This document describes using green fluorescent protein (GFP) to study protein-protein interactions. GFP from jellyfish has properties that make it useful for this, such as fluorescence and stability. The document discusses fusing GFP to proteins of interest to monitor their interactions. Specifically, it examines fusing GFP to the S-peptide and S-protein fragments of the ribonuclease protein. It describes constructing and purifying these GFP fusion proteins, then using gel retardation and fluorescence polarization assays to measure the interactions and determine binding constants. The assays allow quantifying the fraction of proteins bound versus unbound to study protein binding.
protein structure prediction methods. homology modelling, fold recognition, threading, ab initio methods. in short and easy form slides. after one time read you can easily understand methods for protein structure prediction.
This is technique used widely for protein separation from a mixture and is very easy and less costly method. Slides cover all essential points about EMSA and it is quite interesting to know that how it detect and separate different proteins and their mobility shift assay.
Protein docking is used to check the structure, position and orientation of a protein when it interacts with small molecules like ligands. Protein receptor-ligand motifs fit together tightly, and are often referred to as a lock and key mechanism. There are both high specificity and induced fit within these interfaces with specificity increasing with rigidity. The foremost thing that we need to start with a docking search is the sequence of our protein of interest. (Halperin et al., 2002).
Protein-protein interactions occur between two proteins that are similar in size. The interface between the two molecules tends to be flatter and smoother than those in interfaces of these interactions do not have the ability to alter protein-ligand interactions. Protein-protein interactions are usually more rigid, the conformation in order to improve binding and ease movement. (Smith and Sternberg, 2002).
The process of drug development has revolved around a screening approach, as nobody knows which compound or approach could serve as a drug or therapy. Such almost blind screening approach is very time-consuming and laborious. The goal of structure-based drug design is to find chemical structures fitting in the binding pocket of the receptor. Based on the three-dimensional structure of the target protein, it can automatically build ligand molecules within the binding pocket and subsequently screen them (Weil et al., 2004).
A homology model of the housefly voltage-gated sodium channel was developed to predict the location of binding sites for the insecticides fenvalerate, a synthetic pyrethroid, and DDT, an early generation organochlorine. The model successfully addresses the state-dependent affinity of pyrethroid insecticides. (O’Reilly et al., 2006).
protein structure prediction methods. homology modelling, fold recognition, threading, ab initio methods. in short and easy form slides. after one time read you can easily understand methods for protein structure prediction.
This is technique used widely for protein separation from a mixture and is very easy and less costly method. Slides cover all essential points about EMSA and it is quite interesting to know that how it detect and separate different proteins and their mobility shift assay.
Protein docking is used to check the structure, position and orientation of a protein when it interacts with small molecules like ligands. Protein receptor-ligand motifs fit together tightly, and are often referred to as a lock and key mechanism. There are both high specificity and induced fit within these interfaces with specificity increasing with rigidity. The foremost thing that we need to start with a docking search is the sequence of our protein of interest. (Halperin et al., 2002).
Protein-protein interactions occur between two proteins that are similar in size. The interface between the two molecules tends to be flatter and smoother than those in interfaces of these interactions do not have the ability to alter protein-ligand interactions. Protein-protein interactions are usually more rigid, the conformation in order to improve binding and ease movement. (Smith and Sternberg, 2002).
The process of drug development has revolved around a screening approach, as nobody knows which compound or approach could serve as a drug or therapy. Such almost blind screening approach is very time-consuming and laborious. The goal of structure-based drug design is to find chemical structures fitting in the binding pocket of the receptor. Based on the three-dimensional structure of the target protein, it can automatically build ligand molecules within the binding pocket and subsequently screen them (Weil et al., 2004).
A homology model of the housefly voltage-gated sodium channel was developed to predict the location of binding sites for the insecticides fenvalerate, a synthetic pyrethroid, and DDT, an early generation organochlorine. The model successfully addresses the state-dependent affinity of pyrethroid insecticides. (O’Reilly et al., 2006).
Homology modeling, also known as comparative modeling of protein, refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental three-dimensional structure of a related homologous protein.
Prediction of the three dimensional structure of a given protein sequence i.e. target protein from the amino acid sequence of a homologous (template) protein for which an X-ray or NMR structure is available based on an alignment to one or more known protein structures
What constitutes structural bioinformatics and 2 example areas from our own work - studying evolution using structure and what really happens when we take a drug. Presented to UCSD medical students in years 1-3
it will help you to understand how the protein microarrays are made, what are the different types and what all purposes they are used for. its very useful ppt
Introduction to Applications of Proteomics Science,
Proteomics- Techniques, Applications of proteomics
Presented by
A. Harsha Vardhan Naidu
Department of Pharmacology
Functional proteomics, methods and toolsKAUSHAL SAHU
INTRODUCTION
HISTORY
DEFINITION
PROTEOMICS
FUNCTIONAL PROTEOMICS
PROTEOMICS SOFTWARE
PROTEOMICS ANALYSIS
TOOLS FOR PROTEOM ANALYSIS
DIFFERENTS METHODS FOR STUDY OF FUNCTIONAL PROTEOMICS
APLLICATIONS
LIMITATIONS
CONCLUSION
Homology modeling, also known as comparative modeling of protein, refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental three-dimensional structure of a related homologous protein.
