SlideShare a Scribd company logo
1 of 35
Download to read offline
Whole genome sequencing in
public health microbiology
A/Prof Torsten Seemann
Victorian Life Sciences Computation Initiative (VLSCI)
Microbiological Diagnostic Unit Public Health Laboratory (MDU PHL)
Doherty Centre for Applied Microbial Genomics (DCAMG)
The University of Melbourne
MDU/VIDRL Mini Seminar - Melbourne, AU - Wed 17 June 2015
The one true assay?
Traditional workflow
Whole Genome Sequencing (WGS)
2-10 Mbp
100-300 bp
30-100x depth
Simple?“Analysis” and “Results”
The promise of genomics
∷ A single assay
∷ Cheaper
∷ Faster
∷ High throughput
∷ Full single nucleotide resolution
Utility of WGS
∷ Diagnostics
: strain level identification
: in silico antibiogram and virulence profile
∷ Surveillance
: in silico genotyping - MLST, serotyping, VNTR, MLVA
: what’s lurking in our hospital/community?
∷ Forensics
: outbreak detection
: source tracking
Modern workflow
Does it deliver?
∷ In general, YES
∷ But it does NOT replace good epidemiology
∷ WGS is a just another (powerful) tool
∷ Need proper bioinformatics
Got my reads. Now what?
Aligning to reference
AGTCTGATTAGCTTAGCTTGTAGCGCTATATTAT
AGTCTGATTAGCTTAGAT
ATTAGCTTAGATTGTAG
CTTAGATTGTAGC-C
TGATTAGCTTAGATTGTAGC-CTATAT
TAGCTTAGATTGTAGC-CTATATT
TAGATTGTAGC-CTATATTA
TAGATTGTAGC-CTATATTAT
SNP Deletion
Reference based analysis
∷ Implies you have a “close” reference
: need to be careful with draft genomes
∷ Very sensitive
: single mutation precision
∷ Core genome only
: ignores novel DNA in your isolate
De novo genome assembly
De novo analyses
∷ Does not require a reference
∷ Access to whole pan-genome
: new plasmids
: unexpected antibiotic resistance elements
: virulence factors
∷ Limited by short reads
: misleading results in repeated regions
: not suitable for high-res SNP analysis
Best practice
∷ Use both approaches
: reference-based + de novo
∷ Best of both worlds
: and worst of both worlds - interpretation is non-trivial
∷ Still need
: good epidemiology, metadata and domain knowledge!
Limitations
Sequencing bias
Isolate genome
Sequenced reads
Other isolates in
sequencing run
Contamination
Unsequenced
regions
Read length
250 bp - Illumina - $100 8000 bp - Pacbio - $1000
Repeats
Repeat copy 1 Repeat copy 2
Collapsed repeat consensus
1 locus
4 contigs
Inferring transmission
∷ Identical
sequence
does not imply
transmission
∷ Easier to rule
out than in
Cutting edge web tools
Real time
tracking of
seasonal
influenza
virus
evolution in
humans
nextflu.org
ebola.nextflu.org
mers.nextflu.org
Drag genomes.
Calculates:
∷ tree
∷ MLST
∷ resistome
Add metadata
∷ source
∷ location
∷ colours
wgsa.net
Visualise and explore trees linked to genome
data. Just upload .nwk and .csv!
microreact.org
Sharing data
Open science
∷ Crowd-sourcing provably works
: EHEC outbreak 2011
: Ebola
: MERS
∷ But only if people share
: sequencing data
: metadata
: software source code for analysis
GenomeTrakr
∷ International cooperation
: Led by FDA + NCBI
: >20 collaborating institutes inc. UK PHE, DK DTU, MX
: Salmonella and Listeria
∷ Public SRA BioProject #183844
: Real-time submission of WGS genome reads
: Nightly updates of phylogenomic trees
: Contains ~8000 strains of Salmonella
“GenomeTrakka”
∷ A shared online system for all Australian labs
: upload samples
: automated standard/specific analyses
: simple reports and visualization
: easy to submit to international archives (SRA)
∷ Access control
: each lab controls their own data
: jurisdictions can share data in national outbreaks
Conclusion
Acknowledgements
∷ Slide source material
: Nick Loman
: Jennifer Gardy
: Rob Beiko
∷ Slide feedback
: Jason Kwong
: Dieter Bulach
Contact
∷ http://tseemann.github.io
∷ t.seemann@unimelb.edu.au
∷ @torstenseemann
The End
Thank you for listening.

