Dag Harmsen presented on the evolvement and challenges of cgMLST for the harmonization of bacterial genome sequencing and analysis. Key points include:
- cgMLST (core genome multilocus sequence typing) involves identifying and comparing alleles across a fixed set of core genome genes and has been applied to outbreak investigation and global pathogen nomenclature.
- Tools for cgMLST analysis have been developed and improved to work on read, draft, and complete genome levels and allow scalable, additive analysis of single genes to whole genomes.
- Standardizing a hierarchical cgMLST-based approach and developing common nomenclature poses challenges but is important for microbial genotypic surveillance across laboratories and countries.
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...nist-spin
"Next Generation Sequencing for Identification and Subtyping of Foodborne Pathogens" presentation at the Standards for Pathogen Identification via NGS (SPIN) workshop hosted by National Institute for Standards and Technology October 2014 by Rebecca Lindsey, PhD from Enteric Diseases Laboratory Branch of the CDC.
Microbial Metagenomics Drives a New CyberinfrastructureLarry Smarr
06.03.03
Invited Talk
School of Biological Sciences
University of California, Irvine
Title: Microbial Metagenomics Drives a New Cyberinfrastructure
Irvine, CA
Viral Metagenomics (CABBIO 20150629 Buenos Aires)bedutilh
This is a one-hour lecture about metagenomics, focusing on discovery of viruses and unknown sequence elements. It is part of a one-day workshop about metagenome assembly of crAssphage, a bacteriophage virus found in human gut. The hands-on workflow can be found at http://tbb.bio.uu.nl/dutilh/CABBIO/ and should be doable in one afternoon with supervision. There is also an iPython notebook about this here: https://github.com/linsalrob/CrAPy
Metagenomics research is a vast field which studies about the genetic system of the
environmental samples. Binning is a bioinformatics tool. Binning tool helps to analyses the
genomic analysis of the environmental samples.The
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...nist-spin
"Next Generation Sequencing for Identification and Subtyping of Foodborne Pathogens" presentation at the Standards for Pathogen Identification via NGS (SPIN) workshop hosted by National Institute for Standards and Technology October 2014 by Rebecca Lindsey, PhD from Enteric Diseases Laboratory Branch of the CDC.
Microbial Metagenomics Drives a New CyberinfrastructureLarry Smarr
06.03.03
Invited Talk
School of Biological Sciences
University of California, Irvine
Title: Microbial Metagenomics Drives a New Cyberinfrastructure
Irvine, CA
Viral Metagenomics (CABBIO 20150629 Buenos Aires)bedutilh
This is a one-hour lecture about metagenomics, focusing on discovery of viruses and unknown sequence elements. It is part of a one-day workshop about metagenome assembly of crAssphage, a bacteriophage virus found in human gut. The hands-on workflow can be found at http://tbb.bio.uu.nl/dutilh/CABBIO/ and should be doable in one afternoon with supervision. There is also an iPython notebook about this here: https://github.com/linsalrob/CrAPy
Metagenomics research is a vast field which studies about the genetic system of the
environmental samples. Binning is a bioinformatics tool. Binning tool helps to analyses the
genomic analysis of the environmental samples.The
Course: Bioinformatics for Biomedical Research (2014).
Session: 2.1.3- Next Generation Sequencing. Technologies and Applications. Part III: NGS Applications II.
Statistics and Bioinformatisc Unit (UEB) & High Technology Unit (UAT) from Vall d'Hebron Research Institute (www.vhir.org), Barcelona.
Metagenomics is the study of metagenomes, genetic material recovered directly from environmental samples. The broad field was referred to as environmental genomics, ecogenomics or community genomics. Recent studies use "shotgun" Sanger sequencing or next generation sequencing (NGS) to get largely unbiased samples of all genes from all the members of the sampled communities.
Building bioinformatics resources for the global communityExternalEvents
http://www.fao.org/about/meetings/wgs-on-food-safety-management/en/
Building bioinformatics resources for the global community. Presentation from the Technical Meeting on the impact of Whole Genome Sequencing (WGS) on food safety management and GMI-9, 23-25 May 2016, Rome, Italy.
PROKARYOTIC TRANSCRIPTOMICS AND METAGENOMICSLubna MRL
After billions of years of evolution, prokaryotes have developed a huge diversity of regulatory mechanisms, many of which are probably uncharacterized. Now that the powerful tool of whole-transcriptome analysis can be used to study the RNA of bacteria and archaea, a new set of un expected RNA-based regulatory strategies might be revealed.
