SlideShare a Scribd company logo

Combining PacBio with short read technology for improved de novo genome assembly

•Download as PPTX, PDF•
•
L
Lex Nederbragt

This document discusses combining PacBio long read sequencing with short read sequencing technologies to improve genome assembly. PacBio sequencing can generate very long reads but with lower accuracy than short read technologies. By combining the long reads from PacBio with the high accuracy of short reads, it may be possible to generate improved de novo genome assemblies that can span repeats and heterozygous regions more completely. The document provides background on challenges of genome assembly and how PacBio long reads could help address these challenges when combined with short read data.

1 of 56
The best of both worlds Combining PacBio with short read technology for improved de novo genome assembly Lex Nederbragt, NSC and CEES lex.nederbragt@bio.uio.no
This talk
Why does everybody want longer reads? … for genome assemblies
What is a genome assembly Hierarchical structure reads contigs scaffolds
Sequence data Reads reads contigs scaffolds original DNA fragments original DNA fragments Sequenced ends http://www.cbcb.umd.edu/research/assembly_primer.shtml
Contigs Building contigs reads contigs scaffolds ACGCGATTCAGGTTACCACG GCGATTCAGGTTACCACGCG GATTCAGGTTACCACGCGTA TTCAGGTTACCACGCGTAGC CAGGTTACCACGCGTAGCGC Aligned reads GGTTACCACGCGTAGCGCAT TTACCACGCGTAGCGCATTA ACCACGCGTAGCGCATTACA CACGCGTAGCGCATTACACA CGCGTAGCGCATTACACAGA CGTAGCGCATTACACAGATT TAGCGCATTACACAGATTAG Consensus contig ACGCGATTCAGGTTACCACGCGTAGCGCATTACACAGATTAG
Contigs Building contigs reads contigs scaffolds Repeat copy 1 Repeat copy 2 Contig orientation? Contig order? Collapsed repeat consensus http://www.cbcb.umd.edu/research/assembly_primer.shtml
Mate pairs Other read type reads contigs scaffolds Repeat copy 1 Repeat copy 2 (much) longer fragments mate pair reads
Scaffolds Ordered, oriented contigs reads contigs scaffolds mate pairs contigs gap size estimate
What is a genome assembly Hierarchical structure reads ACGCGATTCAGGTTACCACG GCGATTCAGGTTACCACGCG GATTCAGGTTACCACGCGTA TTCAGGTTACCACGCGTAGC CAGGTTACCACGCGTAGCGC Aligned reads GGTTACCACGCGTAGCGCAT TTACCACGCGTAGCGCATTA ACCACGCGTAGCGCATTACA CACGCGTAGCGCATTACACA CGCGTAGCGCATTACACAGA contigs CGTAGCGCATTACACAGATT TAGCGCATTACACAGATTAG Consensus contig ACGCGATTCAGGTTACCACGCGTAGCGCATTACACAGATTAG scaffolds
Genome assembly So, what’s so hard about it?
1) Repeats reads contigs scaffolds Repeat copy 1 Repeat copy 2 Repeats break up contigs Collapsed repeat consensus http://www.cbcb.umd.edu/research/assembly_primer.shtml
2) Heterozygosity Differences between sister * chromosomes * * http://commons.wikimedia.org/wiki/File:Chromosome_1.svg
2) Heterozygosity Polymorphic contig 2 Contig 1 Contig 4 Polymorphic contig 3
2) Heterozygosity http://www.astraean.com/borderwars/wp-content/uploads/2012/04/heterozygoats.jpg and many other sites
3) Many programs to choose from Zhang et al. (2011) doi:10.1371/journal.pone.0017915.g001
Assembly: challenges Repeat copy 1 Repeat copy 2 Knowing how to use the programs Heterozygosity Polymorphic contig 2 Contig 1 Contig 4 Polymorphic contig 3
So, why does everybody want longer reads? http://www.autobizz.com.my/forum/forum/General-Chat/944-The-worlds-longest-car.html
Longer reads? Repeat copy 1 Repeat copy 2 Long reads can span repeats and heterozygous regions Polymorphic contig 2 Contig 1 Contig 4 Polymorphic contig 3
PacBio to the rescue?
High-throughput sequencing Library preparation SMRTBell'template' SMRTBell'template' Standard'Sequencing' Standard'Sequencing' Generates& pass& each& one& on& molecule& Insert& Large& Sizes& Generates& pass& each& one& on& molecule& Large Insert& Sizes Large& Sizes& Insert sequenced& Single pass sequenced& Circular'Consensus'Sequencing' Circular'Consensus'Sequencing' Continued generations of reads Small Insert Sizes& Small& Small& Insert& Sizes Insert& Sizes& Multiple mul8ple& passes passes& each& Generates& on& molecule& Generates& mul8ple& sequenced& passes& each& on& molecule& sequenced&
High-throughput sequencing Raw read length
High-throughput sequencing SMRTBell'template' Raw reads and subreads Standard'Sequencing' Generates& pass& each& one& on& molecule& Large Insert& Sizes Large& Sizes& Insert Single pass sequenced& ‘Subreads’ Circular'Consensus'Sequencing' Small Insert Sizes& Small&Insert& Sizes Multiple mul8ple& passes passes& each& Generates& on& molecule& sequenced&
PacBio: uses SMRTBell'template' Long reads  low quality Standard'Sequencing' Generates& pass& each& one& on& molecule& Large Insert& Sizes Large& Sizes& Insert Single pass sequenced& 85-87% accuracy Circular'Consensus'Sequencing' Useful for assembly? Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced&
Solutions for assembly
Solutions for assembly (1) Designed by Pacific Biosciences http://www.clker.com/clipart-4245.html
Solutions for assembly (2) Broad Institute Need a special recipe for sequencing
Solutions for assembly (3) PacBioToCA Error correct with short reads Celera assembler http://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
PacBioToCA Koren et al, 2012
Shameless self-promotion flxlexblog.wordpress.com
Shameless self-promotion @lexnederbragt
The Atlantic cod genome project
First draft Fragmented assembly - short contigs - many gap bases http://en.wikipedia.org
First draft 6467 scaffolds 35% gap bases
The causes Short Tandem Repeats (>20% of gaps)
The causes Heterozygosity? Polymorphic contig 2 Contig 1 Contig 4 Polymorphic contig 3
The goal 23 pseudochromosomes Longer contigs Below 5% gap bases PacBio to the rescue?
The approach SMRTBell'template' Libraries Standard'Sequencing' Generates& pass& ea one& on& Large Insert& Sizes Large& Sizes& Insert sequenced& Aim for looooong insert sizes Circular'Consensus'Sequencing' Small& Insert& Sizes& Generates& mul8ple& passes sequenced&
SMRTBell'template' The approach Sequencing Standard'Sequencing' Generates& pass& each& one& on& molecule& Large Insert& Sizes Large& Sizes& Insert Single pass sequenced& Sequence with 90 minute movies Circular'Consensus'Sequencing' Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& 10 x coverage in reads of at least 3000 bp sequenced& No, we don’t throw this away…
The approach Error-correction
PacBio results 100 Relative throughput at different minimum length cutoffs 10kb lib 2 Fraction of bases at minimum 10kb lib 1 length 4kb lib 80 Percentage of total sequence 60 40 20 0 0kbp 3kbp 5kbp 10kbp 15kbp Length cutoff longest subread Large library insert size important!
chnology PacBio results SMRTBell'template' 64 SMRT Cells 3.2 Gigabytes in raw reads at least 3kb 3.8 x coverage 3 Standard'Sequencing' Generates& pass& each& one& on& molecule& Large Insert& Sizes Large& Sizes& Insert sequenced& 2.2 Gigabytes in longest subreads reads Circular'Consensus'Sequencing' Largest 15 kbp Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule&
PacBio results Mapping to the cod genome 11.4 kbp subread 10.6 kbp subread 10.9 kbp subread
Example 1 ACACAC repeat 232 bp Gap TGTGTG repeat
Example 1
Example 1
Example 1 Scaffold ...ACACAC TGTGTG... PacBio reads Unplaced contig
Example 2 TGTGTG repeat 344 bp Gap
Example 2
Example 2 Scaffold ...TGTGTG PacBio reads Heterozygosity?
Example 3 Scaffold PacBio reads 300 bp misassembly?
Error-correction Work In Progress http://openclipart.org/
Outlook Will PacBio solve our problems?
Outlook Or
Outlook Polymorphic contig 2 Contig 1 Contig 4 Polymorphic contig 3 Will we find the heterozygous regions?
Outlook http://www.pasteur.fr/recherche/unites/Bbi/ en.wikipedia.org and Martin Malmstrøm

