The document discusses various methods in molecular biology, including nucleic acid hybridization, DNA sequencing, real-time PCR, and DNA microarrays. Nucleic acid hybridization uses complementary base pairing between DNA or RNA probes and targets. DNA sequencing determines the nucleotide order using chain-terminating dideoxynucleotides. Real-time PCR quantifies DNA or RNA targets in real time using fluorescent probes. DNA microarrays allow analysis of gene expression patterns across thousands of genes.
This presentation is about the chromose structure, it's banding & painting. It includes the physical structure of chromosome, then karyotype & idiogram. Different types of chromosome banding & painting in details. FISH & GISH.
This Presentation will be helpful to undergraduate and postgraduate students of biology and biotechnology in understanding the significance of COT curves in determination of gene and genome complexity amoug various organisms
GENETICS
CYTOGENETICS
Definition of Linkage, Coupling and Repulsion hypothesis, Linkage group- Drosophila, maize and man, Types of linkage-complete linkage and incomplete linkage, Factors affecting linkage- distance between genes, age, temperature, radiation, sex, chemicals and nutrition, Significance of linkage.
The tendency of two or more genes to stay together (i.e., the co-existence of two or more genes) in the same chromosome during inheritance is known as LINKAGE. The linked genes are present on the same chromosome are said to be SYNTENIC. The linked genes do not show independent assortment.
LINKAGE v/s INDEPENDENT ASSORTMENT
The frequency of linkage or the strength recombination is influenced by several factors (agents).
Sanger sequencing is one of the DNA sequencing methods used to identify and determine the sequence (Nucleotide) of DNA .This is an enzymatic method of sequencing developed by Fred Sanger.
INTRODUCTION
Hybridization stages
probe synthesis
Probe marking
Target DNA processing
Target DNA denaturation
Target DNA transfer to solid carrier
Visualization
CONCLUSIONS
REFERENCES
This presentation is about the chromose structure, it's banding & painting. It includes the physical structure of chromosome, then karyotype & idiogram. Different types of chromosome banding & painting in details. FISH & GISH.
This Presentation will be helpful to undergraduate and postgraduate students of biology and biotechnology in understanding the significance of COT curves in determination of gene and genome complexity amoug various organisms
GENETICS
CYTOGENETICS
Definition of Linkage, Coupling and Repulsion hypothesis, Linkage group- Drosophila, maize and man, Types of linkage-complete linkage and incomplete linkage, Factors affecting linkage- distance between genes, age, temperature, radiation, sex, chemicals and nutrition, Significance of linkage.
The tendency of two or more genes to stay together (i.e., the co-existence of two or more genes) in the same chromosome during inheritance is known as LINKAGE. The linked genes are present on the same chromosome are said to be SYNTENIC. The linked genes do not show independent assortment.
LINKAGE v/s INDEPENDENT ASSORTMENT
The frequency of linkage or the strength recombination is influenced by several factors (agents).
Sanger sequencing is one of the DNA sequencing methods used to identify and determine the sequence (Nucleotide) of DNA .This is an enzymatic method of sequencing developed by Fred Sanger.
INTRODUCTION
Hybridization stages
probe synthesis
Probe marking
Target DNA processing
Target DNA denaturation
Target DNA transfer to solid carrier
Visualization
CONCLUSIONS
REFERENCES
Back to Basics: Fundamental Concepts and Special Considerations in gDNA Isola...QIAGEN
In this slidedeck, we provide tips for a whole range of sample types that require special consideration. Topics include the basic methods and challenges of RNA purification, special considerations for challenging sample types, and isolating miRNA and extracellular RNA.
2011 course on Molecular Diagnostic Automation - Part 2 - AmplificationPatrick Merel
2011 course on Molecular Diagnostic Automation - Part 2 - Amplification.
This is from early 2011. Prices and Specifications of instruments may have changed.
Part 2 of 3
DNA sequencing is the process of determining the nucleic acid sequence – the order of nucleotides in DNA. It includes any method or technology that is used to determine the order of the four bases: adenine, guanine, cytosine, and thymine.