Metagenomics, together with in vitro evolution and high-throughput screening technologies, provides industry with an unprecedented chance to bring biomolecules into industrial application.
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015Torsten Seemann
How genomics is changing the practice of public health microbiology. The role of whole genome sequencing as the "one true assay". Another powerful tool for the epidemiologist.
10.02.19
Invited talk
Symposium #1816, Managing the Exaflood: Enhancing the Value of Networked Data for Science and Society
Title: Advancing the Metagenomics Revolution
San Diego, CA
Microbiology has experienced a transformation during the last 25 years that has altered microbiologists' view of microorganisms and how to study them. The realization that most microorganisms cannot be grown readily in pure culture forced microbiologists to question their belief that the microbial world had been conquered. We were forced to replace this belief with an acknowledgment of the extent of our ignorance about the range of metabolic and organismal diversity.
Dr. Douglas Marthaler - Use of Next Generation Sequencing for Whole Genome An...John Blue
Use of Next Generation Sequencing for Whole Genome Analysis of Pathogens - Dr. Douglas Marthaler, Veterinary Diagnostic Laboratory, College of Veterinary Medicine, University of Minnesota, from the 2016 Allen D. Leman Swine Conference, September 17-20, 2016, St. Paul, Minnesota, USA.
More presentations at http://www.swinecast.com/2016-leman-swine-conference-material
K-mers in metagenomics
K-mers play a critical role in the exploration of metagenomic data. They have been widely used to assign taxonomic attributions to the short genomic fragments characteristic of shotgun (metagenomic) sequencing. These approaches provide an assembly-free method for profiling microbial communities, and have helped elucidate the factors driving microbial community composition across biogeochemical gradients. Advances in sequencing technology are now making it cost-effective to sequence microbial communities at sufficient depths to allow for the assembly of high-quality contigs. This has made it possible to adopt k-mer based approaches to enable reliable binning of contigs originating from a single microbial population within a community. In this session, I will present both an overview of how k-mers can be used to assign taxonomic attributions to short metagenomic reads, and discuss how these approaches have advanced to a point where population genomes can be recovered en masse from even complex microbial communities.
This presents a number of case studies on the application on high-throughput sequencing (HTS), next generation sequencing (NGS), to biological problems ranging from human genome sequencing, identification of disease mutations, metagenomics, virus discovery, epidemic, transmission chains and viral populations. Presented at the University of Glasgow on Friday 26th June 2015.
Course: Bioinformatics for Biomedical Research (2014).
Session: 2.1.3- Next Generation Sequencing. Technologies and Applications. Part III: NGS Applications II.
Statistics and Bioinformatisc Unit (UEB) & High Technology Unit (UAT) from Vall d'Hebron Research Institute (www.vhir.org), Barcelona.
Metagenomics is the study of metagenomes, genetic material recovered directly from environmental samples. The broad field was referred to as environmental genomics, ecogenomics or community genomics. Recent studies use "shotgun" Sanger sequencing or next generation sequencing (NGS) to get largely unbiased samples of all genes from all the members of the sampled communities.
Building bioinformatics resources for the global communityExternalEvents
http://www.fao.org/about/meetings/wgs-on-food-safety-management/en/
Building bioinformatics resources for the global community. Presentation from the Technical Meeting on the impact of Whole Genome Sequencing (WGS) on food safety management and GMI-9, 23-25 May 2016, Rome, Italy.
PROKARYOTIC TRANSCRIPTOMICS AND METAGENOMICSLubna MRL
After billions of years of evolution, prokaryotes have developed a huge diversity of regulatory mechanisms, many of which are probably uncharacterized. Now that the powerful tool of whole-transcriptome analysis can be used to study the RNA of bacteria and archaea, a new set of un expected RNA-based regulatory strategies might be revealed.
Metagenomics, together with in vitro evolution and high-throughput screening technologies, provides industry with an unprecedented chance to bring biomolecules into industrial application.
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015Torsten Seemann
How genomics is changing the practice of public health microbiology. The role of whole genome sequencing as the "one true assay". Another powerful tool for the epidemiologist.