Recommended

Genome Assembly 2018
Genome Assembly 2018Genome Assembly 2018
Genome Assembly 2018
Aureliano Bombarely
 
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and YieldUnderstanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and YieldIntegrated DNA Technologies
 
Genomics and proteomics I
Genomics and proteomics IGenomics and proteomics I
Genomics and proteomics INikolay Vyahhi
 
Autoencoders
AutoencodersAutoencoders
Autoencoders
Ashok Govindarajan
 
Functional genomics
Functional genomicsFunctional genomics
Functional genomics
Pawan Kumar
 
Overview of Single-Cell RNA-seq
Overview of Single-Cell RNA-seqOverview of Single-Cell RNA-seq
Overview of Single-Cell RNA-seq
Alireza Doustmohammadi
 
A short introduction to single-cell RNA-seq analyses
A short introduction to single-cell RNA-seq analysesA short introduction to single-cell RNA-seq analyses
A short introduction to single-cell RNA-seq analyses
tuxette
 
Expressed sequence tag (EST), molecular marker
Expressed sequence tag (EST), molecular markerExpressed sequence tag (EST), molecular marker
Expressed sequence tag (EST), molecular marker
KAUSHAL SAHU
 

Recommended

Genome Assembly 2018
Genome Assembly 2018Genome Assembly 2018
Genome Assembly 2018
Aureliano Bombarely
 
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and YieldUnderstanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and YieldIntegrated DNA Technologies
 
Genomics and proteomics I
Genomics and proteomics IGenomics and proteomics I
Genomics and proteomics INikolay Vyahhi
 
Autoencoders
AutoencodersAutoencoders
Autoencoders
Ashok Govindarajan
 
Functional genomics
Functional genomicsFunctional genomics
Functional genomics
Pawan Kumar
 
Overview of Single-Cell RNA-seq
Overview of Single-Cell RNA-seqOverview of Single-Cell RNA-seq
Overview of Single-Cell RNA-seq
Alireza Doustmohammadi
 
