polymorphism between individuals.
• Amplified products (usually within the 0.5–5 kb size range) are separated on
agarose gels in the presence of ethidium bromide and view under ultraviolet
light (Jones et al. 1997) and presence and absence of band will be observed.
These polymorphisms are considered to be primarily due to variation in the
primer annealing sites.
23.
24. Advantages:
They are quick and easy to assay.
Because PCR is involved, only low quantities of template DNA are
required.
No sequence data for primer construction are needed.
RAPDs have a very high genomic abundance and are randomly
distributed throughout the genome.
Disadvantages:
Low reproducibility.
RAPD analyses generally require purified, high molecular weight DNA,
and precautions are needed to avoid contamination of DNA samples
because short random primers are used that are able to amplify DNA
fragments in a variety of organisms.
The inherent problems of reproducibility make RAPDs unsuitable
markers for transference or comparison of results among research
teams working in a similar species and subject.
RAPD markers are not locus-specific, band profiles cannot be
interpreted in terms of loci and alleles (dominance of markers), and
similar sized fragments may not be homologous.
25. AFLP(Amplified Fragment Length
Polymorphism)
Keygene 1990; Vos & Jabean 1993
• AFLP, is a technique based on the detection of genomic restriction
fragments by PCR amplification and can be used for DNAs of any
origin or complexity. The fingerprints are produced, without any
prior knowledge of sequence, using a limited set of generic
primers. AFLP procedure mainly involves 3 steps-
• (a) Restriction of DNA using a rare cutting and a commonly cutting
restriction enzyme simultaneously (such as MseI and EcoRI)
followed by ligation of oligonucleotide adapters, of defined
sequences including the respective restriction enzyme sites.
• (b) Selective amplifications of sets of restriction fragments, using
specifically designed primers. To achieve this, the 5' region of the
primer is made such that it would contain both the restriction
enzyme sites on either sides of the fragment complementary to the
respective adapters, while the 3' ends extend for a few arbitrarily
chosen nucleotides into the restriction fragments.
• (c) Gel analysis of the amplified fragments.
26.
27. Advantages & Disadvantages of
AFLP
• AFLP analysis depicts unique fingerprints regardless of the origin and
complexity of the genome. Most AFLP fragments correspond to unique
positions on the genome and hence can be exploited as landmarks in
genetic and physical mapping. AFLPs are extremely useful as tools for
DNA fingerprinting and also for cloning and mapping of variety-specific
genomic DNA sequences. Thus AFLP provides a newly developed,
important tool for a variety of applications.
• Advantages:
• • Fast
• • Relatively inexpensive
• • Highly variable
•
• Disadvantage:
• • Markers are dominant
• • Presence of a band could mean the individual is either homozygous
or heterozygous for the Sequence - can’t tell
28. Sequence Tagged Sites (STS):
In genomics, a sequence tagged site (STS) is a short DNA sequence that has a single
copy in a genome and whose location and base sequence are known. The DNA
sequence of an STS may contain repetitive elements, sequences that appear
elsewhere in the genome, but as long as the sequences at both ends of the site are
unique and conserved, researches can uniquely identify this portion of genome
using tools usually present in any laboratory.
Thus, in broad sense, STS include such markers as microsatellites (SSRs, STMS ),
SCARs, CAPs, and ISSRs
Main features of STS markers are given below.
1. STSs are short DNA sequences (200-500 nucleotide long).
2. STSs occur only once in the genome.
3. STS are detected by PCR in the presence of all other genomic sequences.
4. STSs are derived from cDNAs.
Advantages-
STSs are useful in physical mapping of genes.
This technique permits sharing of data across the laboratories.
It is a rapid and most specific technique than DNA hybridization techniques.
It has high degree of accuracy.
It can be automated.
Disadvantages:
Development of STS is a difficult task. It is time consuming and labour oriented
technique.
It require high technical skill.
29. SSR (Simple sequence repeat)
Simple sequence repeat or Microsatellites, also known as
Simple Sequence Repeats (SSRs) or Short Tandem Repeats
(STRs), are repeating sequences of 2-6 base pairs of DNA. It
is a type of Variable Number Tandem Repeat (VNTR).
Microsatellites are typically co-dominant.
Sequence
Primer
ACTGTCGACACACACACACACGCTAGCT (AC)7
TGACAGCTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACGCTAGCT (AC)8
TGACAGCTGTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACACACGCTAGCT (AC)10
TGACAGCTGTGTGTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACACACACACGCTAGCT (AC)12
TGACAGCTGTGTGTGTGTGTGTGTGTGTGTGCGATCGA
31. • Microsatellite sequences are especially suited to distinguish closely related
genotypes; because of their high degree of variability, they are, therefore,
favoured in population studies and for the identification of closely related
cultivars .
• Microsatellite polymorphism can be detected by Southern hybridization or PCR.
• Microsatellites, like minisatellites, represent tandem repeats, but their repeat
motifs are shorter (1–6 base pairs). If nucleotide sequences in the flanking
regions of the microsatellite are known, specific primers (generally 20–25 bp)
can be designed to amplify the microsatellite by PCR.
• Microsatellites and their flanking sequences can be identified by constructing a
small-insert genomic library, screening the library with a synthetically labelled
oligonucleotide repeat and sequencing the positive clones.
• Alternatively, microsatellite may be identified by screening sequence databases
for microsatellite sequence motifs from which adjacent primers may then be
designed. In addition, primers may be used that have already been designed for
closely related species.
• Polymerase slippage during DNA replication, or slipped strand mispairing, is
considered to be the main cause of variation in the number of repeat units of a
microsatellite, resulting in length polymorphisms that can be detected by gel
electrophoresis.