10.02.19
Invited talk
Symposium #1816, Managing the Exaflood: Enhancing the Value of Networked Data for Science and Society
Title: Advancing the Metagenomics Revolution
San Diego, CA
Microbiology has experienced a transformation during the last 25 years that has altered microbiologists' view of microorganisms and how to study them. The realization that most microorganisms cannot be grown readily in pure culture forced microbiologists to question their belief that the microbial world had been conquered. We were forced to replace this belief with an acknowledgment of the extent of our ignorance about the range of metabolic and organismal diversity.
Dr. Douglas Marthaler - Use of Next Generation Sequencing for Whole Genome An...John Blue
Use of Next Generation Sequencing for Whole Genome Analysis of Pathogens - Dr. Douglas Marthaler, Veterinary Diagnostic Laboratory, College of Veterinary Medicine, University of Minnesota, from the 2016 Allen D. Leman Swine Conference, September 17-20, 2016, St. Paul, Minnesota, USA.
More presentations at http://www.swinecast.com/2016-leman-swine-conference-material
K-mers in metagenomics
K-mers play a critical role in the exploration of metagenomic data. They have been widely used to assign taxonomic attributions to the short genomic fragments characteristic of shotgun (metagenomic) sequencing. These approaches provide an assembly-free method for profiling microbial communities, and have helped elucidate the factors driving microbial community composition across biogeochemical gradients. Advances in sequencing technology are now making it cost-effective to sequence microbial communities at sufficient depths to allow for the assembly of high-quality contigs. This has made it possible to adopt k-mer based approaches to enable reliable binning of contigs originating from a single microbial population within a community. In this session, I will present both an overview of how k-mers can be used to assign taxonomic attributions to short metagenomic reads, and discuss how these approaches have advanced to a point where population genomes can be recovered en masse from even complex microbial communities.
This presents a number of case studies on the application on high-throughput sequencing (HTS), next generation sequencing (NGS), to biological problems ranging from human genome sequencing, identification of disease mutations, metagenomics, virus discovery, epidemic, transmission chains and viral populations. Presented at the University of Glasgow on Friday 26th June 2015.
Tools for Metagenomics with 16S/ITS and Whole Genome Shotgun SequencesSurya Saha
Presented at Cornell Symbiosis symposium. Workflow for processing amplicon based 16S/ITS sequences as well as whole genome shotgun sequences are described. Slides include short description and links for each tool.
DISCLAIMER: This is a small subset of tools out there. No disrespect to methods not mentioned.
Errors and Limitaions of Next Generation SequencingNixon Mendez
High throughput sequencing technologies has made whole genome sequencing and resequencing available to many more researchers and projects.
Cost and time have been greatly reduced.
The error profiles and limitations of the new platforms differ significantly from those of previous sequencing technologies.
The selection of an appropriate sequencing platform for particular types of experiments is an important consideration.
NGS sequencing errors focuses mainly on the following points:
1.Low quality bases
2.PCR errors
3.High Error rate
NGS has inherent limitations they are as follows :
1.Sequence properties and algorithmic challenges
2.Contamination or new insertions
3.Repeat content
4.Segmental duplications
5.Missing and fragmented genes
6.Reference index
Speeding up sequencing: Sequencing in an hour enables sample to answer in a w...Thermo Fisher Scientific
At this time next generation sequencing (NGS) is hindered by slow and often manual workflow procedures. Decreasing overall workflow times is critical for the widespread adoption of targeted and whole genome sequencing (WGS) for many time-sensitive applications, in particular for infectious disease analysis. To this end, we describe improvements to the four main steps of the NGS workflow: i) library preparation; ii) template preparation, iii) sequencing; iv) and data analysis. Together, these advances dramatically decrease the overall turnaround times.
Ion Torrent semiconductor-based sequencing instruments utilities flow sequencing with speed largely dependent on and the number of nucleotide flows (one flow produces ~0.5 base) and the speed of the flows (Figure 2).
QIAseq Technologies for Metagenomics and Microbiome NGS Library PrepQIAGEN
In this slide deck, learn about the innovative technologies that form the basis of QIAGEN’s portfolio of QIAseq library prep solutions for metagenomics and microbiome sequencing. Whether your research starts from single microbial cells, 16s rRNA PCR amplicons, or gDNA for whole genome analysis, QIAseq technologies offer tips and tricks for capturing the genomic diversity of your samples in the most unbiased, streamlined way possible.