DNA sequencing is the process of determining the nucleic acid sequence – the order of nucleotides in DNA. It includes any method or technology that is used to determine the order of the four bases: adenine, guanine, cytosine, and thymine. The advent of rapid DNA sequencing methods has greatly accelerated biological and medical research and discovery.
Knowledge of DNA sequences has become indispensable for basic biological research, DNA Genographic Projects and in numerous applied fields such as medical diagnosis, biotechnology, forensic biology, virology and biological systematics. Comparing healthy and mutated DNA sequences can diagnose different diseases including various cancers,characterize antibody repertoire, and can be used to guide patient treatment.[5Having a quick way to sequence DNA allows for faster and more individualized medical care to be administered, and for more organisms to be identified and cataloged.
The rapid speed of sequencing attained with modern DNA sequencing technology has been instrumental in the sequencing of complete DNA sequences, or genomes, of numerous types and species of life, including the human genome and other complete DNA sequences of many animal, plant, and microbial species.
The first DNA sequences were obtained in the early 1970s by academic researchers using laborious methods based on two-dimensional chromatography. Following the development of fluorescence-based sequencing methods with a DNA sequencer, DNA sequencing has become easier and orders of magnitude faster.
DNA sequencing refers to the general laboratory technique for determining the exact sequence of nucleotides, or bases, in a DNA molecule. The sequence of the bases (often referred to by the first letters of their chemical names: A, T, C, and G) encodes the biological information that cells use to develop and operate.Whole Genome Sequencing
•Allows doctors to closely analyze a patient's genes for mutations and health indicators.
•Can detect intellectual disabilities and developmental delays.
•WGS is currently available at Yale for patients in the NICU and PICU.
•Involves Genetics.Sequencing may be utilized to determine the order of nucleotides in small targeted genomic regions or entire genomes. Illumina sequencing enables a wide variety of applications, allowing researchers to ask virtually any question related to the genome, transcriptome, or epigenome of any organism.The spectrum of analysis of NGS can extend from a small number of genes to an entire genome, depending on the goal. Whole-genome sequencing (WGS) and whole-exome sequencing (WES) provide the sequence of DNA bases across the genome and exome, respectively.Capillary electrophoresis (CE) instruments are capable of performing both Sanger sequencing and fragment analysis. Fragment analysis is a method in which DNA fragments are fluorescently labeled, separated by CE, and sized by comparison to an internal standard. sanger and Maxam-Gilbert sequencing technologies were classified
DNA consists of a linear string of nucleotides, or bases, for simplicity, referred to by the first letters of their chemical names--A, T, C and G. The process of deducing the order of nucleotides in DNA is called DNA sequencing. Since the DNA sequence confers information that the cell uses to make RNA molecules and proteins, establishing the sequence of DNA is key for understanding how genomes work. The technology for DNA sequencing was made faster and less expensive as a part of the Human Genome Project. And recent developments have profoundly increased the efficiency of DNA sequencing even further.
A DNA library is a collection of cloned restriction fragments of the DNA of an organism.
Two kinds of libraries will be discussed: genomic libraries and complementary DNA (cDNA) libraries.
Genomic libraries ideally contain a copy of every DNA nucleotide sequence in the genome.
In contrast, cDNA libraries contain those DNA sequences that appear as mRNA molecules, and these differ from one cell type to another.
The Roman Empire A Historical Colossus.pdfkaushalkr1407
The Roman Empire, a vast and enduring power, stands as one of history's most remarkable civilizations, leaving an indelible imprint on the world. It emerged from the Roman Republic, transitioning into an imperial powerhouse under the leadership of Augustus Caesar in 27 BCE. This transformation marked the beginning of an era defined by unprecedented territorial expansion, architectural marvels, and profound cultural influence.
The empire's roots lie in the city of Rome, founded, according to legend, by Romulus in 753 BCE. Over centuries, Rome evolved from a small settlement to a formidable republic, characterized by a complex political system with elected officials and checks on power. However, internal strife, class conflicts, and military ambitions paved the way for the end of the Republic. Julius Caesar’s dictatorship and subsequent assassination in 44 BCE created a power vacuum, leading to a civil war. Octavian, later Augustus, emerged victorious, heralding the Roman Empire’s birth.
