This document discusses next-generation sequencing (NGS) techniques and data relevant for metagenomics analyses. It provides an overview of how 454 and Illumina sequencing platforms work, the type of data generated, including read length and throughput. It also discusses quality control measures like assessing quality scores, filtering low quality reads and removing duplicates. The document demonstrates tools for quality control like Prinseq and FastQC, and filtering techniques including removing adapters and trimming low quality bases.
The presentation addresses the most typical issues during network software development and testing, explains the causes and suggests solutions:
- overlapping IP networks
- invalid netmasks
- incomplete routing configuration
- incorrect local MAC addresses
- unidirectional packet generator and unicast flood
- disabled ethernet auto negotiation
More on security visualization: http://secviz.org
In the network security world, event graphs are evolving into a useful data analysis tool, providing a powerful alternative to reading raw log data. By visually outlining relationships among security events, analysts are given a tool to intuitively draw conclusions about the current state of their network and to respond quickly to emerging issues.
I will be showing a myriad of graphs generated with data from various sources, such as Web servers, firewalls, network based intrusion detection systems, mail servers, and operating system logs. Each of the graphs will be used to show a certain property of the dataset analyzed. They will show anomalous behavior, misconfigurations and simply help document activities in a network.
As part of this talk, I will release a tool tool that can be used to experiment with generating event graphs. A quick tutorial will show how easy it is to generate graphs from security data of your own environment.
Video at: http://www.youtube.com/watch?v=5GK8mYumn6Q
The presentation addresses the most typical issues during network software development and testing, explains the causes and suggests solutions:
- overlapping IP networks
- invalid netmasks
- incomplete routing configuration
- incorrect local MAC addresses
- unidirectional packet generator and unicast flood
- disabled ethernet auto negotiation
More on security visualization: http://secviz.org
In the network security world, event graphs are evolving into a useful data analysis tool, providing a powerful alternative to reading raw log data. By visually outlining relationships among security events, analysts are given a tool to intuitively draw conclusions about the current state of their network and to respond quickly to emerging issues.
I will be showing a myriad of graphs generated with data from various sources, such as Web servers, firewalls, network based intrusion detection systems, mail servers, and operating system logs. Each of the graphs will be used to show a certain property of the dataset analyzed. They will show anomalous behavior, misconfigurations and simply help document activities in a network.
As part of this talk, I will release a tool tool that can be used to experiment with generating event graphs. A quick tutorial will show how easy it is to generate graphs from security data of your own environment.
Video at: http://www.youtube.com/watch?v=5GK8mYumn6Q
Systematic integration of millions of peptidoform evidences into Ensembl and ...Yasset Perez-Riverol
There is an increasing demand for approaches to integrate proteomics data with other ‘omics’ data types, especially genomics. In fact, current resources to integrate proteomics in a genome context are insufficient for large-scale studies. To bring the genomics and proteomics results into coherence, novel resources must be developed that provide simple links across previously acquired datasets with minimal preprocessing and hassle.
PRIDE (http://www.ebi.ac.uk/pride) and Ensembl (http://www.ensembl.org) are world-leading resources for proteomics and genomics data. We have developed a new resource and framework to enable a systematic integration of mass spectrometry (MS) based proteomics evidences into genome browsers. We automatically integrate every high-quality MS-based peptidoform reported in the PRIDE database, into genome coordinates through Ensembl, and other genome browsers.
Как HeadHunter удалось безопасно нарушить RFC 793 (TCP) и обойти сетевые лову...Ontico
В какой-то момент 3-й в мире работный сайт начал периодически падать на несколько минут. Сюрпризом стало то, что в этот раз действительно из-за сети.
Для масштабирования сервисов и их взаимодействия между собой hh.ru использует внутренний балансировщик. Обработку 25 тыс. запросов в секунду обеспечивают 5 серверов с nginx. Обращение к этим серверам балансирует коммутатор.
Я расскажу, как мы расследовали серию инцидентов, которая была вызвана нарушением протокола TCP при балансировке. И что мы придумали, чтобы продолжить безнаказанно его нарушать.