Prediction of the three dimensional structure of a given protein sequence i.e. target protein from the amino acid sequence of a homologous (template) protein for which an X-ray or NMR structure is available based on an alignment to one or more known protein structures
What constitutes structural bioinformatics and 2 example areas from our own work - studying evolution using structure and what really happens when we take a drug. Presented to UCSD medical students in years 1-3
it will help you to understand how the protein microarrays are made, what are the different types and what all purposes they are used for. its very useful ppt
Introduction to Applications of Proteomics Science,
Proteomics- Techniques, Applications of proteomics
Presented by
A. Harsha Vardhan Naidu
Department of Pharmacology
Functional proteomics, methods and toolsKAUSHAL SAHU
INTRODUCTION
HISTORY
DEFINITION
PROTEOMICS
FUNCTIONAL PROTEOMICS
PROTEOMICS SOFTWARE
PROTEOMICS ANALYSIS
TOOLS FOR PROTEOM ANALYSIS
DIFFERENTS METHODS FOR STUDY OF FUNCTIONAL PROTEOMICS
APLLICATIONS
LIMITATIONS
CONCLUSION
Fluorescence recovery after photobleaching commonly called FRAP is one of the most cutting edge technologies that has turned the world of protein around.Click to know more
Applications of protein array in diagnostics and genomic and proteomicSusan Rey
icroarray technology can simultaneously analyze thousands of parameters in a single experiment. Micro-point of capture molecules are fixed into ranks on a solid support and exposed to samples containing corresponding binding molecules. Complex formation in each micro-point can be detected by the readout system, which is based on fluorescence, chemiluminescence, mass spectrometry, radioactive or electrochemistry. Miniaturization and parallelization binding assays, whose analysis power can be also enlarged by microarray gene expression analysis, is sensitive. These systems can be used to detect the degree of hybridization and immobilized DNA microarray probes will be exposed to complementary target. Currently, the development of protein array has demonstrated its applications in enzyme-substrate, DNA- protein and different types of protein - protein interactions. In this post, we will discuss the capture-molecule-ligand analysis, analyze its theoretical advantages and disadvantage and its influence in diagnostics, genomic and proteomics.
Applications of protein array in diagnostics and genomic and proteomicSusan Rey
Microarray technology can simultaneously analyze thousands of parameters in a single experiment. Micro-point of capture molecules are fixed into ranks on a solid support and exposed to samples containing corresponding binding molecules. Complex formation in each micro-point can be detected by the readout system, which is based on fluorescence, chemiluminescence, mass spectrometry, radioactive or electrochemistry. Miniaturization and parallelization binding assays, whose analysis power can be also enlarged by microarray gene expression analysis, is sensitive. These systems can be used to detect the degree of hybridization and immobilized DNA microarray probes will be exposed to complementary target. Currently, the development of protein array has demonstrated its applications in enzyme-substrate, DNA- protein and different types of protein - protein interactions. In this post, we will discuss the capture-molecule-ligand analysis, analyze its theoretical advantages and disadvantage and its influence in diagnostics, genomic and proteomics.
Yeast two-hybrid is based on the reconstitution of a functional transcription factor (TF) when two proteins or polypeptides of interest interact. Upon interaction between the bait and the prey, the DBD and AD are brought in close proximity and a functional TF is reconstituted upstream of the reporter gene.
Protein protein interaction, functional proteomicsKAUSHAL SAHU
IntroductionTypes of Protein-protein interactionsEffects of Protein-Protein InteractionsProtein-Protein Interaction Identification Methods :- Experimental (In vivo) Yeast two hybrid system- Experimental (In vitro) Co-immunoprecipitation, ChIP, Affinity Blotting, Protein Probing - Computational (In silico) Database of interacting proteins, VisANT etc.
ConclusionReferences
Brief Introduction of Protein-Protein Interactions (PPIs)Creative Proteomics
For more information, please visit https://www.creative-proteomics.com/services/protein-protein-interaction-networks.htm. Protein-protein interactions play important roles in various biological processes. PPIs can be classified based on different factors, including composition, affinity, and lifetime.
For more information, you can visit https://www.creative-proteomics.com/services/protein-post-translational-modification-analysis.htm. In this video, we introduce some commonly used methods to detect PPIs and techniques for proteome-scale interactome maps.
Introduction.
Types of Protein – Protein Interaction.
Methods to investigate Protein – Protein Interaction.
Protein – Protein Interaction modulated by Chemical energy.
Two Hybrid Screening.
Overview of Protein – Protein Interaction analysis.
Biological effect of Protein – Protein interaction.
Conclusion.
Reference.
Potenciales analgésicos obtenidos a partir de toxinas de moluscos gasterópodosNelson Giovanny Rincon S
El dolor es una experiencia sensorial y emocional desagradable que pueden experimentar todos los seres vivos que disponen de un sistema nervioso central
Activated carbon was prepared from lignocellulosic
material (Eucalyptus Globulus labill seed) by
chemical activation with ZnCl2 at two different concentrations
(10 and 25 % m/v) named ACS25 and ACS10. The
textural characteristics of the activated carbons (ACs) were
determined by N2 adsorption isotherms; these exhibit
B.E.T. surface areas of 250 and 300 m2 g-1 for ACS25 and
ACS10, respectively, with micropore volume contents of
0.140 and 0.125 cm3 g-1 in the same order. In addition, the
FTIR and Boehm methods were conducted for the chemical
characterisation of ACs, where many groups with basic
character were found, which favours the adsorption of
phenols. The prepared carbonaceous adsorbents were used
in the adsorption of wide pollutants monosubstituted phenol
derivatives: phenol, 4-nitrophenol and 4-chlorophenol.
The effect of temperature on the thermodynamics, kinetic
and equilibrium of phenols adsorption on ACs was thoroughly
examined. The adsorption kinetics adjusted properly
for a pseudo-second-order kinetic model. However, the
Elovich model (chemisorption) confirms that phenols
adsorption did not occur via the sharing of electrons
between the phenolic ring and basal plane of ACs because
is not properly adjusted, so the process is given by
physisorption. The thermodynamic parameters [i.e. Gibbs
free energy change (DG), enthalpy change (DH) and
entropy change (DS)] were also evaluated.