Under Augustus, the empire experienced the Pax Romana, a 200-year period of relative peace and stability. Augustus reformed the military, established efficient administrative systems, and initiated grand construction projects. The empire's borders expanded, encompassing territories from Britain to Egypt and from Spain to the Euphrates. Roman legions, renowned for their discipline and engineering prowess, secured and maintained these vast territories, building roads, fortifications, and cities that facilitated control and integration.
The Roman Empire’s society was hierarchical, with a rigid class system. At the top were the patricians, wealthy elites who held significant political power. Below them were the plebeians, free citizens with limited political influence, and the vast numbers of slaves who formed the backbone of the economy. The family unit was central, governed by the paterfamilias, the male head who held absolute authority.
Culturally, the Romans were eclectic, absorbing and adapting elements from the civilizations they encountered, particularly the Greeks. Roman art, literature, and philosophy reflected this synthesis, creating a rich cultural tapestry. Latin, the Roman language, became the lingua franca of the Western world, influencing numerous modern languages.
Roman architecture and engineering achievements were monumental. They perfected the arch, vault, and dome, constructing enduring structures like the Colosseum, Pantheon, and aqueducts. These engineering marvels not only showcased Roman ingenuity but also served practical purposes, from public entertainment to water supply.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Students, digital devices and success - Andreas Schleicher - 27 May 2024..pptxEduSkills OECD
Andreas Schleicher presents at the OECD webinar ‘Digital devices in schools: detrimental distraction or secret to success?’ on 27 May 2024. The presentation was based on findings from PISA 2022 results and the webinar helped launch the PISA in Focus ‘Managing screen time: How to protect and equip students against distraction’ https://www.oecd-ilibrary.org/education/managing-screen-time_7c225af4-en and the OECD Education Policy Perspective ‘Students, digital devices and success’ can be found here - https://oe.cd/il/5yV
Ethnobotany and Ethnopharmacology:
Ethnobotany in herbal drug evaluation,
Impact of Ethnobotany in traditional medicine,
New development in herbals,
Bio-prospecting tools for drug discovery,
Role of Ethnopharmacology in drug evaluation,
Reverse Pharmacology.
This is a presentation by Dada Robert in a Your Skill Boost masterclass organised by the Excellence Foundation for South Sudan (EFSS) on Saturday, the 25th and Sunday, the 26th of May 2024.
He discussed the concept of quality improvement, emphasizing its applicability to various aspects of life, including personal, project, and program improvements. He defined quality as doing the right thing at the right time in the right way to achieve the best possible results and discussed the concept of the "gap" between what we know and what we do, and how this gap represents the areas we need to improve. He explained the scientific approach to quality improvement, which involves systematic performance analysis, testing and learning, and implementing change ideas. He also highlighted the importance of client focus and a team approach to quality improvement.
3. Hybridization of nucleid acids Doublestrand DNA High temperature High pH Temperature decrease, Decreasing The pH Level Denaturation - double-stranded deoxyribonucleotic acid unwinds and separates into single-stranded strands through the breaking of hydrogen bonding between the bases DNA pair by hydrogen bonds to a complementary sequence, forming a double - stranded polynucleotide
4.
5.
6. Hybridization of nucleid acids was used for prenatal diagnosis normal globin sickle-cell globin normal protein mutated protein protein patients
10. DNA microarray (=DNA Chip) Any cells expresses, at any one time, many hundreds or even thousands of genes. Some of products are expressed at high level (e.g. actin) while others may only be expressed in a few copies. Expresion of different sets of genes Trying to identify these differences is important field of research. Different stages of maturation tumor cell vs. normal cell
11.
12.
13.
14.
15.
16.