A short introduction to single-cell RNA-seq analyses
A short introduction to single-cell RNA-seq analysesA short introduction to single-cell RNA-seq analyses
A short introduction to single-cell RNA-seq analyses
tuxette
 
Expressed sequence tag (EST), molecular marker
Expressed sequence tag (EST), molecular markerExpressed sequence tag (EST), molecular marker
Expressed sequence tag (EST), molecular marker
KAUSHAL SAHU
 
Protein computational analysis
Protein computational analysisProtein computational analysis
Protein computational analysis
Kinza Irshad
 
Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)
Sebastian Schmeier
 
BPF Internals (eBPF)
BPF Internals (eBPF)BPF Internals (eBPF)
BPF Internals (eBPF)
Brendan Gregg
 
New generation sequencing equipments
New generation sequencing equipmentsNew generation sequencing equipments
New generation sequencing equipmentsKalaivani P
 
15 molecular markers techniques
15 molecular markers techniques15 molecular markers techniques
15 molecular markers techniques
AVINASH KUSHWAHA
 
Small rna
Small rnaSmall rna
Small rnaAndrea José Fuentes Bisbal
 
Assembly and finishing
Assembly and finishingAssembly and finishing
Assembly and finishingNikolay Vyahhi
 
Physical maps and their use in annotations
Physical maps and their use in annotationsPhysical maps and their use in annotations
Physical maps and their use in annotations
Sheetal Mehla
 
Linkage analysis
Linkage analysisLinkage analysis
Linkage analysis
UshaYadav24
 
Molecular marker and its application to genome mapping and molecular breeding
Molecular marker and its application to genome mapping and molecular breedingMolecular marker and its application to genome mapping and molecular breeding
Molecular marker and its application to genome mapping and molecular breeding
FOODCROPS
 
Data retreival system
Data retreival systemData retreival system
Data retreival system
Shikha Thakur
 
Investigating the 3D structure of the genome with Hi-C data analysis
Investigating the 3D structure of the genome with Hi-C data analysisInvestigating the 3D structure of the genome with Hi-C data analysis
Investigating the 3D structure of the genome with Hi-C data analysis
tuxette
 
scRNA-Seq Workshop Presentation - Stem Cell Network 2018
scRNA-Seq Workshop Presentation - Stem Cell Network 2018scRNA-Seq Workshop Presentation - Stem Cell Network 2018
scRNA-Seq Workshop Presentation - Stem Cell Network 2018
David Cook
 
RNA-Seq
RNA-SeqRNA-Seq
RNA-Seq
Bioinformatics and Computational Biosciences Branch
 
"Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio...
"Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio..."Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio...
"Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio...
Edge AI and Vision Alliance
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
Uzma Jabeen
 
The uni prot knowledgebase
The uni prot knowledgebaseThe uni prot knowledgebase
The uni prot knowledgebase
Kew Sama
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
Swathi Prabakar
 
Understanding DPDK algorithmics
Understanding DPDK algorithmicsUnderstanding DPDK algorithmics
Understanding DPDK algorithmics
Denys Haryachyy
 
Long non coding RNA or lncRNA
Long non coding RNA or lncRNALong non coding RNA or lncRNA
Long non coding RNA or lncRNA
MOHIT GOSWAMI
 
IonGAP - an Integrated Genome Assembly Platform for Ion Torrent Data
IonGAP - an Integrated Genome Assembly Platform for Ion Torrent DataIonGAP - an Integrated Genome Assembly Platform for Ion Torrent Data
IonGAP - an Integrated Genome Assembly Platform for Ion Torrent Data
Adrian Baez-Ortega
 
Jan2016 pac bio giab
Jan2016 pac bio giabJan2016 pac bio giab
Jan2016 pac bio giab
GenomeInABottle
 

More Related Content

What's hot

Protein computational analysis
Protein computational analysisProtein computational analysis
Protein computational analysis
Kinza Irshad
 
Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)
Sebastian Schmeier
 
BPF Internals (eBPF)
BPF Internals (eBPF)BPF Internals (eBPF)
BPF Internals (eBPF)
Brendan Gregg
 
New generation sequencing equipments
New generation sequencing equipmentsNew generation sequencing equipments
New generation sequencing equipmentsKalaivani P
 
15 molecular markers techniques
15 molecular markers techniques15 molecular markers techniques
15 molecular markers techniques
AVINASH KUSHWAHA
 
Assembly and finishing
Assembly and finishingAssembly and finishing
Assembly and finishingNikolay Vyahhi
 
Physical maps and their use in annotations
Physical maps and their use in annotationsPhysical maps and their use in annotations
Physical maps and their use in annotations
Sheetal Mehla
 
Linkage analysis
Linkage analysisLinkage analysis
Linkage analysis
UshaYadav24
 
Molecular marker and its application to genome mapping and molecular breeding
Molecular marker and its application to genome mapping and molecular breedingMolecular marker and its application to genome mapping and molecular breeding
Molecular marker and its application to genome mapping and molecular breeding
FOODCROPS
 
Data retreival system
Data retreival systemData retreival system
Data retreival system
Shikha Thakur
 