Envenenamiento por mordedura de serpiente: Impacto general en Colombia y el M...Nelson Giovanny Rincon S
Los accidentes ofídicos u ofidismo (envenenamiento por mordedura de serpientes) es un problema importante a nivel mundial. Aun así, es difícil conocer el número exacto de mordeduras por serpientes venenosas en el mundo. Estos accidentes representan un serio problema de salud pública en los países tropicales. La Organización Mundial de la Salud estima que hay cinco millones de mordeduras por serpientes anualmente en el mundo con 125000 fallecimientos. Siendo Asia, principalmente la India, Pakistán y Birmania, donde ocurren el 80 % de todas las defunciones, mientras Estados Unidos reporta el 8 % y Sudamérica con cerca del 10 % de la cifra mundial
Thermodynamic Study of Adsorption of Phenol, 4-Chlorophenol, and 4-Nitropheno...Nelson Giovanny Rincon S
Activated carbons from shell eucalyptus (Eucalyptus globulus) were prepared by chemical activation through impregnation with solutions of two activators: sulfuric acid and sodium hydroxide, the surface areas for activated carbons with base were 780 and 670 m2 g−1 and the solids activated with acid were 150 and 80 m2 g−1. These were applying in adsorption of priority pollutants: phenol, 4-nitrophenol, and 4-chlorophenol from aqueous solution. Activated carbon with the highest adsorption capacity has values of 2.12, 2.57, and 3.89 on phenol, 4-nitrophenol, and 4-chlorophenol, respectively.
Actualmente, uno de los mayores desafíos que afronta la humanidad es encontrar nuevas fuentes de energía, debido al escaso rendimiento de las energías provenientes de combustibles fósiles, los problemas ambientales que estas causan y su elevado consumo, que amenaza con agotarlas. Por ello, es necesario buscar nuevas fuentes de energía para satisfacer la demanda energética que deriva del desarrollo de la humanidad
Obtención de carbones activados a partir de semillas de eucalipto, por activa...Nelson Giovanny Rincon S
Activated carbons were prepared from shell Eucalyptus (Eucalyptus globulus Labil) by chemical activation using as activating
agent solutions of phosphoric acid, at two different concentrations; 30 and 80% v/v. Carbons were texturally characterized by
N2 physisorption, the apparent surface area was determined by B.E.T., method, values obtained were 2009 and 1027 m2 g-1.
Dubinin-Radushkevich equation was used to obtain the micropore volume with values of 0.65 and 0.32 cm3 g-1. Boehm method
established that the carbons are acidic aspect confirmed by determining the point of zero charge. Solid energetic interactions
against HCl and NaOH solutions were established by immersion calorimetry finding great correlation with the content of acidic
and basic groups of the solids. Finally, the adsorption capacity of the solid was evaluated with phenol from aqueous solution
since this is a priority pollutant, where high adsorption capacity of the two carbons was evident due to the large surface area,
micropore volume and surface chemistry of solids.
Síntesis de carbón activado proveniente de semillas de Eucalipto por activaci...Nelson Giovanny Rincon S
This research synthesized and characterized activated
carbons from Eucalyptus seed husk (Eucalyptus globulus
Labill), using chemical activation with H3PO4 as a dehydrating
agent and physical activation with CO2 as the oxidizing
agent. Texturally characterized carbons using nitrogen adsorption isotherms at 77K, using the method of the
apparent area, BET Dubinin and Radushkevich method for
the volume of micropores, besides chemically characterized
by Boehm titrations, infrared spectroscopy and pH
at the point of zero charge.
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Sérgio Sacani
Since volcanic activity was first discovered on Io from Voyager images in 1979, changes
on Io’s surface have been monitored from both spacecraft and ground-based telescopes.
Here, we present the highest spatial resolution images of Io ever obtained from a groundbased telescope. These images, acquired by the SHARK-VIS instrument on the Large
Binocular Telescope, show evidence of a major resurfacing event on Io’s trailing hemisphere. When compared to the most recent spacecraft images, the SHARK-VIS images
show that a plume deposit from a powerful eruption at Pillan Patera has covered part
of the long-lived Pele plume deposit. Although this type of resurfacing event may be common on Io, few have been detected due to the rarity of spacecraft visits and the previously low spatial resolution available from Earth-based telescopes. The SHARK-VIS instrument ushers in a new era of high resolution imaging of Io’s surface using adaptive
optics at visible wavelengths.
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...University of Maribor
Slides from:
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Track: Artificial Intelligence
https://www.etran.rs/2024/en/home-english/
Richard's entangled aventures in wonderlandRichard Gill
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
Introduction:
RNA interference (RNAi) or Post-Transcriptional Gene Silencing (PTGS) is an important biological process for modulating eukaryotic gene expression.
It is highly conserved process of posttranscriptional gene silencing by which double stranded RNA (dsRNA) causes sequence-specific degradation of mRNA sequences.
dsRNA-induced gene silencing (RNAi) is reported in a wide range of eukaryotes ranging from worms, insects, mammals and plants.
This process mediates resistance to both endogenous parasitic and exogenous pathogenic nucleic acids, and regulates the expression of protein-coding genes.
What are small ncRNAs?
micro RNA (miRNA)
short interfering RNA (siRNA)
Properties of small non-coding RNA:
Involved in silencing mRNA transcripts.
Called “small” because they are usually only about 21-24 nucleotides long.
Synthesized by first cutting up longer precursor sequences (like the 61nt one that Lee discovered).