Course: Bioinformatics for Biomedical Research (2014).
Session: 2.1.2- Next Generation Sequencing. Technologies and Applications. Part II: NGS Applications I.
Statistics and Bioinformatisc Unit (UEB) & High Technology Unit (UAT) from Vall d'Hebron Research Institute (www.vhir.org), Barcelona.
The field of next-generation sequencing (NGS) has been experiencing explosive growth over the past several years and shows little sign of slowing down. The increasing capabilities and dramatically lowered costs have expanded NGS's reach beyond that of the human genome into nearly every corner of biological research. An overview of the platforms on the market today, including an assessment of their relative strengths and weaknesses, will be presented. The presentation will conclude with a peek into where the technology is going and what will be available in the future.
Exploring Spark for Scalable Metagenomics Analysis: Spark Summit East talk by...Spark Summit
Whole genome based metagenomics analyses hold the key to discover novel species from microbial communities, reveal their full metabolic potentials, and understand their interactions with each other. Metagenomics projects based on next generation sequencing typically produce 100GB to 1000GB unstructured data. Unlike many other big data problems, analysis of metagenomics data often generates temporary files with 100 to 1000 times of the original size, posing a significant challenge in both hardware infrastructure and software algorithms. Here we report our experience with evaluating Apache Spark in metagenomics data analysis for its speed, scalability, robustness, and most importantly, ease of programming. We developed a Spark-based scalable metagenomics application to deconvolute individual genomes from a complex microbial community with thousands of species. We then systematically tested its performance on synthetic and real world datasets using the Elastic MapReduce framework provided by Amazon Web Services. Our preliminary results suggest Spark provides a cost-effective solution with rapid development/deployment cycles for metagenomics data analysis. These experience likely extends to other big genomics data analyses, in both research and production settings.
El lunes 23 de octubre de 2017 celebramos una jornada en la Fundación Ramón Areces sobre Microbiota Intestinal: Implicaciones en la Salud y Enfermedad.
Web applications for rapid microbial taxonomy identification ExternalEvents
http://www.fao.org/about/meetings/wgs-on-food-safety-management/en/
Web applications for rapid microbial taxonomy identification. Presentation from the Technical Meeting on the impact of Whole Genome Sequencing (WGS) on food safety management -23-25 May 2016, Rome, Italy.
MseqDR consortium: a grass-roots effort to establish a global resource aimed ...Human Variome Project
The success of whole exome sequencing (WES) for highly heterogeneous disorders, such as mitochondrial disease, is limited by substantial technical and bioinformatics challenges to correctly identify and prioritize the extensive number of sequence variants present in each patient. The likelihood of success can be greatly improved if a large cohort of patient data is assembled in which sequence variants can be systematically analysed, annotated, and interpreted relative to known phenotype. This effort has engaged and united more than 100 international mitochondrial clinicians, researchers, and bioinformaticians in the Mitochondrial Disease Sequence Data Resource (MSeqDR) consortium that formed in June 2012 to identify and prioritize the specific WES data analysis needs of the global mitochondrial disease community. Through regular web-based meetings, we have familiarized ourselves with existing strengths and gaps facing integration of MSeqDR with public resources, as well as the major practical, technical, and ethical challenges that must be overcome to create a sustainable data resource. We have now moved forward toward our common goal by establishing a central data resource (http://mseqdr.org/) that has both public access and secure web-based features that allow the coherent compilation, organization, annotation, and analysis of WES and mtDNA genome data sets generated in both clinical- and research-based settings of suspected mitochondrial disease patients. The most important aims of the MSeqDR consortium are summarized in the MSeqDR portal within the Consortium overview sections. Consortium participants are organized in 3 working groups that include (1) Technology and Bioinformatics; (2) Phenotyping, databasing, IRB concerns and access; and (3) Mitochondrial DNA specific concerns. The online MSeqDR resource is organized into discrete sections to facilitate data deposition and common reannotation, data visualization, data set mining, and access management. With the support of the United Mitochondrial Disease Foundation (UMDF) and the NINDS/NICHD U54 supported North American Mitochondrial Disease Consortium (NAMDC), the MSeqDR prototype has been built. Current major components include common data upload and reannotation using a novel HBCR based annotation tool that has also been made publicly available through the website, MSeqDR GBrowse that allows ready visualization of all public and MSeqDR specific data including labspecific aggregate data visualization tracks, MSeqDR-LSDB instance of nearly 1250 mitochondrial disease and mitochodnrial localized genes that is based on the Locus Specific Database model, exome data set mining in individuals or families using the GEM.app tool, and Account & Access Management. Within MSeqDR GBrowse it is now possible to explore data derived from MitoMap, HmtDB, ClinVar, UCSC-NumtS, ENCODE, 1000 genomes, and many other resources that bioinformaticians recruited to the project are organizing.