17. DNA sequencing DNA sequencing is the process of determining the nucleotide order of a given DNA fragment . There are two methods of DNA sequencing: Chemical method –has been devised by Allan Maxam and Walter Gilbert . (Dideoxy) method was developed by Frederick Sanger and colleagues in 1977. Now it is used more frequently than Maxam-Gilbert method. Walter Gilbert a Frederick Sanger w ere awarded the 1980 Nobel Prize in Chemistry . Walter Gilbert Frederick Sanger
18. First step is DNA denaturation. So, we obtain single strand DNA. Labeld synthetic deoxyribonucleotide primer is hybridized to the single strand of the DNA in the next step. Then, the primer is elongated in four separate reaction mixtures containing the four normal deoxyribonucleoside triphospates (dNTPs) plus one of the four dideoxyribonucleoside triphospates (ddNTPs) in a ratio of 100 to 1. A ddNTP molecule can add at the position of the corresponding normal dNTP, but when this occurs, chain e longation stops because the ddNTP lacks a 3′ hydroxyl. In time, each reaction mixture will contain a mixture of prematurely terminated chains ending at every occurrence of the ddNTP . The oligonucleotide primer is extended using a T7 DNA p olymerase from the 5'- end of the primer. "G" tube : all 4 dNTP, ddGTP and DNA polymerase "A„ tube: all 4 dNTP, ddATP and DNA polymerase "T„ tube: all 4 dNTP, ddTTP and DNA polymerase "C„ tube: all 4 dNTP, ddCTP and DNA polymerase
19. ddNTP <<< dNTP 1 : 100 Normal deoxyribonucleoside triphospates (dNTPs) plus one of the four dideoxyribonucleoside triphospates (ddNTPs) in a ratio of 100 to 1 is beacuse of the gradual termination of the sequencing reaction.
20. Structure of a dideoxynucleotide (in this example ddCTP ) (in this example dCTP ) N ote that the hydroxyl group which is attached to carbon 3′ in normal nucleotides is replaced by a hydrogen atom. Structure of a nucleotide
21. The enzyme makes no distinction between dNTPs and ddNTPs. Each time the ddNTP is incorporated, the synthesis stop. Because a lot of DNA molecules are present in the test tube, the strand can be terminated at any G position. "G" tube
22. Conventional D NA sequencing. This generally involves using a radioactively labeled nucleotide and size-fractionation of the products of the four reactions in separate wells of a p olyacrylamide gel. The dried gel is submitted to au toradiography, allowing the sequence of the c omplementary strand to be read (from bottom to top). The bottom panel illustrates a practical example, in this case a sequence within the gene for type II neurofibromatosis.
23. stops DNA synthesis Newly synthetized DNA strand What do the bands in the gel mean? PAGE electrophoresis of the "G" reaction
24. The sequence of the original DNA template strand can be read directly from the resuling autoradiography. 3´- CTTACAGGAAAGAGATTC AGGATTCAGGAGGCCTACCATGAA We wanted to know this sequence
25. Separation of terminated fragments is common for all nucleotides The mixture of terminated fragment is subjected to gel electrophoresis in parallel
26. An alternative to the labelling of the primer is to label the terminators instead, commonly called 'dye terminator sequencing'. The major advantage of this approach is the complete sequencing set can be performed in a single reaction, rather than the four needed with the labeled-primer approach. This is accomplished by labelling each of the dideoxynucleotide chain-terminators with a separate fluorescent dye, which fluoresces at a different wavelength. M ore commonly now , fragments are then size-separated in a narrow glass tube (capillary) filled with a viscous polymer instead of electrophoresis in a slab polyacrylamide gel . The gel is placed into a DNA sequencer for electrophoresis and analysis. Each fragment is detected as it passes a laser beam at the bottom of the gel. Each type of ddNTP emits colored light of a characteristic wavelength and it is recorded as a colored band on a stimulated gel image.
27. The gel is placed into a DNA sequencer for electrophoresis and analysis. Each fragment is detected as it passes a laser beam at the bottom of the gel. Each type of ddNTP emits colored light of a characteristic wavelength and it is recorded as a colored band on a stimulated gel image. DNA sequencer
28. The computer program interprets the raw data and outputs an electropherogram with colored peaks representing each letter in the sequence
50. Black line indicate product with lower melting temperature Tm (81 0 C) than the other products Tm (89 0 C) Melting curve analysis This peak corresponds to one band in the agarose gel.