Silence an mRNA by base pairing with some sequence on the mRNA.
Discovery of siRNA?
The first small RNA:
In 1993 Rosalind Lee (Victor Ambros lab) was studying a non- coding gene in C. elegans, lin-4, that was involved in silencing of another gene, lin-14, at the appropriate time in the
development of the worm C. elegans.
Two small transcripts of lin-4 (22nt and 61nt) were found to be complementary to a sequence in the 3' UTR of lin-14.
Because lin-4 encoded no protein, she deduced that it must be these transcripts that are causing the silencing by RNA-RNA interactions.
Types of RNAi ( non coding RNA)
MiRNA
Length (23-25 nt)
Trans acting
Binds with target MRNA in mismatch
Translation inhibition
Si RNA
Length 21 nt.
Cis acting
Bind with target Mrna in perfect complementary sequence
Piwi-RNA
Length ; 25 to 36 nt.
Expressed in Germ Cells
Regulates trnasposomes activity
MECHANISM OF RNAI:
First the double-stranded RNA teams up with a protein complex named Dicer, which cuts the long RNA into short pieces.
Then another protein complex called RISC (RNA-induced silencing complex) discards one of the two RNA strands.
The RISC-docked, single-stranded RNA then pairs with the homologous mRNA and destroys it.
THE RISC COMPLEX:
RISC is large(>500kD) RNA multi- protein Binding complex which triggers MRNA degradation in response to MRNA
Unwinding of double stranded Si RNA by ATP independent Helicase
Active component of RISC is Ago proteins( ENDONUCLEASE) which cleave target MRNA.
DICER: endonuclease (RNase Family III)
Argonaute: Central Component of the RNA-Induced Silencing Complex (RISC)
One strand of the dsRNA produced by Dicer is retained in the RISC complex in association with Argonaute
ARGONAUTE PROTEIN :
1.PAZ(PIWI/Argonaute/ Zwille)- Recognition of target MRNA
2.PIWI (p-element induced wimpy Testis)- breaks Phosphodiester bond of mRNA.)RNAse H activity.
MiRNA:
The Double-stranded RNAs are naturally produced in eukaryotic cells during development, and they have a key role in regulating gene expression .
Nutraceutical market, scope and growth: Herbal drug technologyLokesh Patil
As consumer awareness of health and wellness rises, the nutraceutical market—which includes goods like functional meals, drinks, and dietary supplements that provide health advantages beyond basic nutrition—is growing significantly. As healthcare expenses rise, the population ages, and people want natural and preventative health solutions more and more, this industry is increasing quickly. Further driving market expansion are product formulation innovations and the use of cutting-edge technology for customized nutrition. With its worldwide reach, the nutraceutical industry is expected to keep growing and provide significant chances for research and investment in a number of categories, including vitamins, minerals, probiotics, and herbal supplements.
Multi-source connectivity as the driver of solar wind variability in the heli...Sérgio Sacani
The ambient solar wind that flls the heliosphere originates from multiple
sources in the solar corona and is highly structured. It is often described
as high-speed, relatively homogeneous, plasma streams from coronal
holes and slow-speed, highly variable, streams whose source regions are
under debate. A key goal of ESA/NASA’s Solar Orbiter mission is to identify
solar wind sources and understand what drives the complexity seen in the
heliosphere. By combining magnetic feld modelling and spectroscopic
techniques with high-resolution observations and measurements, we show
that the solar wind variability detected in situ by Solar Orbiter in March
2022 is driven by spatio-temporal changes in the magnetic connectivity to
multiple sources in the solar atmosphere. The magnetic feld footpoints
connected to the spacecraft moved from the boundaries of a coronal hole
to one active region (12961) and then across to another region (12957). This
is refected in the in situ measurements, which show the transition from fast
to highly Alfvénic then to slow solar wind that is disrupted by the arrival of
a coronal mass ejection. Our results describe solar wind variability at 0.5 au
but are applicable to near-Earth observatories.
This presentation explores a brief idea about the structural and functional attributes of nucleotides, the structure and function of genetic materials along with the impact of UV rays and pH upon them.
Slide 1: Title Slide
Extrachromosomal Inheritance
Slide 2: Introduction to Extrachromosomal Inheritance
Definition: Extrachromosomal inheritance refers to the transmission of genetic material that is not found within the nucleus.
Key Components: Involves genes located in mitochondria, chloroplasts, and plasmids.
Slide 3: Mitochondrial Inheritance
Mitochondria: Organelles responsible for energy production.
Mitochondrial DNA (mtDNA): Circular DNA molecule found in mitochondria.
Inheritance Pattern: Maternally inherited, meaning it is passed from mothers to all their offspring.
Diseases: Examples include Leber’s hereditary optic neuropathy (LHON) and mitochondrial myopathy.
Slide 4: Chloroplast Inheritance
Chloroplasts: Organelles responsible for photosynthesis in plants.
Chloroplast DNA (cpDNA): Circular DNA molecule found in chloroplasts.
Inheritance Pattern: Often maternally inherited in most plants, but can vary in some species.
Examples: Variegation in plants, where leaf color patterns are determined by chloroplast DNA.
Slide 5: Plasmid Inheritance
Plasmids: Small, circular DNA molecules found in bacteria and some eukaryotes.
Features: Can carry antibiotic resistance genes and can be transferred between cells through processes like conjugation.
Significance: Important in biotechnology for gene cloning and genetic engineering.
Slide 6: Mechanisms of Extrachromosomal Inheritance
Non-Mendelian Patterns: Do not follow Mendel’s laws of inheritance.
Cytoplasmic Segregation: During cell division, organelles like mitochondria and chloroplasts are randomly distributed to daughter cells.