More Related Content

What's hot

NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...VHIR Vall d’Hebron Institut de Recerca
 
'Novel technologies to study the resistome'
'Novel technologies to study the resistome''Novel technologies to study the resistome'
'Novel technologies to study the resistome'Willem van Schaik
 
Dr. Douglas Marthaler - Use of Next Generation Sequencing for Whole Genome An...
Dr. Douglas Marthaler - Use of Next Generation Sequencing for Whole Genome An...Dr. Douglas Marthaler - Use of Next Generation Sequencing for Whole Genome An...
Dr. Douglas Marthaler - Use of Next Generation Sequencing for Whole Genome An...John Blue
 
Building bioinformatics resources for the global community
Building bioinformatics resources for the global communityBuilding bioinformatics resources for the global community
Building bioinformatics resources for the global communityExternalEvents
 
Analysis of binning tool in metagenomics
Analysis of binning tool in metagenomicsAnalysis of binning tool in metagenomics
Analysis of binning tool in metagenomicsDr. sreeremya S
 
Discovery and Annotation of Novel Proteins from Rumen Gut Metagenomic Sequenc...
Discovery and Annotation of Novel Proteins from Rumen Gut Metagenomic Sequenc...Discovery and Annotation of Novel Proteins from Rumen Gut Metagenomic Sequenc...
Discovery and Annotation of Novel Proteins from Rumen Gut Metagenomic Sequenc...Mick Watson
 
Bioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesisBioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesisDespoina Kalfakakou
 
20170209 ngs for_cancer_genomics_101
20170209 ngs for_cancer_genomics_10120170209 ngs for_cancer_genomics_101
20170209 ngs for_cancer_genomics_101Ino de Bruijn
 
Sophie F. summer Poster Final
Sophie F. summer Poster FinalSophie F. summer Poster Final
Sophie F. summer Poster FinalSophie Friedheim
 
Basic knowledge of_viral_metagenome_vanshika-varshney
Basic knowledge of_viral_metagenome_vanshika-varshneyBasic knowledge of_viral_metagenome_vanshika-varshney
Basic knowledge of_viral_metagenome_vanshika-varshneyVanshikaVarshney5
 
Advancing the Metagenomics Revolution
Advancing the Metagenomics RevolutionAdvancing the Metagenomics Revolution
Advancing the Metagenomics RevolutionLarry Smarr
 
Viral Metagenomics (CABBIO 20150629 Buenos Aires)
Viral Metagenomics (CABBIO 20150629 Buenos Aires)Viral Metagenomics (CABBIO 20150629 Buenos Aires)
Viral Metagenomics (CABBIO 20150629 Buenos Aires)bedutilh
 
Studying the microbiome
Studying the microbiomeStudying the microbiome
Studying the microbiomeMick Watson
 

What's hot (20)

NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
 
Proposal for 2016 survey of WGS capacity in EU/EEA Member States
Proposal for 2016 survey of WGS capacity in EU/EEA Member StatesProposal for 2016 survey of WGS capacity in EU/EEA Member States
Proposal for 2016 survey of WGS capacity in EU/EEA Member States
 
Introduction to Metagenomics Data Analysis - UEB-VHIR - 2013
Introduction to Metagenomics Data Analysis - UEB-VHIR - 2013Introduction to Metagenomics Data Analysis - UEB-VHIR - 2013
Introduction to Metagenomics Data Analysis - UEB-VHIR - 2013
 
'Novel technologies to study the resistome'
'Novel technologies to study the resistome''Novel technologies to study the resistome'
'Novel technologies to study the resistome'
 
Big data nebraska
Big data nebraskaBig data nebraska
Big data nebraska
 
Dr. Douglas Marthaler - Use of Next Generation Sequencing for Whole Genome An...
Dr. Douglas Marthaler - Use of Next Generation Sequencing for Whole Genome An...Dr. Douglas Marthaler - Use of Next Generation Sequencing for Whole Genome An...
Dr. Douglas Marthaler - Use of Next Generation Sequencing for Whole Genome An...
 
