Downloaded 915 times
More Related Content
Similar to HLA sequencing - the barcode on your cells
HLA sequencing - the barcode on your cells
- 1. HLA Typing: Understanding the onyour cells. Swati Kadam, Ph.D.
- 2.
- 3. What is HLA? •HLA = Human Leukocyte Antigen • Immune cells read HLA-barcode on cells to help identify self vs. non self cells or uninfected vs. infected cells. – An immune response is triggered if a infected cell is identified. Y Y Y YY Y Y Y Y Y Y Y Y Y Y Y Infected cell T-cell Uninfected cell Uninfected cell Uninfected cell
- 4. • Any celldisplaying some other HLA type is "non-self" and is seen as an invader by the body's immune system, resulting in the rejection of the tissue bearing those cells. Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Non-self cell : INVADER T-cell Self cell Self cell Self cell What is HLA?
- 5. MHC Region MHC ClassII genes MHC Class III genes MHC Class I genes HLA-AHLA-C TNF C4 HLA-DQHLA-DP HLA-DR HLA-B MHC houses HLA genes Chromosome 6
- 6. MHC Region MHC ClassII genes MHC Class III genes MHC Class I genes HLA disease associations Chromosome 6 - Leprosy - Multiple Sclerosis - Lymphoid Leukemia - Rh(D) isoimmunization - Psoriasis - Ankylosing spondylitis - Hemophilia with synovitis - Malaria - Susceptibility or Resistance to HIV-1 - Type1 autoimmune hepatitis - ANCA-positive autoimmune disease - Multiple Sclerosis - Psoriasis - Systemic Lupus - Asthma - Childhood Acute Lymphoblastic Leukemia (ALL) - HIV-related disease - Thyroid Carcinoma - Nephropathy - Kawasaki disease - Celiac Disease http://ccg.murdoch.edu.au/private/yurek_kulski/mhc/Table4.html
- 7.
- 8. HLA status andcontrol over HIV infection - HIV controllers = HIV positive individuals that do not develop a clinical disease and do not progress to AIDS. - HLA Class I SNPs can determine whether you are a HIV controller or progressor http://aids.gov/hiv-aids-basics/hiv-aids-101/what-is-hiv-aids/ X X
- 9. HLA drug hypersensitivitytesting Allergy to Abacavir is strongly associated with the presence of the HLA-B*5701 gene
- 10. Gluten intolerance • Celiacdisease is an autoimmune disorder of the small intestine triggered by gluten consumption. • Over 95% of people with celiac have the isoform of DQ2 or DQ8, on Class II MHC genes.
- 11. • Organ transplantation •Hematopoietic stem cell transplant • HLA types associated with specific immune diseases. • Parental testing • Reduce instance of GVHD – Non-related donor – Related donor Importance of HLA typing
- 12. Did you know? •In the United States: – Nearly 120,000 need lifesaving organ transplants. – Every 10 minutes another name is added to the national organ transplant waiting list. – An average of 6000 people die each year from the lack of available organs for transplant. – In 2012, there were 14,013 Organ Donors resulting in 28,052 organ transplants. – More than 1 million tissue transplants are done each year and the surgical need for tissue has been steadily rising. • $230M worldwide transplant test market.
- 13. 1, 8, 10 3,14, 17 10, 16, 8 2, 7, 11 1, 8, 10 1, 8, 10 2, 7, 11 10, 16, 8 3, 14, 17 2, 7, 11 3, 14, 17 10, 16, 8 Mother Father Daughter 1 Daughter 2Son 1 Son 2 10, 16, 8 Son 3 1, 8, 10 Variation in HLA alleles even between siblings. Random and varied distribution of Haplotypes from each parent. High resolution typing provides a more accurate match Finding a match is not easy! Match
- 15. • Serotyping – Detectionof antibodies is serum (non sequencing based method). • Sanger sequencing of amplified regions – Amplicon sequencing of specific exon regions. • Sequence Specific Oligonucleotide Hybridization (SSO) – Oligo hybridization based detection of allele status. • (NGS) MHC sequencing for donor matching – Sequencing of entire MHC region. – Sequencing of amplicons for target regions. Typing Methods
- 16. Method About methodPros Cons Serotyping Non-sequencing based typing method where antibodies specific to HLA proteins are used to identify the proteins on the cell surface. - Low Cost - Rapid - Traditional - Crude Method - Protein based detection - Inaccurate typing - Protein binding to more than one serotype Sequence Specific Oligonucleotide Hybridization (SSO) Typing method where specific oligos are first designed for genes of interest and then hybridized to patient or donor DNA to check for hybridization. - Checking of specific target - Efficient - Cannot account for unrecorded alleles - Hybridization errors - Need to know target sequence - Cannot phase Sanger Sequencing Sanger sequencing or Sequencing by Termination (SBT) is a classical method used for sequencing specific regions of the MHC. - Used to sequence regions of interest - Fast - Base pair resolution - Coverage only 2x - Different HLA alleles share similar sequences, difficulty aligning. - Cannot phase Next-Gen Seq Performing long range PCR to amplify HLA genes in MHC region, fragmenting the amplified genes and then preforming deep sequencing. - Deep coverage (1000x) - Total MHC coverage - Rapid high throughput - Accurate and efficient - Phasing - Data Analysis Typing Methods
- 17.