Heteroplasmy: Presence of more than one type of organellar genome within a cell, leading to variation in expression.
Slide 7: Examples of Extrachromosomal Inheritance
Four O’clock Plant (Mirabilis jalapa): Shows variegated leaves due to different cpDNA in leaf cells.
Petite Mutants in Yeast: Result from mutations in mitochondrial DNA affecting respiration.
Slide 8: Importance of Extrachromosomal Inheritance
Evolution: Provides insight into the evolution of eukaryotic cells.
Medicine: Understanding mitochondrial inheritance helps in diagnosing and treating mitochondrial diseases.
Agriculture: Chloroplast inheritance can be used in plant breeding and genetic modification.
Slide 9: Recent Research and Advances
Gene Editing: Techniques like CRISPR-Cas9 are being used to edit mitochondrial and chloroplast DNA.
Therapies: Development of mitochondrial replacement therapy (MRT) for preventing mitochondrial diseases.
Slide 10: Conclusion
Summary: Extrachromosomal inheritance involves the transmission of genetic material outside the nucleus and plays a crucial role in genetics, medicine, and biotechnology.
Future Directions: Continued research and technological advancements hold promise for new treatments and applications.
Slide 11: Questions and Discussion
Invite Audience: Open the floor for any questions or further discussion on the topic.
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...Scintica Instrumentation
Intravital microscopy (IVM) is a powerful tool utilized to study cellular behavior over time and space in vivo. Much of our understanding of cell biology has been accomplished using various in vitro and ex vivo methods; however, these studies do not necessarily reflect the natural dynamics of biological processes. Unlike traditional cell culture or fixed tissue imaging, IVM allows for the ultra-fast high-resolution imaging of cellular processes over time and space and were studied in its natural environment. Real-time visualization of biological processes in the context of an intact organism helps maintain physiological relevance and provide insights into the progression of disease, response to treatments or developmental processes.
In this webinar we give an overview of advanced applications of the IVM system in preclinical research. IVIM technology is a provider of all-in-one intravital microscopy systems and solutions optimized for in vivo imaging of live animal models at sub-micron resolution. The system’s unique features and user-friendly software enables researchers to probe fast dynamic biological processes such as immune cell tracking, cell-cell interaction as well as vascularization and tumor metastasis with exceptional detail. This webinar will also give an overview of IVM being utilized in drug development, offering a view into the intricate interaction between drugs/nanoparticles and tissues in vivo and allows for the evaluation of therapeutic intervention in a variety of tissues and organs. This interdisciplinary collaboration continues to drive the advancements of novel therapeutic strategies.
2. 2
CONTENT
Introduction
Protein–Protein Interactions
Types of protein–protein interactions
Methods to investigate protein-protein interactions
Green fluorescent Protein as a signal for protein-protein
interactions.
Detecting Protein-Protein Interactions with a Green
Fluorescent Protein Fragment Reassembly Trap.
4. PPIs refer to intentional physical contacts established between two or
more proteins as a result of biochemical events and/or electrostatic forces.
In fact, proteins are vital macromolecules, at both cellular and systemic levels, but
they rarely act alone.
Aberrant PPIs are the basis of multiple diseases, such as Creutzfeld-
Jacob, Alzheimer's disease, and cancer.
4
Introduction
Casado-Vela J, Matthiesen R, Sellés S, Naranjo, JR Protein-Protein Interactions: Gene Acronym Redundancies and Current Limitations
Precluding Automated Data Integration Proteomes 2013, 1(1), 3-24.
5. PPIs have been studied from different perspectives:
Biochemistry
Quantum Chemistry
Molecular Dynamics
Signal Transduction
This information enables the creation of large protein interaction networks
similar to metabolic or genetic/epigenetic networks.
5
Protein–protein interactions
Casado-Vela J, Matthiesen R, Sellés S, Naranjo, JR Protein-Protein Interactions: Gene Acronym Redundancies and Current Limitations
Precluding Automated Data Integration Proteomes 2013, 1(1), 3-24.
6. 6
Protein–protein interactions
Casado-Vela J, Matthiesen R, Sellés S, Naranjo, JR Protein-Protein Interactions: Gene Acronym Redundancies and Current Limitations
Precluding Automated Data Integration Proteomes 2013, 1(1), 3-24.
PPIs have been studied from different perspectives:
Biochemistry
Quantum Chemistry
Molecular Dynamics
Signal Transduction
This information enables the creation of large protein interaction networks
similar to metabolic or genetic/epigenetic networks.
8. Cell metabolism
In many biosynthetic
processes enzymes interact with each
other to produce small compounds or
other macromolecules.
Muscle contraction
Myosin filaments act as molecular
motors and by binding
to actin enables filament sliding.
Examples of protein–protein interactions
8 Casado-Vela J, Matthiesen R, Sellés S, Naranjo, JR Protein-Protein Interactions: Gene Acronym Redundancies and Current Limitations
Precluding Automated Data Integration Proteomes 2013, 1(1), 3-24.
Signal transduction
The activity of the cell is regulated by extracellular signals.
Transport across membranes
A protein may be carrying another protein.
10. Homo-oligomers are macromolecular complexes constituted by only one type of protein
subunit.
Disruption of homo-oligomers in order to return to the initial individual monomers often
requires denaturation of the complex.
homo-oligomers complex
Several enzymes, carrier proteins and transcriptional regulatory factors carry out their
functions as homo-oligomers.
Homo-oligomers vs. hetero-oligomers
10 Joel Edt, Shoshana Wodak..Protein Modules and Protein-Protein Interaction 2002..16, 232-245
11. Distinct protein subunits interact in hetero-oligomers, which are essential to
control several cellular functions.