Mechanical signals inhibit growth of a grafted tumor in vivo proof of conceptRemy BROSSEL
We apply the principles of physical oncology (or mechanobiology) in vivo to show the effect of a “constraint field” on tumor growth.
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0152885
Professor Michael Levin's presentation at Meningitis Research Foundation's 2013 conference Meningitis & Septicaemia in Children & Adults www.meningitis.org/conference2013
High-throughput proteomics: from understanding data to predicting themMaté Ongenaert
High-throughput proteomics: from understanding data to predicting themprof. dr. Lennart Martens
UGent - Department of Biochemistry, Faculty of Medicine and Health Sciences, VIB - Group Leader Computational Omics and Systems Biology Group (CompOmics), Department of Medical Protein Research
In proteomics, as in any high-throughput omics field, the rate of data generation has increased dramatically, yielding very large datasets that require substantial processing to render them useful and interpretable. Key concepts here are data management, data-bound analysis algorithms, and user interface design. But we do not need to limit ourselves to only the interpretation of experimental results. By combining data from across many (unrelated) experiments, we can gain substantial knowledge about the strengths and limitations of our technological approaches. High-throughput methods however, rarely serve as the endpoint for research. As exquisite parallel hypothesis testers, these approaches can quickly highlight promising follow-up targets for more detailed study. Yet moving from discovery to targeted analysis requires much more in-depth understanding of sample and methodology, which is where the insights gained from large-scale data analysis come into play. Armed with this knowledge, we can begin to predict experimental outcomes based on specific hypotheses, thus effectively creating tests or assays that can be used in focused validation experiments
Digital Scientific Notations are expected to solve some of the problems we have in computational science today. In particular, they should make the verification of computational science by human scientists possible again. Leibniz is a Digital Scientific Notation for the physical sciences currently under development. This presentation gives an overview of the current state.
Để xem full tài liệu Xin vui long liên hệ page để được hỗ trợ
: https://www.facebook.com/thuvienluanvan01
HOẶC
https://www.facebook.com/garmentspace/
https://www.facebook.com/thuvienluanvan01
https://www.facebook.com/thuvienluanvan01
tai lieu tong hop, thu vien luan van, luan van tong hop, do an chuyen nganh
Talk by Christoph Steinbeck, European Bioinformatics Institute (EMBL-EBI) on challenges for data sharing of clinical data in metabolomics research. This workshop was co-organised with the European BBMRI Biobanking infrastructure as part of the BioMedBridge symposium at the Wellcome Trust Conference Centre in Hinxton, UK.
Similar to EU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for Harmonization (20)
Presentation from the ECDC expert consultation on Whole Genome Sequencing organised by the European Centre of Disease Prevention and Control - Stockholm, 19 November 2015
Presentation from the ECDC expert consultation on Whole Genome Sequencing organised by the European Centre of Disease Prevention and Control - Stockholm, 19 November 2015
Presentation from the ECDC expert consultation on Whole Genome Sequencing organised by the European Centre of Disease Prevention and Control - Stockholm, 19 November 2015
Presentation from the ECDC expert consultation on Whole Genome Sequencing organised by the European Centre of Disease Prevention and Control - Stockholm, 19 November 2015
Presentation from the ECDC expert consultation on Whole Genome Sequencing organised by the European Centre of Disease Prevention and Control - Stockholm, 19 November 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
Presentation from the 3rd Joint Meeting of the Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI) Networks, organised by the European Centre of Disease Prevention and Control - Stockholm, 11-13 February 2015
More from European Centre for Disease Prevention and Control (ECDC) (20)
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...i3 Health
i3 Health is pleased to make the speaker slides from this activity available for use as a non-accredited self-study or teaching resource.
This slide deck presented by Dr. Kami Maddocks, Professor-Clinical in the Division of Hematology and
Associate Division Director for Ambulatory Operations
The Ohio State University Comprehensive Cancer Center, will provide insight into new directions in targeted therapeutic approaches for older adults with mantle cell lymphoma.