- 18. http://hla.alleles.org/ We have justscratched the surface
- 20. Table S1: PCRprimers and estimated amplicon size for the 6 HLA genes Locus Forward primer Seq Reverse primer Seq Length (bp) HLA-A HLA-A_F7 ATCCTGGATACTCACGACGCGGAC HLA-A_R8 CATCAACCTCTCATGGCAAGAATTT 3398 HLA-C HLA-C_F4 GGCCGCCTGTACTTTTCTCAGCAG HLA-C_R3 CCATGGTGAGTTTCCCTGTACAAGAG 4440 HLA-B HLA-B_F3 AGGTGAATGGCTCTGAAAATTTGTCTC HLA-B_R3 AGAGTTTAATTGTAATGCTGTTTTGACACA 4296 HLA-DRB1 HLA-DRB1_F1 TGATTGACTTGCTGGCTGGTTTCTCATC HLA-DRB1_R2 GCATCCACAGAATCACATTTTCTAGTGTT 11899 HLA-DQB1 HLA-DQB1_F6 TCATGTGCTTCTCTTGAGCAGTCTGA HLA-DQB1_R7 TGTGACAGCAATTTTCTCTCCCCT 7118 HLA-DPB1 HLA-DPB1_F1 TGGTCCAACAGGATCACATTTATAAGTGT HLA-DPB1_R1 CCCAGTTTGGATGGTCTCTCAGCTCTT 13605 13,605bp 7,118bp 11,899bp 4,296bp 4,440bp 3,398bp Long range PCR Nextera MiSeq
- 21. • Nextera/MiSeq – Coverageof coding and non-coding HLA regions. – Nextera tagmentation protocol provides easier faster processing of samples – Greater depth delivers accuracy exceeding existing technologies. Sequencing
- 22. 1, 8, 10 3,14, 17 10, 16, 8 2, 7, 11 1, 8, 10 1, 8, 10 2, 7, 11 10, 16, 8 3, 14, 17 2, 7, 11 3, 14, 17 10, 16, 8 Mother Father Daughter 1 Daughter 2Son 1 Son 2 10, 16, 8 Son 3 1, 8, 10 Variation in HLA alleles even between siblings. Random and varied distribution of Haplotypes from each parent. Finding a match is not an easy task. Unique HLA fingerprint Match
- 23. • MiSeq installat HistoGenetics and DKMS Life Science Lab in Germany. High resolution HLA typing because: – Read length (2x250, 2x300) allows phasing – Highest accuracy and speed – 1000x Coverage • (consensus accuracy 99.999%) – No Homo polymer errors – Easier workflow MiSeq leads the way
- 24. • Analyze SNPs,allelic differences, status of microsatellites, and HLA typing all in one. • Basic SNP or genotyping analysis tool • IMGT-HLA database Data Analysis
- 25. Questions : Swatikadam, Ph.D. skadam@illumina.com Questions : Abizar Lakdawalla alakdawalla@illumina.com
- 26.