Homo-oligomers vs. hetero-oligomers
11
Hemoglobin Hb or Hgb Edit by: Giovanny Rincon
Joel Edt, Shoshana Wodak..Protein Modules and Protein-Protein Interaction 2002..16, 232-245
12. S.I: These are usually the case of homo-
oligomers (e.g. cytochrome c).
T.I.: A protein may interact briefly and in a
reversible manner with other proteins in only
certain cellular contexts – cell type, cell cycle
stage. (biochemical cascades)
Stable interactions vs. transient interactions
12
Example, some G protein-coupled
Activation cycle of a G-protein (purple) by a G-protein-
coupled receptor (light blue) receiving a ligand (red).
Joel Edt, Shoshana Wodak..Protein Modules and Protein-Protein Interaction 2002..16, 232-245
13. C: Are those with the strongest association and are formed by disulphide
bonds or electron sharing.
Although being rare, these interactions are determinant in some post
translational modifications, as ubiquitination and SUMOylation
(Small Ubiquitin-like Modifier (or SUMO)).
Non-covalent bonds are usually established during transient interactions by the
combination of weaker bonds:
Hydrogen bonds
Ionic interactions
Van der Waals forces
Hydrophobic bonds
Covalent vs. non-covalent
13 Joel Edt, Shoshana Wodak..Protein Modules and Protein-Protein Interaction 2002..16, 232-245
14. Protein concentration, which in turn are affected by expression levels and
degradation rates.
Protein affinity for proteins or other binding ligands.
Presence of other proteins, nucleic acids, and ions.
Ligands concentrations (substrates, ions, etc.).
Electric fields around proteins.
Factors that regulate protein–protein
interactions
14 Joel Edt, Shoshana Wodak..Protein Modules and Protein-Protein Interaction 2002..16, 232-245
15. The molecular structures of many protein complexes have been unlocked by the
technique of X-ray crystallography.
The first structure to be solved by this method by Sir John Cowdery Kendrew.
Techniques to study the molecular structure of
protein complexes
15
Crystal structure of modified Gramicidin S
horizontally determined by X-ray
crystallography
Stephen W Michnick. Exploring protein interactions by interaction-induced folding of proteins from complementary peptide fragments.
Prorein Science, Cambridge University Press. 2011, 8: 1256 -1265
16. NMR also started to be applied with the aim of unravelling the molecular
structure of protein complexes.
Techniques to study the molecular structure of
protein complexes
16
NMR structure of cytochrome C
illustrating its dynamics in solution
Stephen W Michnick. Exploring protein interactions by interaction-induced folding of proteins from complementary peptide fragments.
Prorein Science, Cambridge University Press. 2011, 8: 1256 -1265
17. Yeast two-hybrid screening
Investigating interactions of proteins within the yeast nucleus. (transfected with two
plasmids; Bait and Prey).
Tandem affinity purification (TAP):
Detects cell interactions in the real environment (eg in the cytosol of a mammalian cell).
Methods to investigate protein-protein
interactions
17 Stephen W Michnick. Exploring protein interactions by interaction-induced folding of proteins from complementary peptide fragments.
Prorein Science, Cambridge University Press. 2011, 8: 1256 -1265
Coimmunoprecipitation:
Is considered the best assay
for detecting PPIs.
Endogenous proteins
Edit: by Giovanny Rincon
18. Quantitative immunoprecipitation combined with knock-out:
(QUICK is based on the co-immunoprecipitation, quantitative mass
spectrometry (SILAC) and RNA interference (RNA interference - RNAi).
Dual Polarization Interferometry (DPI):
Provides measurements of molecular size, density and mass, in real time
and with high resolution.
Blue Native Polyacrylamide Gel Electrophoresis (BN-PAGE):
Based on the migration of the protein complexes in polyacrylamide gels
according to their molecular weight.
18Stephen W Michnick. Exploring protein interactions by interaction-induced folding of proteins from complementary peptide fragments.
Prorein Science, Cambridge University Press. 2011, 8: 1256 -1265
Methods to investigate protein-protein
interactions
20. From the jelly fish Aequorea victoria has exceptional physical and
chemical properties:
Spontaneous fluorescence
High thermal stability
Resistance to detergents
Organic solvents and proteases
Methods to investigate protein-protein
interactions
20 Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
21. Use of S65T GFP as the basis of two methods for exploring PPIs
21
1.) Fluorescence gel retardation assay: Based on
the electrophoretic mobility of a protein-DNA
complex being less than that of either molecule
alone.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
Methods to investigate protein-protein
interactions
22. 2.) Fluorescence polarization assay. A complex between two molecules
rotates more slowly than do the free molecules.
22 Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
Methods to investigate protein-protein
interactions
24. Monitoring protein-protein interactions
24
System characterized interaction of the S-peptide and S-protein fragments
of bovine pancreatic ribonuclease (RNase) A
S-peptide (residues 1-20) and S-protein (residues 21-124)
Structure of RNase A
S15 was used in this study
Specifically, the generated fusion proteins in
which S15 is fused to the N or C terminus of
S65T GFP.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
25. 25
The His6 tag and S65T mutation were introduced simultaneously into the cDNA
that codes for wild-type GFP by PCR mutagenesis using three primers:
P39
GGCATATGCACCACCACCACCACCACGGCGGTAGCAAAGGAGAAGAAC
for the His6 tag and an Nde I site
M5 CCATGGCCAACACTGGTCACCACTTTCACCTATGGTGTTCAATGCTT
for the S65T change
P36
GTGAATTCTTGTATAGTTCATCCATGCCA for an EcoRI site
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
His6-GFP(S65T)-S15 construction
26. His6-GFP(S65T)-S15 construction
26
The resulting PCR fragment was digested with EcoR I and Nde I and inserted into an
EcoR I/Nde I site of PET-29 ª.