Investigating the 3D structure of the genome with Hi-C data analysis
Investigating the 3D structure of the genome with Hi-C data analysisInvestigating the 3D structure of the genome with Hi-C data analysis
Investigating the 3D structure of the genome with Hi-C data analysis
tuxette
 
scRNA-Seq Workshop Presentation - Stem Cell Network 2018
scRNA-Seq Workshop Presentation - Stem Cell Network 2018scRNA-Seq Workshop Presentation - Stem Cell Network 2018
scRNA-Seq Workshop Presentation - Stem Cell Network 2018
David Cook
 
"Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio...
"Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio..."Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio...
"Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio...
Edge AI and Vision Alliance
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
Uzma Jabeen
 
The uni prot knowledgebase
The uni prot knowledgebaseThe uni prot knowledgebase
The uni prot knowledgebase
Kew Sama
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
Swathi Prabakar
 
Understanding DPDK algorithmics
Understanding DPDK algorithmicsUnderstanding DPDK algorithmics
Understanding DPDK algorithmics
Denys Haryachyy
 
Long non coding RNA or lncRNA
Long non coding RNA or lncRNALong non coding RNA or lncRNA
Long non coding RNA or lncRNA
MOHIT GOSWAMI
 

What's hot (20)

Protein computational analysis
Protein computational analysisProtein computational analysis
Protein computational analysis
 
Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)
 
BPF Internals (eBPF)
BPF Internals (eBPF)BPF Internals (eBPF)
BPF Internals (eBPF)
 
New generation sequencing equipments
New generation sequencing equipmentsNew generation sequencing equipments
New generation sequencing equipments
 
15 molecular markers techniques
15 molecular markers techniques15 molecular markers techniques
15 molecular markers techniques
 
Small rna
Small rnaSmall rna
Small rna
 
Assembly and finishing
Assembly and finishingAssembly and finishing
Assembly and finishing
 
Physical maps and their use in annotations
Physical maps and their use in annotationsPhysical maps and their use in annotations
Physical maps and their use in annotations
 
Linkage analysis
Linkage analysisLinkage analysis
Linkage analysis
 
Molecular marker and its application to genome mapping and molecular breeding
Molecular marker and its application to genome mapping and molecular breedingMolecular marker and its application to genome mapping and molecular breeding
Molecular marker and its application to genome mapping and molecular breeding
 
Data retreival system
Data retreival systemData retreival system
Data retreival system
 
Investigating the 3D structure of the genome with Hi-C data analysis
Investigating the 3D structure of the genome with Hi-C data analysisInvestigating the 3D structure of the genome with Hi-C data analysis
Investigating the 3D structure of the genome with Hi-C data analysis
 
scRNA-Seq Workshop Presentation - Stem Cell Network 2018
scRNA-Seq Workshop Presentation - Stem Cell Network 2018scRNA-Seq Workshop Presentation - Stem Cell Network 2018
scRNA-Seq Workshop Presentation - Stem Cell Network 2018
 
RNA-Seq
RNA-SeqRNA-Seq
RNA-Seq
 
"Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio...
"Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio..."Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio...
"Quantizing Deep Networks for Efficient Inference at the Edge," a Presentatio...
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
 
The uni prot knowledgebase
The uni prot knowledgebaseThe uni prot knowledgebase
The uni prot knowledgebase
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
 
Understanding DPDK algorithmics
Understanding DPDK algorithmicsUnderstanding DPDK algorithmics
Understanding DPDK algorithmics
 
Long non coding RNA or lncRNA
Long non coding RNA or lncRNALong non coding RNA or lncRNA
Long non coding RNA or lncRNA
 

Viewers also liked

IonGAP - an Integrated Genome Assembly Platform for Ion Torrent Data
IonGAP - an Integrated Genome Assembly Platform for Ion Torrent DataIonGAP - an Integrated Genome Assembly Platform for Ion Torrent Data
IonGAP - an Integrated Genome Assembly Platform for Ion Torrent Data
Adrian Baez-Ortega
 
Jan2016 pac bio giab
Jan2016 pac bio giabJan2016 pac bio giab
Jan2016 pac bio giab
GenomeInABottle
 
NGS technologies - platforms and applications
NGS technologies - platforms and applicationsNGS technologies - platforms and applications
NGS technologies - platforms and applications
AGRF_Ltd
 
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Torsten Seemann
 
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...
Lex Nederbragt
 
Next-generation sequencing - variation discovery
Next-generation sequencing - variation discoveryNext-generation sequencing - variation discovery
Next-generation sequencing - variation discoveryJan Aerts
 
2014 June 17 PacBio User Group Meeting Presentation "How Looking for a Needle...
2014 June 17 PacBio User Group Meeting Presentation "How Looking for a Needle...2014 June 17 PacBio User Group Meeting Presentation "How Looking for a Needle...
2014 June 17 PacBio User Group Meeting Presentation "How Looking for a Needle...
Anne Deslattes Mays
 
20150601 bio sb_assembly_course
20150601 bio sb_assembly_course20150601 bio sb_assembly_course
20150601 bio sb_assembly_course
hansjansen9999
 
Improving and validating the Atlantic Cod genome assembly using PacBio
Improving and validating the Atlantic Cod genome assembly using PacBioImproving and validating the Atlantic Cod genome assembly using PacBio
Improving and validating the Atlantic Cod genome assembly using PacBio
Lex Nederbragt
 
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
Torsten Seemann
 
Genome assembly: the art of trying to make one big thing from millions of ver...
Genome assembly: the art of trying to make one big thing from millions of ver...Genome assembly: the art of trying to make one big thing from millions of ver...
Genome assembly: the art of trying to make one big thing from millions of ver...
Keith Bradnam
 