Pattemore 2015
Pattemore 2015Pattemore 2015
Pattemore 2015
 
Building bioinformatics resources for the global community
Building bioinformatics resources for the global communityBuilding bioinformatics resources for the global community
Building bioinformatics resources for the global community
 
Analysis of binning tool in metagenomics
Analysis of binning tool in metagenomicsAnalysis of binning tool in metagenomics
Analysis of binning tool in metagenomics
 
Discovery and Annotation of Novel Proteins from Rumen Gut Metagenomic Sequenc...
Discovery and Annotation of Novel Proteins from Rumen Gut Metagenomic Sequenc...Discovery and Annotation of Novel Proteins from Rumen Gut Metagenomic Sequenc...
Discovery and Annotation of Novel Proteins from Rumen Gut Metagenomic Sequenc...
 
Bioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesisBioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesis
 
Testing for Food Authenticity
Testing for Food AuthenticityTesting for Food Authenticity
Testing for Food Authenticity
 
Proof of concept of WGS based surveillance: meningococcal disease
Proof of concept of WGS based surveillance: meningococcal diseaseProof of concept of WGS based surveillance: meningococcal disease
Proof of concept of WGS based surveillance: meningococcal disease
 
20170209 ngs for_cancer_genomics_101
20170209 ngs for_cancer_genomics_10120170209 ngs for_cancer_genomics_101
20170209 ngs for_cancer_genomics_101
 
Sophie F. summer Poster Final
Sophie F. summer Poster FinalSophie F. summer Poster Final
Sophie F. summer Poster Final
 
Basic knowledge of_viral_metagenome_vanshika-varshney
Basic knowledge of_viral_metagenome_vanshika-varshneyBasic knowledge of_viral_metagenome_vanshika-varshney
Basic knowledge of_viral_metagenome_vanshika-varshney
 
Listeria monocytogenes from population structure to genomic epidemiology
Listeria monocytogenes from population structure to genomic epidemiologyListeria monocytogenes from population structure to genomic epidemiology
Listeria monocytogenes from population structure to genomic epidemiology
 
Advancing the Metagenomics Revolution
Advancing the Metagenomics RevolutionAdvancing the Metagenomics Revolution
Advancing the Metagenomics Revolution
 
Viral Metagenomics (CABBIO 20150629 Buenos Aires)
Viral Metagenomics (CABBIO 20150629 Buenos Aires)Viral Metagenomics (CABBIO 20150629 Buenos Aires)
Viral Metagenomics (CABBIO 20150629 Buenos Aires)
 
Studying the microbiome
Studying the microbiomeStudying the microbiome
Studying the microbiome
 

Viewers also liked

What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - ...
What can we do with microbial WGS data?  - t.seemann - mc gill summer 2016 - ...What can we do with microbial WGS data?  - t.seemann - mc gill summer 2016 - ...
What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - ...Torsten Seemann
 
Toolbox for bacterial population analysis using NGS
Toolbox for bacterial population analysis using NGSToolbox for bacterial population analysis using NGS
Toolbox for bacterial population analysis using NGSMirko Rossi
 
Whole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiologyWhole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiologyPhilip Ashton
 
A Comparison of NGS Platforms.
A Comparison of NGS Platforms.A Comparison of NGS Platforms.
A Comparison of NGS Platforms.mkim8
 
NGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platformsNGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platformsAnnelies Haegeman
 
The Global Micorbial Identifier (GMI) initiative - and its working groups
The Global Micorbial Identifier (GMI) initiative - and its working groupsThe Global Micorbial Identifier (GMI) initiative - and its working groups
The Global Micorbial Identifier (GMI) initiative - and its working groupsExternalEvents
 
Aug2015 deanna church analytical validation
Aug2015 deanna church analytical validationAug2015 deanna church analytical validation
Aug2015 deanna church analytical validationGenomeInABottle
 
Genome Wide Methodologies and Future Perspectives
 Genome Wide Methodologies and Future Perspectives Genome Wide Methodologies and Future Perspectives
Genome Wide Methodologies and Future PerspectivesBrian Krueger
 
Whole Genome Sequencing (WGS): How significant is it for food safety?
Whole Genome Sequencing (WGS): How significant is it for food safety? Whole Genome Sequencing (WGS): How significant is it for food safety?
Whole Genome Sequencing (WGS): How significant is it for food safety? FAO
 
The Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome SequencingThe Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome SequencingEmiliano De Cristofaro
 
Innovative NGS Library Construction Technology
Innovative NGS Library Construction TechnologyInnovative NGS Library Construction Technology
Innovative NGS Library Construction TechnologyQIAGEN
 