51.
52.
53.
54.
55.
56. MLPA – multiplex ligation probe assay We can detect long deletions, insertions, duplications and amplifications, known mutations and we could use this method for quantification of mRNA Principle : uses probes designed to hybridize adjacently to the target sequence. After ligation, the joined probes are amplified and quantified example of using of MLPA : we can detect BRCA1 and BRCA2 mutations in hereditary breast cancers
57.
58.
59. Principle of MLPA. For each specific target, a set of two probes was designed that hybridize immediately adjacent to each other on the same target strand. Both probes consist of a short (22–43 nt) target-specific sequence and a universal forward or reverse PCR primer-binding site. In addition, one of the probes contains a so-called stuffer sequence. For each probe, the stuffer part has a specific length (19–364 bp) and sequence. The long probes are M13-derived. The short probes are synthetic. After an overnight hybridization to the target DNA, the two parts of each hybridized probe are joined by a ligation reaction. Next, a PCR is carried out with a single fluorescent-labeled primer pair, which ensures that the relative yield of the PCR products is proportional to the amount of target. The fragment analysis is preferably carried out on an automated capillary sequencer. The multiple fragments can be distinguished based on different length. The peak area value of each product is used to calculate the relative quantity.
60. Pyrosequencing Dideoxy DNA sequencing - 96 samples at a time ~ 30 -60 kb of sequence per 3-4 hour electrophoretic run - require electrophoresis Pyrosequencing – is able to monitor incorporation of each nucleotide in the growing DNA chain and to identify which nucleotide was being incorporated at each step.
61. DNA chains are synthesized from dNTP precursors DNA polymerase reaction causes cleavage between the and phosphates dNMP (containing phosphate) is incorporated into DNA , leaving behind a pyrophospate (containing and hosphate) Unused dNTPs and excess ATP are degraded by the enzyme apyrase (included in reaction mixture). If selected dNTP is not needed it will be degaraded and no light is produce .
62. A ) DNA polymerase synthetizes a DNA chain by using a single-stranded DNA template and fourth Normal dNTPs. Instead of having a mixture of the four dNTPs, the individual dNTPs are provided sequentialy. When the correct dNTP is provided, the incorporation of the dNMP nucleotide is tracked by the simultaneous production of a pyrophosphate (Ppi) group that is used to produce light. Incorrect dNTP is degradated by the enzyme apyrase. B) The insertion of the correct base is monitored by light p roduction in a a two-step reaction. The released Ppi is used by the enzyme ATP sulfur y lase to generate ATP, which in turn drives a luciferase reaction to produce light, as detected by a charge-coupled device (CCD) camera.
63.
64. 454 pyrosequencing DNA is break into short fragments (300-500 bp) and preparing single-stranded templates. Two different oligonucleotide adaptors are ligated to the ends of DNA fragments (adaptors provide universal priming sequences for amplification). Single stranded DNA templates are immobilized on beads and beads are separated from each other by creating an oil-water emulsion. Each droplet contains a single bead and the reagents needed for PCR. After PCR there are 10 milion copies of one DNA fragment on one bead. biotin streptavidin
65. Simultaneous sequencing of the entire genome in hundreds of thousands of picoliter- Size wells The emulsion is then broken to release the beads. The beads are deposited into picoliter wells on a slide (one bead per well) that are then layered with smaller beads that have ATP sulfurylase and luciferase attached to their surface. A fixed sequešnce of the dNTPs precursors (t, then A, then C, then G) is washed over the beads and chemiluminiscent light is emited each time a nucleotide is incorporated.
68. '3 rd generation' ('next-next-generation') sequencing is knocking on the door. It permit the sequencing of single DNA molecules that are not amplified any way (Helicos Bioscience company) technology Read length Amount per 1 run Price for 1 kb Sanger 1000 bp 36 KB 10 USD 454 400 -500 bp 0,5GB 0.2 USD Solid 50bp 180GB Illumina 75bp 20GB 0.04 USD