De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015Torsten Seemann
 
An introduction to RNA-seq data analysis
An introduction to RNA-seq data analysisAn introduction to RNA-seq data analysis
An introduction to RNA-seq data analysis
AGRF_Ltd
 
Next-generation sequencing format and visualization with ngs.plot
Next-generation sequencing format and visualization with ngs.plotNext-generation sequencing format and visualization with ngs.plot
Next-generation sequencing format and visualization with ngs.plot
Li Shen
 
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
VHIR Vall d’Hebron Institut de Recerca
 
[2013.10.29] albertsen genomics metagenomics
[2013.10.29] albertsen genomics metagenomics[2013.10.29] albertsen genomics metagenomics
[2013.10.29] albertsen genomics metagenomicsMads Albertsen
 
Semiconductor Sequencing Applications for Plant Sciences
Semiconductor Sequencing Applications for Plant SciencesSemiconductor Sequencing Applications for Plant Sciences
Semiconductor Sequencing Applications for Plant Sciences
Thermo Fisher Scientific
 
Ngs de novo assembly progresses and challenges
Ngs de novo assembly progresses and challengesNgs de novo assembly progresses and challenges
Ngs de novo assembly progresses and challenges
Scott Edmunds
 
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
QIAGEN
 

Viewers also liked (20)

IonGAP - an Integrated Genome Assembly Platform for Ion Torrent Data
IonGAP - an Integrated Genome Assembly Platform for Ion Torrent DataIonGAP - an Integrated Genome Assembly Platform for Ion Torrent Data
IonGAP - an Integrated Genome Assembly Platform for Ion Torrent Data
 
Jan2016 pac bio giab
Jan2016 pac bio giabJan2016 pac bio giab
Jan2016 pac bio giab
 
NGS technologies - platforms and applications
NGS technologies - platforms and applicationsNGS technologies - platforms and applications
NGS technologies - platforms and applications
 
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
 
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...
 
Next-generation sequencing - variation discovery
Next-generation sequencing - variation discoveryNext-generation sequencing - variation discovery
Next-generation sequencing - variation discovery
 
2014 June 17 PacBio User Group Meeting Presentation "How Looking for a Needle...
2014 June 17 PacBio User Group Meeting Presentation "How Looking for a Needle...2014 June 17 PacBio User Group Meeting Presentation "How Looking for a Needle...
2014 June 17 PacBio User Group Meeting Presentation "How Looking for a Needle...
 
20150601 bio sb_assembly_course
20150601 bio sb_assembly_course20150601 bio sb_assembly_course
20150601 bio sb_assembly_course
 
Improving and validating the Atlantic Cod genome assembly using PacBio
Improving and validating the Atlantic Cod genome assembly using PacBioImproving and validating the Atlantic Cod genome assembly using PacBio
Improving and validating the Atlantic Cod genome assembly using PacBio
 
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
 
Genome assembly: the art of trying to make one big thing from millions of ver...
Genome assembly: the art of trying to make one big thing from millions of ver...Genome assembly: the art of trying to make one big thing from millions of ver...
Genome assembly: the art of trying to make one big thing from millions of ver...
 
20140711 3 t_clark_ercc2.0_workshop
20140711 3 t_clark_ercc2.0_workshop20140711 3 t_clark_ercc2.0_workshop
20140711 3 t_clark_ercc2.0_workshop
 
De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015
 
An introduction to RNA-seq data analysis
An introduction to RNA-seq data analysisAn introduction to RNA-seq data analysis
An introduction to RNA-seq data analysis
 
Next-generation sequencing format and visualization with ngs.plot
Next-generation sequencing format and visualization with ngs.plotNext-generation sequencing format and visualization with ngs.plot
Next-generation sequencing format and visualization with ngs.plot
 
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
 
[2013.10.29] albertsen genomics metagenomics
[2013.10.29] albertsen genomics metagenomics[2013.10.29] albertsen genomics metagenomics
[2013.10.29] albertsen genomics metagenomics
 
Semiconductor Sequencing Applications for Plant Sciences
Semiconductor Sequencing Applications for Plant SciencesSemiconductor Sequencing Applications for Plant Sciences
Semiconductor Sequencing Applications for Plant Sciences
 
Ngs de novo assembly progresses and challenges
Ngs de novo assembly progresses and challengesNgs de novo assembly progresses and challenges
Ngs de novo assembly progresses and challenges
 
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
 

Similar to Combining PacBio with short read technology for improved de novo genome assembly

2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshopc.titus.brown
 
How to sequence a large eukaryotic genome
How to sequence a large eukaryotic genomeHow to sequence a large eukaryotic genome
How to sequence a large eukaryotic genome
Lex Nederbragt
 
20110524zurichngs 1st pub
20110524zurichngs 1st pub20110524zurichngs 1st pub
20110524zurichngs 1st pubsesejun
 
Genome Assembly copy
Genome Assembly copyGenome Assembly copy
Genome Assembly copy
Pradeep Kumar
 
The Genome Assembly Problem
The Genome Assembly ProblemThe Genome Assembly Problem
The Genome Assembly Problem
Mark Chang
 
Git Going With DVCS v1.5.2
Git Going With DVCS v1.5.2Git Going With DVCS v1.5.2
Git Going With DVCS v1.5.2
Matthew McCullough
 
