http://www.fao.org/about/meetings/wgs-on-food-safety-management/en/ The GMI initiative - and its working groups. Presentation from the Technical Meeting on the impact of Whole Genome Sequencing (WGS) on food safety management -23-25 May 2016, Rome, Italy.

1. The GMI initiative
- and its working groups
Michael Fam Chair Professor
Food Science and Technology
Jørgen Schlundt

2. Kikd off in
brussels
2011
Growing
the
network
First
results
&
pilots
Creating
feritle
ground
agtcagtcacagtacaagtcagtcacagtacaagtcagtcacagtaca
I
---
-
Database(s) in the Cloud
Diagnosis
Whole Genome
Sequencing
Patient / Food
,Food & Disease
Surveillance
Global Prevention
GMI – The idea

3. Global Microbial Identifier
A global system will enable three major lines of action:
• Simple identification of all microorganisms in clinical
(or other) settings, enabling reduction of total time
(and cost) for characterization down to typical time
needed to obtain the original isolate
• A total database of unique sequences of all relevant
microbiological strains globally, enabling real-time
global surveillance of disease developments
• A backbone of Microbial DNA sequences to be used
for deep sequencing analyses from different sources
(gut, sewage, environment, food?)

4. Virus – Bacteria – Parasites
Same - Same
www.globalmicrobialidentifier.org

5. GMI Steering Committee
Eric Brown, Food and Drug Administration (FDA), USA
Vincenco Caporale, World Organization of Animal Health (OIE)
Amy Cawthorne, World Health Organization (WHO), Switzerland
Paul Cook, Food Standards Agency (FSA), UK
David Heymann, Health Protection Agency, UK
Marion Koopmans, Erasmus Medical Centre, Netherlands
David J. Lipman, Nat. Center for Biol. Information (NCBI), USA
Pathom Sawanpanyalert, Ministry of Public Health, Thailand
Jørgen Schlundt, Nanyang Technological University, Singapore
Masami T. Takeuchi, Food and Agriculture Organization (FAO)
Jianguo XU, National Institute for CDC, China

6. GMI - according to the Charter
GMI consists of
The Platform
(organizing body, including e.g. the Steering Committee
and the Working Groups) and
The Community Network
(all individuals and organizations that subscribe to the GMI
Website by filling in a profile)
The Work Groups
Four WGs – originally five
Structuring of GMI must aim to continue to minimize bureaucracy whilst
maximizing the flexibility that has characterized GMI thus far.

7. WG1: Political challenges, outreach
and building a global network
Chair: Jorgen Schlundt, Co-chair: Pathom Sawanpanyalert
Developing a long-term plan to shape political level involvement in
GMI development at the global, regional and national level.
Attempting to establish a functional link to political level decision
makers in several countries or regional, international organizations.
Initiate a coherent system for international discussion of relevant
themes, e.g.
› global health diplomacy,
› coordination between different sectors,
› sensitivity of metadata,
› open access database of genome sequences,
› sharing of strains over borders,
› intellectual property rights (IPR), and
› funding.

8. WG2: Repository and storage of
sequence and meta-data
Chair: Bill Klimke, Co-chair: Guy Coachrane
Developing a format to capture ”Minimum Data for Matching
(MDM)”, consisting of reads and minimum metadata.
The MDM may or may not be accompanied by assemblies and/or
annotation and/or additional metadata.
Ideally, any MDM provided for purposes of searching the GMI
databases should immediately also become a deposit available for
searching by later submitters.
The search and analytical layers may be provided by INSDC
members or by other parties (International Nucleotide Sequence Database Collaboration)
Aiming for a centrally controlled searching and reporting protocol
that official sites adhere to and to whom relevant agencies submit

9. WG3: Analytical approaches
Chair: Marion Koopmans, Co-chair: Marc Allard
Providing guidance for the development of analytical tools for the
optimal functioning of the GMI platform.
Develop a global platform (database, linked databases) that
facilitates the application of NGS in research, clinical and public
health settings worldwide
Define requirements for GMI functioning from the perspective of
end-users (clinical, public health, food safety, research) in terms of
applications (identification, outbreak detection etc.) and priority
targets/diseases
Map current analytical options and solutions against the needs of
GMI end-users, to identify possible R&D and implementation gaps
and to identify projects that may fill those gaps

10. WG4: Ring trials and quality assurance
Chair: Rene Hendriksen, Co-chairs: James Pettengill, Errol Strain
Aiming for all laboratories globally to conduct NGS on bacteria and
virus to the highest degree of quality
Establishing a proficiency testing (PT) WGS infrastructure for GMI
and other partners to ensure high quality and reliable data.
Roll out of PT focusing on testing the quality of sequencing
bacterial DNA as well as cluster analysis on sets of genomes
Initiate virus pilot PT scheme initially focusing on identification of
virus in matrices from metagenomics sequencing data

11. WG5: Pilot Projects
Steering Committee decided “to retire working
group 5 and discuss a new communication
outreach effort at the GMI9 meeting.”
WG 1-4 are suggested to initiate such
discussions in the Break-out sessions