- 27. • Currently atabout 50 HLA related MiSeq installs in the last few months – DKMS. From Martin Allgaier’s install report: “DKMS Life Science Lab, a subsidiary of DKMS, is a state-of-the-art HLA tissue typing laboratory in Dresden, Germany performing all sequencing activities to MiSeq. This was the 11th (!!!) Miseq for this customer and they are still planning for more. Currently, there are no signs of switching to another platform as the MiSeq gives them the output and flexibility they need for their service.” – HistoGenetics. From Peter Kraus’ install report: “MiSeq Install Report for the first 10 of 20 total MiSeqs to be installed at HistoGenetics in Ossining, NY. HistoGenetics is a company that performs HLA typing as a service using sequencing assays” • Press release."We anticipate building on our leadership position and established success by leveraging the MiSeq platform," said Dr. Nezih Cereb, Chief Executive Officer and Co-founder of HistoGenetics. "Based on our experience with other technologies, we think the MiSeq's quality data output and simple workflow, combined with Illumina's commitment to work collaboratively, is the ideal solution to enable us to provide our customers with the superior results and turnaround time they require." Example: MiSeq installs in HLA labs
- 28. • Research customers –Association of HLA variants with disease • Inflammatory, infection susceptibility, cancer, etc. • More accurate cataloging of HLA types • Translational customers • Tissue registries • Marker validation for diseases • Clinical customers • Transplantation match – Registry – Confirmatory HLA sequencing: Business Opportunity $230M worldwide Software companies Conexio • SW market leader. Sanger legacy Omixon • FDA-compliance GenDx • mature SW, nice UI
Editor's Notes
- #2 Hello everyone. Thank you for joining in. Today’s talk is titled HLA typing: Understanding the barcode on your cells. My goal is to introduce HLA, it’s importance, current methods, and how Illumina’s technology can offer a benefit over existing methods and technologies. So let’s begin…Our bodies are equipped with an amazing barcoding mechanism
- #3 Just like in our day to day lives we use barcodes to identify objects and define them, allowing easier recognition and organization.Our body uses a similar tool to help scan and organize our body such that objects that don’t belong there are tagged for immediate removal or destruction.
- #4 So what is HLA? HLA stands for Human Leukocyte Antigen.HLA acts like a barcode on each of our cells to help the scanners of our body, which are our immune cells identify barcodes from infected cells that do not belong in our body.
- #5 What is interesting is that such a mechanism not only helps identify infected cells, but it also sees “non-self” cells as invaders. What does that mean?… Any cell that displays another type of HLA that is not something your own DNA encodes for is targeted. This can happen when an organ from a donor who’s HLA type does not match your own is transplanted, leading to organ rejection or Graft versus host diseases.Now that we know what HLA is, lets take a closer look at the genes that encode these barcodes.
- #6 The Major Histocompatibility Complex (MHC) on Chromosome 6 houses Human Leukocyte Antigen (HLA) genes.The MHC region is distributed into three classes. Class I, Class II and Class III genes. Of which the Class II and Class I genes are important during transplantation to reduce the chances of rejection or disease. This MHC region is the most polymorphic region in the human genome, meaning there are multiple variants of each gene within the population as a whole.
- #7 What is interesting is that polymorphisms in this region associate with multiple diseases. I have listed a few here, most of which are autoimmune.
- #8 Here is a more comprehensive list of the diseases that associate with SNPs in specific regions of the MHC.I mean just look at the amount of information that is hidden within this region. A 4Mbp region can provide information and predict more than 70 disease states (a few examples are).-Height, Hypothyroidism, Bipolar disorder, Menopause, Lung cancer, -Arthiritis, Parkinsons, Total cholesterol-Type1 Diabetes, Nephropathy, Celiac disease-Kawesaki diseaseThe list goes on. It’s unimaginable how such a tiny region in the genome can show associations with so many diseases and disorders.
- #9 Polymorphisms in HLA have control over your susceptibility or protection from the HIV virus. The HIV virus attacks your T-cells (important part of your scanning system) and makes copies of it self. So the virus hijacks your scanner, which then compromises its ability to read barcodes.Research by the International HIV controllers Study performed a Genome-wide association analysis in multiethnic cohort of HIV-1 controllers and progressors and analyzed the effects of individual amino acids within the classical HLA proteins. Where more than 300 SNPs were located within the MHC and none else. So what are HIV controllers and progressors?HIV controllers are HIV positive patients that are less likely to transmit HIV to others and do not develop a clinical disease. They also maintain stable CD4+ cell counts (usually declines in HIV positive individuals as the disease progresses to AIDS). These 'HIV controllers' do not require treatment, because their bodies suppress the replication of the virus, since they do not develop AIDS.Polymorphisms within this region on the MHC can determine whether you are a controller (do not develop AIDS) or a progressor after a HIV infection.
- #10 Allergies to various drugs is also associated with specific SNPs in the MHC region.For those that are diagnosed as HIV positive are treated with a drug called Abacavir, but about 5-8% of HIV positive patients have hypersensitivity to anti-retroviral drug Abacavir, which is the first line of defense in HIV treatment.Currently a skin test that takes 24-48 hours is used to test for allergies and is not consistent between ethnic backgrounds. The test had a 44% sensitivity amongst white patients and 14% sensitivity amongst black patients with a clinically suspected hypersensitivity reaction. Sequencing on the other hand can provide more robust and clear indications of allergies to drugs.