The crystallographic structure of restriction
Endonuclease EcoRI
The DNA fragment encoding SI5 was generated from PET-29a by PCR using P37:
GGAATTCCGGCGGCAAAGAAACCGCTGCTGCTAAA with an EcoR I site)
and P38 (TGGTCGACTTAGCTGTCCATGTGCTGG CGTTCGA with a Sal I site) and
inserted into EcoR I/Sal I site of the above plasmid to give pSH24.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
27. S15-GFP(S65T)-His6 Construction
27
The coding region of GFP(S65T) was amplified from pSH24:
P53 (TCAAGATCTTAGCAAAGGAGAAGAACTT with a Bgl I1 site)
P54 (GCCCTCGAGCTTGTATAGTTCATCCATGC with an Xho I site).
The PCR fragment was digested with Bgl I1 and Xho I and inserted into Bgl II/Xho I
site of PET-29 b to give pSH41.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
28. Gel Retardation Assay
28
Purified fusion proteins were quantified
Є= 39.2 mM-1 cm-1 at 490 nm of S65T GFP
S-protein Є= 9.56 mM-1 cm-1 at 280 nm
S15-GFP(S65T)-His6 was incubated with varying
amounts of S-protein.
20´ the mixtures were loaded onto a native
polyacrylamide gel, and was subjected to
electrophoresis at 4 °C at 10 V/cm.
After the gel was scanned by a Fluorimager SI
System (490 nm for excitation and 2515 nm for
emission).
The fluorescence intensities of bound and free
S15- GFP(S65T)-His6 were quantified by using
the program Image QuaNT 4.1.
Values of R (= fluorescence intensity of bound S15-GFP(S65T)-His6/ total fluorescence
intensity) were determined from the fluorescence intensities and Kd was determined:
)
6
)65(15(1
total
HisTSGFTSRtotalproteinS
R
R
d
K
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University Press.
1997, 6: 2344 &2349.
29. Polarization Assay
29
Measured with a Beacon Fluorescence Polarization System
Purified S15-GFP(S65T)-His6 was incubated with various concentrations of S-protein
in Tris-HCI buffer, pH 7.5, 8.0, or 8.5, containing NaCl (0 or 0.10 M).
Polarization measurements were made at each
S-protein concentration.
Values of Kd were determined by using the
program DeltaGraph 4.0 to fit the data with:
In Eq. 2, P is the measured polarization:
(ΔP =Pmax- Pmin). F is the concentration of free
S-protein. The fraction of bound S-protein (ƒB)
was obtained from the eq: (3)
)2(
min
P
F
d
K
PFP
)3(min
P
PP
B
f
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
31. Purification and detection of S65T GFP Fusion
Proteins
31
DNA encoding SI5 and six histidine residue (His6) was added to 5' and 3' ends
of the cDNA encoding S65T GFP.
The two resulting proteins, His6-GFP-(S65T)-S15 and SI5-GFP-(S65T)-His6,
were produced in Escherichia coli strain BL21(DE3)
Escherichia coli strain BL21(DE3)
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
32. Purification and detection of S65T GFP fusion
proteins
32
Purified by affinity chromatography using a Ni2+ -NTA column:
SDS-PAGE analysis of purified GFP fusion proteins.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
33. Purification and detection of S65T GFP fusion
proteins
33
Zymogram electorphoresis analysis of purified GFP fusion proteins.
Lane 1. Sl5-GFP(S65T)-His6. Lane 2. His6-GFP(S65T)-S15.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
34. Fluorescence gel retardation assay
34
The slower migrating isoform of His6-GFP(S65T)-
S15 was shifted upon binding to S-protein during
native PAGE, indicating that only this species has
an accessible S15.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
35. Fluorescence gel retardation assay
35
Fluorescence intensities of bound and free S15-GFP (S65T)-His6 were
quantified.
From the relative fluorescence intensities of the bound and free
S15-GFP-(S65 T)-His6, the binding ratio, at each concentration was obtained:
The dissociation constant (Kd) is (6 ± 3) * 10-8 M. (Average)
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
36. 36
Effect of pH.
The Kd values obtained were
1.4* 10-8 M, 1.1*10-8 M and
1.0*10-8 M.
Polarization assay
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
In this assay, the formation of a complex is deduced from an increase in
fluorescence polarization.
37. 37
Effect of salt concentration on complex formation. The value of Kd increased by
3.8-fold when NaCl was added to a final concentration of 0.10 M.
Polarization assay
At pH 8.0. Values of Kd in the presence
of 0 and 0.10 M NaCl were 1.1*10-8 M
and 4.2 *10-8 M, respectively.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University Press. 1997, 6:
2344 &2349.
38. 38
GENERAL IDEAS
In fluorescence gel retardation method the interaction between the two
proteins is evident by a decrease in the mobility of the fluorescent fusion
protein that results from complex formation.
The fluorescence polarization assay, provides a more accurate
assessment of the value of Kd.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University Press. 1997, 6:
2344 &2349.
40. 40
Fusing strongly interacting antiparallel
leucine zippers to the C- and N-termini of the
N-terminal and C-terminal fragments of GFP
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
Leucine zippers
41. 41
Compatible plasmids (e.g., pMRBAD-Z-CGFP and pET11a-Z-NGFP) were either
cotransformed or sequentially transformed into BL21(DE3) Escherichia coli by
electroporation.
Cells were screened on LB agar supplemented with anamycin, ampicillin and arabinose.