DNA Sequencing from Single Cell
DNA Sequencing from Single CellDNA Sequencing from Single Cell
DNA Sequencing from Single CellQIAGEN
 
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practiceAug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practiceGenomeInABottle
 
Tools for Metagenomics with 16S/ITS and Whole Genome Shotgun Sequences
Tools for Metagenomics with 16S/ITS and Whole Genome Shotgun SequencesTools for Metagenomics with 16S/ITS and Whole Genome Shotgun Sequences
Tools for Metagenomics with 16S/ITS and Whole Genome Shotgun SequencesSurya Saha
 
Plant genome sequencing and crop improvement
Plant genome sequencing and crop improvementPlant genome sequencing and crop improvement
Plant genome sequencing and crop improvementRagavendran Abbai
 
Exploring Spark for Scalable Metagenomics Analysis: Spark Summit East talk by...
Exploring Spark for Scalable Metagenomics Analysis: Spark Summit East talk by...Exploring Spark for Scalable Metagenomics Analysis: Spark Summit East talk by...
Exploring Spark for Scalable Metagenomics Analysis: Spark Summit East talk by...Spark Summit
 
Next Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewNext Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewDominic Suciu
 
Bioinformática Introdução (Basic NGS)
Bioinformática Introdução (Basic NGS)Bioinformática Introdução (Basic NGS)
Bioinformática Introdução (Basic NGS)Renato Puga
 

Viewers also liked (20)

What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - ...
What can we do with microbial WGS data?  - t.seemann - mc gill summer 2016 - ...What can we do with microbial WGS data?  - t.seemann - mc gill summer 2016 - ...
What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - ...
 
Toolbox for bacterial population analysis using NGS
Toolbox for bacterial population analysis using NGSToolbox for bacterial population analysis using NGS
Toolbox for bacterial population analysis using NGS
 
Introduction to next generation sequencing
Introduction to next generation sequencingIntroduction to next generation sequencing
Introduction to next generation sequencing
 
Whole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiologyWhole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiology
 
A Comparison of NGS Platforms.
A Comparison of NGS Platforms.A Comparison of NGS Platforms.
A Comparison of NGS Platforms.
 
NGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platformsNGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platforms
 
The Global Micorbial Identifier (GMI) initiative - and its working groups
The Global Micorbial Identifier (GMI) initiative - and its working groupsThe Global Micorbial Identifier (GMI) initiative - and its working groups
The Global Micorbial Identifier (GMI) initiative - and its working groups
 
Aug2015 deanna church analytical validation
Aug2015 deanna church analytical validationAug2015 deanna church analytical validation
Aug2015 deanna church analytical validation
 
Poster ESHG
Poster ESHGPoster ESHG
Poster ESHG
 
Genome Wide Methodologies and Future Perspectives
 Genome Wide Methodologies and Future Perspectives Genome Wide Methodologies and Future Perspectives
Genome Wide Methodologies and Future Perspectives
 
Whole Genome Sequencing (WGS): How significant is it for food safety?
Whole Genome Sequencing (WGS): How significant is it for food safety? Whole Genome Sequencing (WGS): How significant is it for food safety?
Whole Genome Sequencing (WGS): How significant is it for food safety?
 
The Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome SequencingThe Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome Sequencing
 
Innovative NGS Library Construction Technology
Innovative NGS Library Construction TechnologyInnovative NGS Library Construction Technology
Innovative NGS Library Construction Technology
 
DNA Sequencing from Single Cell
DNA Sequencing from Single CellDNA Sequencing from Single Cell
DNA Sequencing from Single Cell
 
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practiceAug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practice
 
Tools for Metagenomics with 16S/ITS and Whole Genome Shotgun Sequences
Tools for Metagenomics with 16S/ITS and Whole Genome Shotgun SequencesTools for Metagenomics with 16S/ITS and Whole Genome Shotgun Sequences
Tools for Metagenomics with 16S/ITS and Whole Genome Shotgun Sequences
 
Plant genome sequencing and crop improvement
Plant genome sequencing and crop improvementPlant genome sequencing and crop improvement
Plant genome sequencing and crop improvement
 
Exploring Spark for Scalable Metagenomics Analysis: Spark Summit East talk by...
Exploring Spark for Scalable Metagenomics Analysis: Spark Summit East talk by...Exploring Spark for Scalable Metagenomics Analysis: Spark Summit East talk by...
Exploring Spark for Scalable Metagenomics Analysis: Spark Summit East talk by...
 