Rnaseq forgenefinding
Rnaseq forgenefindingRnaseq forgenefinding
Rnaseq forgenefinding
Sucheta Tripathy
 

Similar to Combining PacBio with short read technology for improved de novo genome assembly (7)

2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshop
 
How to sequence a large eukaryotic genome
How to sequence a large eukaryotic genomeHow to sequence a large eukaryotic genome
How to sequence a large eukaryotic genome
 
20110524zurichngs 1st pub
20110524zurichngs 1st pub20110524zurichngs 1st pub
20110524zurichngs 1st pub
 
Genome Assembly copy
Genome Assembly copyGenome Assembly copy
Genome Assembly copy
 
The Genome Assembly Problem
The Genome Assembly ProblemThe Genome Assembly Problem
The Genome Assembly Problem
 
Git Going With DVCS v1.5.2
Git Going With DVCS v1.5.2Git Going With DVCS v1.5.2
Git Going With DVCS v1.5.2
 
Rnaseq forgenefinding
Rnaseq forgenefindingRnaseq forgenefinding
Rnaseq forgenefinding
 

More from Lex Nederbragt

Coding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS eraCoding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS era
Lex Nederbragt
 
Why of version control
Why of version controlWhy of version control
Why of version control
Lex Nederbragt
 
Assembly: before and after
Assembly: before and afterAssembly: before and after
Assembly: before and after
Lex Nederbragt
 
Repeat after me: Is our research reproducible (enough)?
Repeat after me: Is our research reproducible (enough)? Repeat after me: Is our research reproducible (enough)?
Repeat after me: Is our research reproducible (enough)?
Lex Nederbragt
 
A different kettle of fish entirely: bioinformatic challenges and solutions f...
A different kettle of fish entirely: bioinformatic challenges and solutions f...A different kettle of fish entirely: bioinformatic challenges and solutions f...
A different kettle of fish entirely: bioinformatic challenges and solutions f...
Lex Nederbragt
 
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...
Lex Nederbragt
 
How and why I use blogging
How and why I use bloggingHow and why I use blogging
How and why I use blogging
Lex Nederbragt
 
Assembly of metagenomes
Assembly of metagenomesAssembly of metagenomes
Assembly of metagenomes
Lex Nederbragt
 
NGS techniques and data
NGS techniques and data NGS techniques and data
NGS techniques and data
Lex Nederbragt
 
NGS: bioinformatic challenges
NGS: bioinformatic challengesNGS: bioinformatic challenges
NGS: bioinformatic challenges
Lex Nederbragt
 

More from Lex Nederbragt (10)

Coding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS eraCoding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS era
 
Why of version control
Why of version controlWhy of version control
Why of version control
 
Assembly: before and after
Assembly: before and afterAssembly: before and after
Assembly: before and after
 
Repeat after me: Is our research reproducible (enough)?
Repeat after me: Is our research reproducible (enough)? Repeat after me: Is our research reproducible (enough)?
Repeat after me: Is our research reproducible (enough)?
 
A different kettle of fish entirely: bioinformatic challenges and solutions f...
A different kettle of fish entirely: bioinformatic challenges and solutions f...A different kettle of fish entirely: bioinformatic challenges and solutions f...
A different kettle of fish entirely: bioinformatic challenges and solutions f...
 
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...
 
How and why I use blogging
How and why I use bloggingHow and why I use blogging
How and why I use blogging
 
Assembly of metagenomes
Assembly of metagenomesAssembly of metagenomes
Assembly of metagenomes
 
NGS techniques and data
NGS techniques and data NGS techniques and data
NGS techniques and data
 
NGS: bioinformatic challenges
NGS: bioinformatic challengesNGS: bioinformatic challenges
NGS: bioinformatic challenges
 

Recently uploaded

Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered QualitySoftware Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
Inflectra
 
Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........
Alison B. Lowndes
 
Smart TV Buyer Insights Survey 2024 by 91mobiles.pdf
Smart TV Buyer Insights Survey 2024 by 91mobiles.pdfSmart TV Buyer Insights Survey 2024 by 91mobiles.pdf
Smart TV Buyer Insights Survey 2024 by 91mobiles.pdf
91mobiles
 
State of ICS and IoT Cyber Threat Landscape Report 2024 preview
State of ICS and IoT Cyber Threat Landscape Report 2024 previewState of ICS and IoT Cyber Threat Landscape Report 2024 preview
State of ICS and IoT Cyber Threat Landscape Report 2024 preview
Prayukth K V
 
JMeter webinar - integration with InfluxDB and Grafana
JMeter webinar - integration with InfluxDB and GrafanaJMeter webinar - integration with InfluxDB and Grafana
JMeter webinar - integration with InfluxDB and Grafana
RTTS
 
Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...
Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...
Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...
Ramesh Iyer
 
PCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase TeamPCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase Team
ControlCase
 
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
Product School
 
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Thierry Lestable
 
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
James Anderson
 
DevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA ConnectDevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA Connect
Kari Kakkonen
 
Connector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a buttonConnector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a button
DianaGray10
 
FIDO Alliance Osaka Seminar: Passkeys and the Road Ahead.pdf
FIDO Alliance Osaka Seminar: Passkeys and the Road Ahead.pdfFIDO Alliance Osaka Seminar: Passkeys and the Road Ahead.pdf
FIDO Alliance Osaka Seminar: Passkeys and the Road Ahead.pdf
FIDO Alliance
 
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
Product School
 
Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !
KatiaHIMEUR1
 
FIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdfFIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance
 
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
BookNet Canada
 
Accelerate your Kubernetes clusters with Varnish Caching
Accelerate your Kubernetes clusters with Varnish CachingAccelerate your Kubernetes clusters with Varnish Caching
Accelerate your Kubernetes clusters with Varnish Caching
Thijs Feryn
 
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Product School
 
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Tobias Schneck
 

Recently uploaded (20)

Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered QualitySoftware Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
 
Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........
 