32.
33.
34. Advantage-
SSR markers tend to be highly polymorphic.
The genotyping throughput is high.
This is a simple PCR assay. Many SSR markers are multi-allelic and
highly polymorphic.
Most SSRs are co-dominant and locus specific.
No special equipment is needed for performing SSRs assays; however,
special equipment is needed for some assay methods,
Start-up costs are low for manual assay methods (once the markers
are developed). SSR assays can be performed using very small DNA
samples (~100 ng per individual).
SSR markers are easily shared between laboratories.
Disadvantages:
The development of SSRs is labor intensive
SSR marker development costs are very high
Start-up costs are high for automated SSR assay methods.
Developing PCR multiplexes is difficult and expensive.
Some markers may not multiplex.
35. • In human beings, 99.9 percent bases are same.
• Remaining 0.1 percent makes a person unique.
– Different attributes / characteristics / traits
• how a person looks,
• These variations can be:
– Harmless (change in phenotype)
– Harmful (diabetes, cancer, heart disease, Huntington's
disease, and hemophilia )
– Latent (variations found in coding and regulatory
regions, are not harmful on their own, and the change
in each gene only becomes apparent under certain
conditions e.g. susceptibility to lung cancer)
SNPs
(Single Nucleotide Polymorphisms)
36. • SNPs are found in
– coding and (mostly) non coding regions.
• Occur with a very high frequency
– about 1 in 1000 bases to 1 in 100 to 300 bases.
• The abundance of SNPs and the ease with which
they can be measured make these genetic variations
significant.
• SNPs close to particular gene acts as a marker for
that gene.
• SNPs in coding regions may alter the protein
structure made by that coding region.
37.
38. •In many organisms most polymorphisms result from changes in a
single nucleotide position (point mutations), has led to the
development of techniques to study single nucleotide polymorphisms
(SNPs).
•Analytical procedures require sequence information for the design of
allelespecific PCR primers or oligonucleotide probes.
•SNPs and flanking sequences can be found by library construction
and sequencing or through the screening of readily available sequence
databases.
•Once the location of SNPs is identified and appropriate primers
designed, one of the advantages they offer is the possibility of high
throughput automation
•SNP analysis may be useful for cultivar discrimination in crops where
it is difficult to find polymorphisms,
39. Advantages-
SNP markers are useful in gene mapping.
SNPs help in detection of mutations at molecular level.
SNP markers are useful in positional cloning of a mutant
locus.
SNP markers are useful in detection of disease causing
genes.
Disadvantages:
Most of the SNPs are bialleleic and less informative than
SSRs.
Multiplexing is not possible for all loci.
Some SNP assay techniques are costly.
Development of SNP markers is labour oriented.
More (three times) SNPs are required in preparing
genetic maps than SSR markers.
40. Diversity Array Technology (DArT)
high-throughput marker system
No sequence information is needed
DArT is based on microarray hybridizations
Detect the presence v/s absence of individual
fragments
Efficiently and economically scan from
hundreds to thousands of polymorphic
markers.
41. DArT technology consists of several
steps:
1. Complexity reduction of the DNA of interest
1. Library creation Microarraying libraries onto glass slides
2. Microarraying fragments onto glass slides
3. Hybridisation of fluoro-labelled DNA onto slides
4. Scanning of slides for hybridisation signal
5. Data analysis and extraction.
9
42. DArT operates on the principle that the genomic
'representation' contains two types of fragments:
• Constant fragments: found in any 'representation'
prepared from a DNA sample from an individual
belonging to a given species, and
• Variable (polymorphic): fragments called
molecular markers, only found in some but not all
of the 'representations'.
Principle of DArT
43.
44. Presence vs. absence in a genomic 'representation' is assayed by
hybridizing the 'representation' to a DArT array consisting of a
library of that species.
46. 2. Library creation
DNA amplification
Cloning
Library in E coli
13
Each colony contains one of the
fragments from the genomic
'representation'.
47. 3. Microarraying
Selection of clones
Arranged into a plate format
(usually 384-well plates)
Fragments within library
amplified
Spotted onto glass slides
14
Genotyping array
49. 5. scanning
The hybridised slides are Washed and processed
to remove unbound labelled DNA.
Then scanned using a scanner to detect
fluorescent signal emitted from the hybridised
fragments.
The result from each fluorescent channel is
recorded
The resulting images are stored in 'tif' format.
16
50. 6. Data analysis
The data from the scanned images is extracted and analysed
using the DArTsoft software and the information is managed
by the DArTdb Laboratory Information Management System.
17
52. Advantages of DArT technology
Marker density relevant to application
Sequence information and platform independence
High throughput due to a high level of multiplexing
Matching most cost-effective technology with the
application on modern platforms
19
53. DArT Applications
• Genome profiling and diversity analysis
• Genetic and physical mapping
• Identification of QTL
• Rapid introgression of genomic regions in accelerated
backcrossing programs
• Simultaneous marker-assisted selection for several
traits
• Genomic Selection
• Varietal identification of crops and genetic purity
testing
• Monitoring the composition of complex DNA samples
20
54. AN IDEAL MARKER SYSTEM
1) Highly polymorphic nature: It must be polymorphic as it is
polymorphism that is measured for genetic diversity
studies.
2) Codominant inheritance: Determination of homozygous and
heterozygous states of diploid organisms.
3) Frequent occurrence in genome: A marker should be evenly
and frequently distributed throughout the genome.
4) Selective neutral behaviors: The DNA sequences of any
organism are neutral to environmental conditions or
management practices.
5) Easy access (availability): It should be easy, fast and cheap
to detect.
6) Easy and fast assay
7) High reproducibility
8) Easy exchange of data between laboratories.