Next Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewNext Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology Overview
 
Bioinformática Introdução (Basic NGS)
Bioinformática Introdução (Basic NGS)Bioinformática Introdução (Basic NGS)
Bioinformática Introdução (Basic NGS)
 

Similar to WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015

Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...Torsten Seemann
 
2015 06-12-beiko-irida-big data
2015 06-12-beiko-irida-big data2015 06-12-beiko-irida-big data
2015 06-12-beiko-irida-big databeiko
 
Sequencing Genomics: The New Big Data Driver
Sequencing Genomics:The New Big Data DriverSequencing Genomics:The New Big Data Driver
Sequencing Genomics: The New Big Data DriverLarry Smarr
 
2017 09-07 Global Virome Project
2017 09-07 Global Virome Project2017 09-07 Global Virome Project
2017 09-07 Global Virome ProjectThe End Within
 
Discovering Yourself with Computational Bioinformatics
Discovering Yourself with Computational BioinformaticsDiscovering Yourself with Computational Bioinformatics
Discovering Yourself with Computational BioinformaticsLarry Smarr
 
GenomeTrakr: Whole-Genome Sequencing for Food Safety and A New Way Forward in...
GenomeTrakr: Whole-Genome Sequencing for Food Safety and A New Way Forward in...GenomeTrakr: Whole-Genome Sequencing for Food Safety and A New Way Forward in...
GenomeTrakr: Whole-Genome Sequencing for Food Safety and A New Way Forward in...ExternalEvents
 
01 Slide_Oscar
01 Slide_Oscar01 Slide_Oscar
01 Slide_OscarOscar Chan
 
Emerging challenges in data-intensive genomics
Emerging challenges in data-intensive genomicsEmerging challenges in data-intensive genomics
Emerging challenges in data-intensive genomicsmikaelhuss
 
DNA analysis on your laptop: Spot the differences
DNA analysis on your laptop: Spot the differencesDNA analysis on your laptop: Spot the differences
DNA analysis on your laptop: Spot the differencesBarbera van Schaik
 
Web applications for rapid microbial taxonomy identification
Web applications for rapid microbial taxonomy identification Web applications for rapid microbial taxonomy identification
Web applications for rapid microbial taxonomy identification ExternalEvents
 
Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009Ian Foster
 
Quantified Self On Being A Personal Genomic Observatory
Quantified Self On Being A Personal Genomic ObservatoryQuantified Self On Being A Personal Genomic Observatory
Quantified Self On Being A Personal Genomic ObservatoryLarry Smarr
 
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...Reid Robison
 
Grand round whsiao_may2015
Grand round whsiao_may2015Grand round whsiao_may2015
Grand round whsiao_may2015IRIDA_community
 
How Can We Make Genomic Epidemiology a Widespread Reality? - William Hsiao
How Can We Make Genomic Epidemiology a Widespread Reality?  - William HsiaoHow Can We Make Genomic Epidemiology a Widespread Reality?  - William Hsiao
How Can We Make Genomic Epidemiology a Widespread Reality? - William HsiaoWilliam Hsiao
 
Data analytics challenges in genomics
Data analytics challenges in genomicsData analytics challenges in genomics
Data analytics challenges in genomicsmikaelhuss
 
Methods to enhance the validity of precision guidelines emerging from big data
Methods to enhance the validity of precision guidelines emerging from big dataMethods to enhance the validity of precision guidelines emerging from big data
Methods to enhance the validity of precision guidelines emerging from big dataChirag Patel
 
How to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationHow to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationJoaquin Dopazo
 
Lab-on-a-Chip for cancer diagnostics and monitoring
Lab-on-a-Chip for cancer diagnostics and monitoringLab-on-a-Chip for cancer diagnostics and monitoring
Lab-on-a-Chip for cancer diagnostics and monitoringstanislas547
 

Similar to WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015 (20)

Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
 
2015 06-12-beiko-irida-big data
2015 06-12-beiko-irida-big data2015 06-12-beiko-irida-big data
2015 06-12-beiko-irida-big data
 
Sequencing Genomics: The New Big Data Driver
Sequencing Genomics:The New Big Data DriverSequencing Genomics:The New Big Data Driver
Sequencing Genomics: The New Big Data Driver
 
2017 09-07 Global Virome Project
2017 09-07 Global Virome Project2017 09-07 Global Virome Project
2017 09-07 Global Virome Project
 
Discovering Yourself with Computational Bioinformatics
Discovering Yourself with Computational BioinformaticsDiscovering Yourself with Computational Bioinformatics
Discovering Yourself with Computational Bioinformatics
 
GenomeTrakr: Whole-Genome Sequencing for Food Safety and A New Way Forward in...
GenomeTrakr: Whole-Genome Sequencing for Food Safety and A New Way Forward in...GenomeTrakr: Whole-Genome Sequencing for Food Safety and A New Way Forward in...
GenomeTrakr: Whole-Genome Sequencing for Food Safety and A New Way Forward in...
 