Как HeadHunter удалось безопасно нарушить RFC 793 (TCP) и обойти сетевые лову...Андрей Шорин
В какой-то момент 3-й в мире работный сайт начал периодически падать на несколько минут. Сюрпризом стало то, что в этот раз действительно из-за сети.
Для масштабирования сервисов и их взаимодействия между собой hh.ru использует внутренний балансировщик. Обработку 25 тыс. запросов в секунду обеспечивают 5 серверов с nginx. Обращение к этим серверам балансирует коммутатор.
Я расскажу, как мы расследовали серию инцидентов, которая была вызвана нарушением протокола TCP при балансировке. И что мы придумали, чтобы продолжить безнаказанно его нарушать.
True stories on the analysis of network activity using Pythondelimitry
The presentation from SPbPython community / PiterPy meetup.
The presentation tells about the problems of analysing the network activity of applications on Linux using Python. The following topics are covered: analysis of network packets, analysis of packet filters, packets crafting using Scapy, analysis of open ports.
Handy Networking Tools and How to Use ThemSneha Inguva
When I joined the networking team at DigitalOcean a few years ago, I dove into an entirely different world of software-defined networking in the data center. Virtual switches, networking protocols — these were concepts that I had encountered at the surface level before — but now I frequently found myself debugging them. With time, I came to rely on a variety of Linux networking tools for introspecting, troubleshooting, and examining network state. In this talk, I’ll share some of my favorite Linux networking tools and discuss scenarios in which they are quite helpful.
Systematic integration of millions of peptidoform evidences into Ensembl and ...Yasset Perez-Riverol
There is an increasing demand for approaches to integrate proteomics data with other ‘omics’ data types, especially genomics. In fact, current resources to integrate proteomics in a genome context are insufficient for large-scale studies. To bring the genomics and proteomics results into coherence, novel resources must be developed that provide simple links across previously acquired datasets with minimal preprocessing and hassle.
PRIDE (http://www.ebi.ac.uk/pride) and Ensembl (http://www.ensembl.org) are world-leading resources for proteomics and genomics data. We have developed a new resource and framework to enable a systematic integration of mass spectrometry (MS) based proteomics evidences into genome browsers. We automatically integrate every high-quality MS-based peptidoform reported in the PRIDE database, into genome coordinates through Ensembl, and other genome browsers.
Как HeadHunter удалось безопасно нарушить RFC 793 (TCP) и обойти сетевые лову...Ontico
В какой-то момент 3-й в мире работный сайт начал периодически падать на несколько минут. Сюрпризом стало то, что в этот раз действительно из-за сети.
Для масштабирования сервисов и их взаимодействия между собой hh.ru использует внутренний балансировщик. Обработку 25 тыс. запросов в секунду обеспечивают 5 серверов с nginx. Обращение к этим серверам балансирует коммутатор.
Я расскажу, как мы расследовали серию инцидентов, которая была вызвана нарушением протокола TCP при балансировке. И что мы придумали, чтобы продолжить безнаказанно его нарушать.
Как HeadHunter удалось безопасно нарушить RFC 793 (TCP) и обойти сетевые лову...Андрей Шорин
В какой-то момент 3-й в мире работный сайт начал периодически падать на несколько минут. Сюрпризом стало то, что в этот раз действительно из-за сети.
Для масштабирования сервисов и их взаимодействия между собой hh.ru использует внутренний балансировщик. Обработку 25 тыс. запросов в секунду обеспечивают 5 серверов с nginx. Обращение к этим серверам балансирует коммутатор.
Я расскажу, как мы расследовали серию инцидентов, которая была вызвана нарушением протокола TCP при балансировке. И что мы придумали, чтобы продолжить безнаказанно его нарушать.
True stories on the analysis of network activity using Pythondelimitry
The presentation from SPbPython community / PiterPy meetup.
The presentation tells about the problems of analysing the network activity of applications on Linux using Python. The following topics are covered: analysis of network packets, analysis of packet filters, packets crafting using Scapy, analysis of open ports.
Handy Networking Tools and How to Use ThemSneha Inguva
When I joined the networking team at DigitalOcean a few years ago, I dove into an entirely different world of software-defined networking in the data center. Virtual switches, networking protocols — these were concepts that I had encountered at the surface level before — but now I frequently found myself debugging them. With time, I came to rely on a variety of Linux networking tools for introspecting, troubleshooting, and examining network state. In this talk, I’ll share some of my favorite Linux networking tools and discuss scenarios in which they are quite helpful.