Cells were either grown for 3 days at room temperature 22 °C.
Fluorescence was observed under a hand-held long-wave UV lamp 365nm.
Screening
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
42. 42
To improve the utility of the GFP-based fragment complementation
Assay; two compatible vectors that can be comaintained in E. coli
Compatible Vectors for Comaintenance of
GFP Fusions.
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
43. 43
If the Z-NGFP or Z-CGFP plasmids are replaced with link-NGFP or link-CGFP
plasmids, respectively, then no cellular fluorescence is observed
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
Compatible Vectors for Comaintenance of
GFP Fusions
(Middle row) GFP reassembly occurs when the
interacting peptides are fused to the GFP
fragments, with the original fusion architecture
To confirm the visual phenotypes, it also harvested cells
from the screening agar plates and examined the
fluorescence in cleared lysates for equal numbers of cells
44. 44
Parallel and antiparallel coiled coils
associate by the interaction of
hydrophobic residues at the peptide-
peptide interface.
As well as charge-charge interactions
between “edge” positions.
Antiparallel Leucine Zipper Libraries for
Determining Interaction Requirements
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope
and Mechanism. CHEM. SOC. 2005, 127, 146-157
Helical wheel diagram
A portion of the antiparallel leucine zipper from
T. thermophilus SerRS
45. 45
General Applicability of the Screen:
Protein-Peptide Interactions
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
Quantified from lysates
Interaction of TPR1, TPR2A, and TPR2B on
NGFP with the Z peptide or C-terminal peptides
from Hsc70 or Hsp90 in CGFP
46. 46
It have engineered a pair of compatible plasmids that greatly facilitate the use
of GFP fragment reassembly as a screen for protein-protein interactions in
bacteria.
The vectors allow facile subcloning of the genes of interest as fusions to the
GFP fragments, and their compatibility and independent transcriptional control
afford faithful reporting of interactions.
The screen can detect weak (KD = 1 mM) and probably transient interactions
due to irreversibility of the reassembly reaction,
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
GENERAL IDEAS
the current knowledge on biochemical cascades and disease pathogenesis, as well as provide new therapeutic targets.
– that empower the current knowledge on biochemical cascades and disease pathogenesis, as well as provide putative new therapeutic targets.
Physiology of muscle contraction involves several interactions.
Stable interactions involve proteins that interact for a long time, taking part of permanent complexes as subunits, in order to carry out structural or functional roles.
In this technique the angles and intensities of a beam of X-rays diffracted by crystalline atoms are detected in a film, thus producing a three-dimensional picture of the density of electrons within the crystal.
This technique is based on the study of magnetic properties of atomic nuclei, thus determining physical and chemical properties of the correspondent atoms or the molecules. Nuclear magnetic resonance is advantageous for characterizing weak PPIs
Because protein interactions are so important, there is a multitude of methods to detect them. Each approach has its own pros and cons, especially in terms of sensitivity and specificity of the method.
A high sensitivity means that many of the interactions that occur are actually detected by the method, while high specificity indicates that most of the detected interactions do occur (few false-positives)
En la segunda: This method can identify molecules that bind to a given protein unequivocally.
El la tercera: This is a great advantage compared to the two-hybrid assay..
Migration is also defined by the load, is used as the cathode buffer solution containing Coomassie blue, which gives net negative charge to proteins without desnaturar or break their interactions with other proteins.
Structural comparison of wt GFP, S65T GFP and EGFP.(A) overlay of EGFP (green), wt GFP (grey) and S65T GFP (cyan). (B) Stereo view of the influence of the S65T mutation on local hydrogen bond network. EGFP, wt GFP and S65T GFP coloured as in A. Hydrogen bonds associated with EGFP, wt GFP and S65T GFP are yellow, red and blue dashed lines respectively.
The resulting increase in rotational correlation time gives rise to an increase in fluorescence polarization
To demonstrate the potential of S65T GFP in exploring protein-protein
interactions, was chosen as a model
by using the extinction coefficient
Lane Media Molecular mass markers
The insensitivity of Kd values to the pH change (pH 7.5 to pH 8.5) was not unexpected, as none of the amino acid side chains involveidn the interaction is known to change its protonation state in this pH range. The Kd (1.4 X lo-' M) at pH 7.5 is approximately fourfold lower than the
The added salt is likely to disturb the water molecules hydrating the hydrophobic patch in the complex between S-peptide
and S-protein, resulting in a decrease in the binding affinity.
Finally, the value of Kd (4.2 X IOp8 M) that we observed in 20 mM Tris-HCI buffer, pH 8.0, containing NaCl (0.10 M) was similar (i.e., 2.6-fold lower) to that obtained by titration calorimetry in 50 mh4 sodium acetate buffer, pH 6.0, containing NaCl (0.10 mM)
, respectively, folding and fluorescence of the split GFP molecule are achieved
or grown for 8-16 h at 30 or 37°C followed by 1-2 days of incubation at room temperature.
, respectively, folding and fluorescence of the split GFP molecule are achieved
Cotransformation or sequential transformation of BL21(DE3) E. coli with pET11a-Z-NGFP and pMRBAD-Z-CGFP with mild induction of the lac-controlled T7 polymerase (10 μM IPTG) and strong induction of the arabinose promoter (0.02- 0.2% arabinose) on LB agar after 16 h at 37 °C and 24 h at room temperature results in cellular fluorescence in all colonies.
The overnight cell-growth phase may be carried out at 30 °C, or the cells may be allowed to grow for 3 days at room temperature. If the Z-NGFP or Z-CGFP plasmids are replaced with link-NGFP or link-CGFP plasmids, respectively, then no cellular fluorescence is observed, proving that the antiparallel leucine