01 Slide_Oscar
01 Slide_Oscar01 Slide_Oscar
01 Slide_Oscar
 
Emerging challenges in data-intensive genomics
Emerging challenges in data-intensive genomicsEmerging challenges in data-intensive genomics
Emerging challenges in data-intensive genomics
 
DNA analysis on your laptop: Spot the differences
DNA analysis on your laptop: Spot the differencesDNA analysis on your laptop: Spot the differences
DNA analysis on your laptop: Spot the differences
 
Web applications for rapid microbial taxonomy identification
Web applications for rapid microbial taxonomy identification Web applications for rapid microbial taxonomy identification
Web applications for rapid microbial taxonomy identification
 
Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009
 
JALANov2000
JALANov2000JALANov2000
JALANov2000
 
Quantified Self On Being A Personal Genomic Observatory
Quantified Self On Being A Personal Genomic ObservatoryQuantified Self On Being A Personal Genomic Observatory
Quantified Self On Being A Personal Genomic Observatory
 
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
 
Grand round whsiao_may2015
Grand round whsiao_may2015Grand round whsiao_may2015
Grand round whsiao_may2015
 
How Can We Make Genomic Epidemiology a Widespread Reality? - William Hsiao
How Can We Make Genomic Epidemiology a Widespread Reality?  - William HsiaoHow Can We Make Genomic Epidemiology a Widespread Reality?  - William Hsiao
How Can We Make Genomic Epidemiology a Widespread Reality? - William Hsiao
 
Data analytics challenges in genomics
Data analytics challenges in genomicsData analytics challenges in genomics
Data analytics challenges in genomics
 
Methods to enhance the validity of precision guidelines emerging from big data
Methods to enhance the validity of precision guidelines emerging from big dataMethods to enhance the validity of precision guidelines emerging from big data
Methods to enhance the validity of precision guidelines emerging from big data
 
How to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationHow to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical information
 
Lab-on-a-Chip for cancer diagnostics and monitoring
Lab-on-a-Chip for cancer diagnostics and monitoringLab-on-a-Chip for cancer diagnostics and monitoring
Lab-on-a-Chip for cancer diagnostics and monitoring
 

More from Torsten Seemann

How to write bioinformatics software no one will use
How to write bioinformatics software no one will useHow to write bioinformatics software no one will use
How to write bioinformatics software no one will useTorsten Seemann
 
How to write bioinformatics software people will use and cite - t.seemann - ...
How to write bioinformatics software people will use and cite -  t.seemann - ...How to write bioinformatics software people will use and cite -  t.seemann - ...
How to write bioinformatics software people will use and cite - t.seemann - ...Torsten Seemann
 
Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016Torsten Seemann
 
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...Torsten Seemann
 
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...Torsten Seemann
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...Torsten Seemann
 
De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015Torsten Seemann
 
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015Torsten Seemann
 
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012Torsten Seemann
 
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...Torsten Seemann
 
Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015Torsten Seemann
 
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Torsten Seemann
 
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014Torsten Seemann
 
Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Torsten Seemann
 
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014Torsten Seemann
 
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014Torsten Seemann
 
Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012Torsten Seemann
 
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...Torsten Seemann
 

More from Torsten Seemann (18)

How to write bioinformatics software no one will use
How to write bioinformatics software no one will useHow to write bioinformatics software no one will use
How to write bioinformatics software no one will use
 
How to write bioinformatics software people will use and cite - t.seemann - ...
How to write bioinformatics software people will use and cite -  t.seemann - ...How to write bioinformatics software people will use and cite -  t.seemann - ...
How to write bioinformatics software people will use and cite - t.seemann - ...
 
Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016
 
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
 
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
 
De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015
 
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
 
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
 
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
 
Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015
 
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
 
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
 
Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013
 
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
 
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
 
Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012
 
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
 

Recently uploaded

Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?Patrick Diehl
 
Scheme-of-Work-Science-Stage-4 cambridge science.docx
Scheme-of-Work-Science-Stage-4 cambridge science.docxScheme-of-Work-Science-Stage-4 cambridge science.docx
Scheme-of-Work-Science-Stage-4 cambridge science.docxyaramohamed343013
 
Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx  .This slides helps to know the different types of biop...Biopesticide (2).pptx  .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...RohitNehra6
 
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...jana861314
 
Analytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdfAnalytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdfSwapnil Therkar
 
zoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistanzoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistanzohaibmir069
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTSérgio Sacani
 
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bNightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bSérgio Sacani
 
NAVSEA PEO USC - Unmanned & Small Combatants 26Oct23.pdf
NAVSEA PEO USC - Unmanned & Small Combatants 26Oct23.pdfNAVSEA PEO USC - Unmanned & Small Combatants 26Oct23.pdf
NAVSEA PEO USC - Unmanned & Small Combatants 26Oct23.pdfWadeK3
 
Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...Nistarini College, Purulia (W.B) India
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Sérgio Sacani
 
Analytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptxAnalytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptxSwapnil Therkar
 
Behavioral Disorder: Schizophrenia & it's Case Study.pdf
Behavioral Disorder: Schizophrenia & it's Case Study.pdfBehavioral Disorder: Schizophrenia & it's Case Study.pdf
Behavioral Disorder: Schizophrenia & it's Case Study.pdfSELF-EXPLANATORY
 
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...anilsa9823
 
Animal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxAnimal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxUmerFayaz5
 
Orientation, design and principles of polyhouse
Orientation, design and principles of polyhouseOrientation, design and principles of polyhouse
Orientation, design and principles of polyhousejana861314
 
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptx
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptxSOLUBLE PATTERN RECOGNITION RECEPTORS.pptx
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptxkessiyaTpeter
 
Isotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on IoIsotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on IoSérgio Sacani
 
Artificial Intelligence In Microbiology by Dr. Prince C P
Artificial Intelligence In Microbiology by Dr. Prince C PArtificial Intelligence In Microbiology by Dr. Prince C P
Artificial Intelligence In Microbiology by Dr. Prince C PPRINCE C P
 
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking  the Potential: Deep dive into ocean of Ceramic Magnets.pptxUnlocking  the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptxanandsmhk
 

Recently uploaded (20)

Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?
 
Scheme-of-Work-Science-Stage-4 cambridge science.docx
Scheme-of-Work-Science-Stage-4 cambridge science.docxScheme-of-Work-Science-Stage-4 cambridge science.docx
Scheme-of-Work-Science-Stage-4 cambridge science.docx
 
Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx  .This slides helps to know the different types of biop...Biopesticide (2).pptx  .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...
 
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
 
Analytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdfAnalytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdf
 
zoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistanzoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistan
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOST
 
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bNightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
 
NAVSEA PEO USC - Unmanned & Small Combatants 26Oct23.pdf
NAVSEA PEO USC - Unmanned & Small Combatants 26Oct23.pdfNAVSEA PEO USC - Unmanned & Small Combatants 26Oct23.pdf
NAVSEA PEO USC - Unmanned & Small Combatants 26Oct23.pdf
 
Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
 
Analytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptxAnalytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptx
 
Behavioral Disorder: Schizophrenia & it's Case Study.pdf
Behavioral Disorder: Schizophrenia & it's Case Study.pdfBehavioral Disorder: Schizophrenia & it's Case Study.pdf
Behavioral Disorder: Schizophrenia & it's Case Study.pdf
 
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
 
Animal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxAnimal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptx
 
Orientation, design and principles of polyhouse
Orientation, design and principles of polyhouseOrientation, design and principles of polyhouse
Orientation, design and principles of polyhouse
 
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptx
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptxSOLUBLE PATTERN RECOGNITION RECEPTORS.pptx
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptx
 
Isotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on IoIsotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on Io
 
Artificial Intelligence In Microbiology by Dr. Prince C P
Artificial Intelligence In Microbiology by Dr. Prince C PArtificial Intelligence In Microbiology by Dr. Prince C P
Artificial Intelligence In Microbiology by Dr. Prince C P
 
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking  the Potential: Deep dive into ocean of Ceramic Magnets.pptxUnlocking  the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptx
 

WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015