Smart TV Buyer Insights Survey 2024 by 91mobiles.pdf
Smart TV Buyer Insights Survey 2024 by 91mobiles.pdfSmart TV Buyer Insights Survey 2024 by 91mobiles.pdf
Smart TV Buyer Insights Survey 2024 by 91mobiles.pdf
 
State of ICS and IoT Cyber Threat Landscape Report 2024 preview
State of ICS and IoT Cyber Threat Landscape Report 2024 previewState of ICS and IoT Cyber Threat Landscape Report 2024 preview
State of ICS and IoT Cyber Threat Landscape Report 2024 preview
 
JMeter webinar - integration with InfluxDB and Grafana
JMeter webinar - integration with InfluxDB and GrafanaJMeter webinar - integration with InfluxDB and Grafana
JMeter webinar - integration with InfluxDB and Grafana
 
Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...
Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...
Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...
 
PCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase TeamPCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase Team
 
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
 
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
 
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
 
DevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA ConnectDevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA Connect
 
Connector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a buttonConnector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a button
 
FIDO Alliance Osaka Seminar: Passkeys and the Road Ahead.pdf
FIDO Alliance Osaka Seminar: Passkeys and the Road Ahead.pdfFIDO Alliance Osaka Seminar: Passkeys and the Road Ahead.pdf
FIDO Alliance Osaka Seminar: Passkeys and the Road Ahead.pdf
 
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
 
Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !
 
FIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdfFIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdf
 
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
 
Accelerate your Kubernetes clusters with Varnish Caching
Accelerate your Kubernetes clusters with Varnish CachingAccelerate your Kubernetes clusters with Varnish Caching
Accelerate your Kubernetes clusters with Varnish Caching
 