STATEMENT OF NEED
Mantle cell lymphoma (MCL) is a rare, aggressive B-cell non-Hodgkin lymphoma (NHL) accounting for 5% to 7% of all lymphomas. Its prognosis ranges from indolent disease that does not require treatment for years to very aggressive disease, which is associated with poor survival (Silkenstedt et al, 2021). Typically, MCL is diagnosed at advanced stage and in older patients who cannot tolerate intensive therapy (NCCN, 2022). Although recent advances have slightly increased remission rates, recurrence and relapse remain very common, leading to a median overall survival between 3 and 6 years (LLS, 2021). Though there are several effective options, progress is still needed towards establishing an accepted frontline approach for MCL (Castellino et al, 2022). Treatment selection and management of MCL are complicated by the heterogeneity of prognosis, advanced age and comorbidities of patients, and lack of an established standard approach for treatment, making it vital that clinicians be familiar with the latest research and advances in this area. In this activity chaired by Michael Wang, MD, Professor in the Department of Lymphoma & Myeloma at MD Anderson Cancer Center, expert faculty will discuss prognostic factors informing treatment, the promising results of recent trials in new therapeutic approaches, and the implications of treatment resistance in therapeutic selection for MCL.
Target Audience
Hematology/oncology fellows, attending faculty, and other health care professionals involved in the treatment of patients with mantle cell lymphoma (MCL).
Learning Objectives
1.) Identify clinical and biological prognostic factors that can guide treatment decision making for older adults with MCL
2.) Evaluate emerging data on targeted therapeutic approaches for treatment-naive and relapsed/refractory MCL and their applicability to older adults
3.) Assess mechanisms of resistance to targeted therapies for MCL and their implications for treatment selection
Flu Vaccine Alert in Bangalore Karnatakaaddon Scans
As flu season approaches, health officials in Bangalore, Karnataka, are urging residents to get their flu vaccinations. The seasonal flu, while common, can lead to severe health complications, particularly for vulnerable populations such as young children, the elderly, and those with underlying health conditions.
Dr. Vidisha Kumari, a leading epidemiologist in Bangalore, emphasizes the importance of getting vaccinated. "The flu vaccine is our best defense against the influenza virus. It not only protects individuals but also helps prevent the spread of the virus in our communities," he says.
This year, the flu season is expected to coincide with a potential increase in other respiratory illnesses. The Karnataka Health Department has launched an awareness campaign highlighting the significance of flu vaccinations. They have set up multiple vaccination centers across Bangalore, making it convenient for residents to receive their shots.
To encourage widespread vaccination, the government is also collaborating with local schools, workplaces, and community centers to facilitate vaccination drives. Special attention is being given to ensuring that the vaccine is accessible to all, including marginalized communities who may have limited access to healthcare.
Residents are reminded that the flu vaccine is safe and effective. Common side effects are mild and may include soreness at the injection site, mild fever, or muscle aches. These side effects are generally short-lived and far less severe than the flu itself.
Healthcare providers are also stressing the importance of continuing COVID-19 precautions. Wearing masks, practicing good hand hygiene, and maintaining social distancing are still crucial, especially in crowded places.
Protect yourself and your loved ones by getting vaccinated. Together, we can help keep Bangalore healthy and safe this flu season. For more information on vaccination centers and schedules, residents can visit the Karnataka Health Department’s official website or follow their social media pages.
Stay informed, stay safe, and get your flu shot today!
Couples presenting to the infertility clinic- Do they really have infertility...Sujoy Dasgupta
Dr Sujoy Dasgupta presented the study on "Couples presenting to the infertility clinic- Do they really have infertility? – The unexplored stories of non-consummation" in the 13th Congress of the Asia Pacific Initiative on Reproduction (ASPIRE 2024) at Manila on 24 May, 2024.
Prix Galien International 2024 Forum ProgramLevi Shapiro
June 20, 2024, Prix Galien International and Jerusalem Ethics Forum in ROME. Detailed agenda including panels:
- ADVANCES IN CARDIOLOGY: A NEW PARADIGM IS COMING
- WOMEN’S HEALTH: FERTILITY PRESERVATION
- WHAT’S NEW IN THE TREATMENT OF INFECTIOUS,
ONCOLOGICAL AND INFLAMMATORY SKIN DISEASES?