Email Marketing 3.0 Adapting to Mobile 1st WorldAffiliate Summit
This presentation is from Affiliate Summit West 2014 (January 12-14, 2014 in Las Vegas, NV). Session description: Most emails are opened on mobile devices but email marketers still send desktop optimized emails. Affiliates should think mobile first.
Utilizzare il social network più famoso del mondo per generare richieste di informazioni, contatti utili al business e aumentare il fatturato. Workshop tenuto a Smau Napoli il 10 dicembre 2015.
Ben Stoker text architecture as theology in theory and in practice at the chu...Historic England
Notes for Presentation by Ben Stoker, Development Officer, Diocese of Lincoln. "Architecture as theology in theory and in practice at the parish church of St John the Baptist, Lincoln". The presentation was given as part of a session on "Visions of Church and Churches in the 20th century" at a conference on parish church interiors supported by Historic England.
«Επιχειρηματικότητα και Πράσινη Στρατηγική» - Κάρολος ΠαπαδάςStarttech Ventures
Κάρολος Παπαδάς, Υποψήφιος Διδάκτωρ, Τμήμα Marketing & Επικοινωνίας, Οικονομικό Πανεπιστήμιο Αθηνών
Παρουσίαση Έρευνας: «Επιχειρηματικότητα και Πράσινη Στρατηγική»
Παρουσίαση που πραγματοποιηθηκε στο πλαίσιο του Ethos Sustainability Forum & Awards 2015
Xilinx vs Intel (Altera) FPGA performance comparison Roy Messinger
You're welcome to check out this interesting comparison I've conducted between these 2 vendors. Very interesting and surprising results (I did not expect such differences).
RNA-Seq Analysis: Everything You Always Wanted to Know...and then somebasepairtech
Computational biologist and Basepair founder, Dr. Amit Sinha (@ausinha) helps viewers navigate the world of RNA-Seq analysis. Topics include: Introduction to RNA-Seq, tools and workflows for analysis, visualization and figures, Q & A. More info at: https://www.basepairtech.com/
Imagine you're tackling one of these evasive performance issues in the field, and your go-to monitoring checklist doesn't seem to cut it. There are plenty of suspects, but they are moving around rapidly and you need more logs, more data, more in-depth information to make a diagnosis. Maybe you've heard about DTrace, or even used it, and are yearning for a similar toolkit, which can plug dynamic tracing into a system that wasn't prepared or instrumented in any way.
Hopefully, you won't have to yearn for a lot longer. eBPF (extended Berkeley Packet Filters) is a kernel technology that enables a plethora of diagnostic scenarios by introducing dynamic, safe, low-overhead, efficient programs that run in the context of your live kernel. Sure, BPF programs can attach to sockets; but more interestingly, they can attach to kprobes and uprobes, static kernel tracepoints, and even user-mode static probes. And modern BPF programs have access to a wide set of instructions and data structures, which means you can collect valuable information and analyze it on-the-fly, without spilling it to huge files and reading them from user space.
In this talk, we will introduce BCC, the BPF Compiler Collection, which is an open set of tools and libraries for dynamic tracing on Linux. Some tools are easy and ready to use, such as execsnoop, fileslower, and memleak. Other tools such as trace and argdist require more sophistication and can be used as a Swiss Army knife for a variety of scenarios. We will spend most of the time demonstrating the power of modern dynamic tracing -- from memory leaks to static probes in Ruby, Node, and Java programs, from slow file I/O to monitoring network traffic. Finally, we will discuss building our own tools using the Python and Lua bindings to BCC, and its LLVM backend.
Presentation of Fridtof Lund-Johansen in 1st International Antibody Validatio...St John's Laboratory Ltd
Fridtjof Lund-Johansen is an MDPhD who has worked for 30 years with antibodies and flow cytometry. He took his degree at the University of Bergen in Norway. He then did post-docs in California, first at Becton Dickinson in San Jose and then at DNAX instiute of Immunology in Palo Alto. He is now a PI at the Institute of Immunology at Oslo University Hospital where he leads an effort to develop antibody-based proteomics. His technology is called MAP for microsphere affinity proteomics. He will talk about how MAP can be used to test thousands of antibodies in parallel.