- #11 Another disease that is associated with SNPs in the MHC is Celiac disease, which is an immune reaction to eating gluten, a protein found in wheat, barley and rye. Eating gluten triggers an immune response and damages the lining of the intestine. There's no cure for celiac disease — but following a strict gluten-free diet can help manage symptoms and promote intestinal healing. LabCorp provides sequencing services to sequence the HLADQ genes to determine celiac disease.
- #12 So far we have explored the role of HLA in disease associations, but wait there is more!HLA typing plays a crucial role during organ or stem cell transplant. It can also be used for Parental testing and to reduce the instance of Graft versus Host Disease (GVHD)
- #13 A Higher HLA typing resolution can assure fewer chances of organ rejection and more accurate patient-donor matching. This is pretty big with a 230M worldwide transplant test market.
- #14 Everyone’s HLA type is very unique. For instance a mother and father have a specific HLA type, their children then have the probability to have a distinct HLA type depending on which Haplotype they inherit, as you can see here it makes it even difficult for siblings to be a close match. High resolution HLA typing can provide a more accurate match in a shorter time frame, where with sequencing a larger database can be scanned for potential matches faster.
- #15 A novel by Jodi Picoult, My sister’s keeper, now a feature film, is about a small girl who was born as a donor for her older sister that was affected by a fatal disease. The story is about a savior sibling. Surprisingly, this is not a matter of fiction, but is real and is an option desperate parents make to save their children. Let’s talk about how a savior sibling is created. Multiple embryos are created and preimplantation genetic diagnosis is used to detect and select ones that are free of a genetic disorder and that are also a HLA match for an existing sibling who requires a transplant.
- #16 Serotyping is a non-sequencing based method, which detect the presence of certain antibodies in serum, providing information about HLA type.Sanger sequencing of specific exon regions can be performed for HLA typing informationA method called SSO or sequence specific oligonucleotide hybridization detects polymorphisms. DNA probes for various regions are spotted onto a membrane. Upon hybridization of designed oligos to patient DNA a detectable signal is given off, indicating a specific HLA genotype.For NGS methods either the entire MHC region can be sequenced or targettedamplicon sequencing can be performed, depending on what is being tested.
- #18 As you can see the nomenclature designations can be rather complex, reminding us how polymorphic and variable these genes can be.Each number is a digit and current methods are able to give information of upto 4 digits only.
- #19 More and more alleles are being identified as higher resolution technology becomes available. As we identify more alleles we can better understand their associations with diseases as well as better be able to identify a specific HLA type.This is pretty exciting, getting an indepth look on the HLA alleles provides a more comprehensive map of the MHC region.We have just scratched the surface and we a long ways away from identifying all the alleles present within the human population.
- #20 This is a great paper by Hosomichi et al provides a protocol for phase defined sequencing of HLA using Nextera and Illumina sequencing technology.
- #21 They performed long range PCR of regions within the MHC (highlighted in red) and used nextera kit to perform tagmentation and miseq for sequencing. Here we have primer information for those interested in using this protocol for analyses.This paper provides an easy and fast protocol that addresses multiple things:Provides high resolution HLA typing – which allowed the group to detect new allelesWe can get phasing informationInstead of the only 4-digit HLA information, we can now get resolution for upto 8-digits (almost double the information) – which means more accurate typing.
- #22 Just to conclude the Nextera/MiSeq approach.
- #23 Lets recall how difficult it is to find a match, where even finding a match within siblings can be extremely difficult. Faster processing of samples and greater more accurate coverage can allow for searching a larger repository of donors to find a close match.A mismatch can lead to diseases and or organ rejection. With such a shortage of organ donors and an ever increasing demand for organs, it becomes crucial to get accurate, higher resolution HLA typing information. Such that a correct match can be made, preventing further disease or organ rejection.
- #24 We have recently performed two large installs of the MiSeq. At HistoGenetics and DKMS Life science lab. HistoGenetics performshigh-resolution HLA Sequence-Based Typing (SBT) services. DKMS a subsidiary of DKMS life science lab is a tissue typing laboratory. So we can see that the demand and interest for high resolution of HLA typing is increasing.MiSeq offers a benefit over other technologies as it provides higher resolution:
- #25 Some ways to analyze the data is by simply performing basic SNP analysis using the IMGT-HLA database. I have some examples provided here, such as HLAminer and Omixion analysis tools, but there are many mature tools available which takes raw data and generates information about the HLA barcode in a semi-automated manner.
- #26 Just imagine the plethora of information we can get from deciphering the HLA-barcode. Current technology has now made it possible to dig deeper. We can predict diseases, improve organ transplant rates, and eventually save lives.So let’s crack the code with current tools and knowledge and decipher the HLA-barcode so we can better understand our body and what exactly our MHC has in store for us.