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
 
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
 

Combining PacBio with short read technology for improved de novo genome assembly

  • 1. The best of both worlds Combining PacBio with short read technology for improved de novo genome assembly Lex Nederbragt, NSC and CEES lex.nederbragt@bio.uio.no
  • 3. Why does everybody want longer reads? … for genome assemblies
  • 4. What is a genome assembly Hierarchical structure reads contigs scaffolds
  • 5. Sequence data Reads reads contigs scaffolds original DNA fragments original DNA fragments Sequenced ends http://www.cbcb.umd.edu/research/assembly_primer.shtml
  • 6. Contigs Building contigs reads contigs scaffolds ACGCGATTCAGGTTACCACG GCGATTCAGGTTACCACGCG GATTCAGGTTACCACGCGTA TTCAGGTTACCACGCGTAGC CAGGTTACCACGCGTAGCGC Aligned reads GGTTACCACGCGTAGCGCAT TTACCACGCGTAGCGCATTA ACCACGCGTAGCGCATTACA CACGCGTAGCGCATTACACA CGCGTAGCGCATTACACAGA CGTAGCGCATTACACAGATT TAGCGCATTACACAGATTAG Consensus contig ACGCGATTCAGGTTACCACGCGTAGCGCATTACACAGATTAG
  • 7. Contigs Building contigs reads contigs scaffolds Repeat copy 1 Repeat copy 2 Contig orientation? Contig order? Collapsed repeat consensus http://www.cbcb.umd.edu/research/assembly_primer.shtml
  • 8. Mate pairs Other read type reads contigs scaffolds Repeat copy 1 Repeat copy 2 (much) longer fragments mate pair reads
  • 9. Scaffolds Ordered, oriented contigs reads contigs scaffolds mate pairs contigs gap size estimate
  • 10. What is a genome assembly Hierarchical structure reads ACGCGATTCAGGTTACCACG GCGATTCAGGTTACCACGCG GATTCAGGTTACCACGCGTA TTCAGGTTACCACGCGTAGC CAGGTTACCACGCGTAGCGC Aligned reads GGTTACCACGCGTAGCGCAT TTACCACGCGTAGCGCATTA ACCACGCGTAGCGCATTACA CACGCGTAGCGCATTACACA CGCGTAGCGCATTACACAGA contigs CGTAGCGCATTACACAGATT TAGCGCATTACACAGATTAG Consensus contig ACGCGATTCAGGTTACCACGCGTAGCGCATTACACAGATTAG scaffolds
  • 11. Genome assembly So, what’s so hard about it?
  • 12. 1) Repeats reads contigs scaffolds Repeat copy 1 Repeat copy 2 Repeats break up contigs Collapsed repeat consensus http://www.cbcb.umd.edu/research/assembly_primer.shtml
  • 13. 2) Heterozygosity Differences between sister * chromosomes * * http://commons.wikimedia.org/wiki/File:Chromosome_1.svg
  • 14. 2) Heterozygosity Polymorphic contig 2 Contig 1 Contig 4 Polymorphic contig 3
  • 16. 3) Many programs to choose from Zhang et al. (2011) doi:10.1371/journal.pone.0017915.g001
  • 17. Assembly: challenges Repeat copy 1 Repeat copy 2 Knowing how to use the programs Heterozygosity Polymorphic contig 2 Contig 1 Contig 4 Polymorphic contig 3
  • 18. So, why does everybody want longer reads? http://www.autobizz.com.my/forum/forum/General-Chat/944-The-worlds-longest-car.html
  • 19. Longer reads? Repeat copy 1 Repeat copy 2 Long reads can span repeats and heterozygous regions Polymorphic contig 2 Contig 1 Contig 4 Polymorphic contig 3
  • 20. PacBio to the rescue?
  • 21. High-throughput sequencing Library preparation SMRTBell'template' SMRTBell'template' Standard'Sequencing' Standard'Sequencing' Generates& pass& each& one& on& molecule& Insert& Large& Sizes& Generates& pass& each& one& on& molecule& Large Insert& Sizes Large& Sizes& Insert sequenced& Single pass sequenced& Circular'Consensus'Sequencing' Circular'Consensus'Sequencing' Continued generations of reads Small Insert Sizes& Small& Small& Insert& Sizes Insert& Sizes& Multiple mul8ple& passes passes& each& Generates& on& molecule& Generates& mul8ple& sequenced& passes& each& on& molecule& sequenced&
  • 22. High-throughput sequencing Raw read length
  • 23. High-throughput sequencing SMRTBell'template' Raw reads and subreads Standard'Sequencing' Generates& pass& each& one& on& molecule& Large Insert& Sizes Large& Sizes& Insert Single pass sequenced& ‘Subreads’ Circular'Consensus'Sequencing' Small Insert Sizes& Small&Insert& Sizes Multiple mul8ple& passes passes& each& Generates& on& molecule& sequenced&
  • 24. PacBio: uses SMRTBell'template' Long reads  low quality Standard'Sequencing' Generates& pass& each& one& on& molecule& Large Insert& Sizes Large& Sizes& Insert Single pass sequenced& 85-87% accuracy Circular'Consensus'Sequencing' Useful for assembly? Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced&
  • 26. Solutions for assembly (1) Designed by Pacific Biosciences http://www.clker.com/clipart-4245.html
  • 27. Solutions for assembly (2) Broad Institute Need a special recipe for sequencing
  • 28. Solutions for assembly (3) PacBioToCA Error correct with short reads Celera assembler http://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
  • 29. PacBioToCA Koren et al, 2012
  • 31. Shameless self-promotion @lexnederbragt
  • 32. The Atlantic cod genome project
  • 33. First draft Fragmented assembly - short contigs - many gap bases http://en.wikipedia.org
  • 34. First draft 6467 scaffolds 35% gap bases
  • 35. The causes Short Tandem Repeats (>20% of gaps)
  • 36. The causes Heterozygosity? Polymorphic contig 2 Contig 1 Contig 4 Polymorphic contig 3
  • 37. The goal 23 pseudochromosomes Longer contigs Below 5% gap bases PacBio to the rescue?
  • 38. The approach SMRTBell'template' Libraries Standard'Sequencing' Generates& pass& ea one& on& Large Insert& Sizes Large& Sizes& Insert sequenced& Aim for looooong insert sizes Circular'Consensus'Sequencing' Small& Insert& Sizes& Generates& mul8ple& passes sequenced&
  • 39. SMRTBell'template' The approach Sequencing Standard'Sequencing' Generates& pass& each& one& on& molecule& Large Insert& Sizes Large& Sizes& Insert Single pass sequenced& Sequence with 90 minute movies Circular'Consensus'Sequencing' Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& 10 x coverage in reads of at least 3000 bp sequenced& No, we don’t throw this away…
  • 41. PacBio results 100 Relative throughput at different minimum length cutoffs 10kb lib 2 Fraction of bases at minimum 10kb lib 1 length 4kb lib 80 Percentage of total sequence 60 40 20 0 0kbp 3kbp 5kbp 10kbp 15kbp Length cutoff longest subread Large library insert size important!
  • 42. chnology PacBio results SMRTBell'template' 64 SMRT Cells 3.2 Gigabytes in raw reads at least 3kb 3.8 x coverage 3 Standard'Sequencing' Generates& pass& each& one& on& molecule& Large Insert& Sizes Large& Sizes& Insert sequenced& 2.2 Gigabytes in longest subreads reads Circular'Consensus'Sequencing' Largest 15 kbp Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule&
  • 43. PacBio results Mapping to the cod genome 11.4 kbp subread 10.6 kbp subread 10.9 kbp subread
  • 44. Example 1 ACACAC repeat 232 bp Gap TGTGTG repeat
  • 47. Example 1 Scaffold ...ACACAC TGTGTG... PacBio reads Unplaced contig
  • 50. Example 2 Scaffold ...TGTGTG PacBio reads Heterozygosity?
  • 51. Example 3 Scaffold PacBio reads 300 bp misassembly?
  • 52. Error-correction Work In Progress http://openclipart.org/
  • 53. Outlook Will PacBio solve our problems?
  • 55. Outlook Polymorphic contig 2 Contig 1 Contig 4 Polymorphic contig 3 Will we find the heterozygous regions?