For more details about 1st international antibody validation forum please check on http://www.stjohnslabs.com/ac_cms/blog
A talk I gave at the Dec 2013 Assembly Masterclass at UC Davis. Really licensed under CC0. UPDATED May 2014, for the presentation I gave at the combined SeRC Nordic Assembly Workshop in Stockholm, Sweden, May 14th 2014
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...Lex Nederbragt
Un update of the previous talk with the same title. A talk I gave at the Computational Life Science initiative (University of Oslo) about new High Throughput Sequencing instruments at the Norwegian Sequencing Centre. I also mentioned future upgrades, and the upcoming nanopore sequencing platform of Oxford nanopore.
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...Lex Nederbragt
A talk I gave at the Microbiology Research Group (University of Oslo) about new High Throughput Sequencing instruments at the Norwegian Sequencing Centre. I also mentioned future upgrades, and the upcoming nanopore sequencing platform of Oxford nanopore
A talk I gave for my colleagues on how and why I use blogging and twitter for science, trying to convince them to start doing the same. DO check out the presenter notes! (see tab 'notes')
How to sequence a large eukaryotic genome - and how we sequenced the cod genome. A seminar I gave for the Computational Life Science (Univ. of Oslo) seminar series, September 28, 2011
Next generation sequencing: research opportunities and bioinformatic challenges. A seminar I gave for the Computational Life Science (Univ. of Oslo) seminar series, March 2, 2011
28. 454 Throughput GS FLX Titanium per-run output: Up to 1.5 million single-end reads Up to 600 megabases (Mb, million bases) Less for amplicons
29. Illumina throughput (HiSeq 2000) Variable length 50,100, (soon 150) single or paired-end per-run output: Up to 1 billion (109) single-end Up to 2 billion paired-end reads Up to 200 gigabases (Gb, billion bases) Soon: 3 times more reads and bases
30. What do you get? Errors! http://www.it.bton.ac.uk/staff/je/java/jewl/tutorial/tutorial.html
47. Illumina: fastq file @PCUS-319-EAS487_0004_FC:6:1:1351:952#0/1 CCAACATAGCTGGATGCCAACATAGCTGGATTGTTATAGCTGGTTTGCTTTTCTAACTCGCTGGAAGTTTATAAGCATTCCTACTATTTCATAGTATTAC +@PCUS-319-EAS487_0004_FC:6:1:1351:952#0/1 BBbfYcbV^BV`cQffaBZfB_fdfUYaa]`adcbfefcfd^cad^fOabRceb`beSbdfaad_e^^dbeedTbd`VcdfffYBddb^fae Quality score as characters: Phred score = ASCII value -33 'B' is ASCII 66 Phred 33
48. Illumina: fastq file @PCUS-319-EAS487_0004_FC:6:1:1351:952#0/1 CCAACATAGCTGGATGCCAACATAGCTGGATTGTTATAGCTGGTTTGCTTTTCTAACTCGCTGGAAGTTTATAAGCATTCCTACTATTTCATAGTATTAC +@PCUS-319-EAS487_0004_FC:6:1:1351:952#0/1 BBbfYcbV^BV`cQffaBZfB_fdfUYaa]`adcbfefcfd^cad^fOabRceb`beSbdfaad_e^^dbeedTbd`VcdfffYBddb^fae Matching pair in the other file: +@PCUS-319-EAS487_0004_FC:6:1:1351:952#0/2
49. FastQ formats Cock PJ et al 2009 The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Res. 2010 Apr;38(6):1767-71. and http://en.wikipedia.org/wiki/Fastq
58. Prinseq: contamination The dinucleotide odds ratios* Principal component analysis (PCA) *dinucleotide frequencies normalized for the base composition
66. Filtering/trimming Adaptor removal especially Illumina Duplicate removal Filtering for low quality bases or stretches of them reads with 'N's E.g. fastX toolkit prinseq
67. Other technologies Life Technologies SOLiD ionTorrent not much used for metagenomics Pacific Biosciences PacBio RS large potential