- ARTIFICIAL INTELLIGENCE AND ETHICS
- GENE THERAPY
- BEYOND BORDERS: GLOBAL INITIATIVES FOR DEMOCRATIZING LIFE SCIENCE TECHNOLOGIES AND PROMOTING ACCESS TO HEALTHCARE
- ETHICAL CHALLENGES IN LIFE SCIENCES
- Prix Galien International Awards Ceremony
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Ve...kevinkariuki227
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdfAnujkumaranit
Artificial intelligence (AI) refers to the simulation of human intelligence processes by machines, especially computer systems. It encompasses tasks such as learning, reasoning, problem-solving, perception, and language understanding. AI technologies are revolutionizing various fields, from healthcare to finance, by enabling machines to perform tasks that typically require human intelligence.
HOT NEW PRODUCT! BIG SALES FAST SHIPPING NOW FROM CHINA!! EU KU DB BK substit...GL Anaacs
Contact us if you are interested:
Email / Skype : kefaya1771@gmail.com
Threema: PXHY5PDH
New BATCH Ku !!! MUCH IN DEMAND FAST SALE EVERY BATCH HAPPY GOOD EFFECT BIG BATCH !
Contact me on Threema or skype to start big business!!
Hot-sale products:
NEW HOT EUTYLONE WHITE CRYSTAL!!
5cl-adba precursor (semi finished )
5cl-adba raw materials
ADBB precursor (semi finished )
ADBB raw materials
APVP powder
5fadb/4f-adb
Jwh018 / Jwh210
Eutylone crystal
Protonitazene (hydrochloride) CAS: 119276-01-6
Flubrotizolam CAS: 57801-95-3
Metonitazene CAS: 14680-51-4
Payment terms: Western Union,MoneyGram,Bitcoin or USDT.
Deliver Time: Usually 7-15days
Shipping method: FedEx, TNT, DHL,UPS etc.Our deliveries are 100% safe, fast, reliable and discreet.
Samples will be sent for your evaluation!If you are interested in, please contact me, let's talk details.
We specializes in exporting high quality Research chemical, medical intermediate, Pharmaceutical chemicals and so on. Products are exported to USA, Canada, France, Korea, Japan,Russia, Southeast Asia and other countries.
Anti ulcer drugs and their Advance pharmacology ||
Anti-ulcer drugs are medications used to prevent and treat ulcers in the stomach and upper part of the small intestine (duodenal ulcers). These ulcers are often caused by an imbalance between stomach acid and the mucosal lining, which protects the stomach lining.
||Scope: Overview of various classes of anti-ulcer drugs, their mechanisms of action, indications, side effects, and clinical considerations.
Report Back from SGO 2024: What’s the Latest in Cervical Cancer?bkling
Are you curious about what’s new in cervical cancer research or unsure what the findings mean? Join Dr. Emily Ko, a gynecologic oncologist at Penn Medicine, to learn about the latest updates from the Society of Gynecologic Oncology (SGO) 2024 Annual Meeting on Women’s Cancer. Dr. Ko will discuss what the research presented at the conference means for you and answer your questions about the new developments.
Report Back from SGO 2024: What’s the Latest in Cervical Cancer?
EU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for Harmonization
1. Dag Harmsen
Univ. Münster, Germany
dharmsen@uni-muenster.de
EU PathoNGenTrace Consortium
cgMLST Evolvement and Challenges for Harmonization
19th November, 2015
2. Commercial Disclosure
Dag Harmsen is co-founder and partial owner of a
bioinformatics company (Ridom GmbH, Münster, Germany) that
develops software for DNA sequence analysis. Ridom and
Ion Torrent/Thermo Fisher (Waltham, MA) partnered and
released SeqSphere+ software to speed and simplify whole
genome based bacterial typing.
4. for
Outbreak Investigation
&
Global Nomenclature
Multiple Genome
Alignment
(e.g., progressive Mauve)
k-mer
without alignment
ANI
with alignment
(Average Nucleotide Identity)
Genome-wide
Mapping &
SNP Calling
Genome-wide
Gene by
Gene Allele
Calling (cgMLST)
+ Works on read, draft & complete genome level, quickly identifies
closest matching genome.
- Whole genome reduced to a single number of similarity.
- Additively expandable [≈ O(n)], but poor mapping to
nomenclature possible.
- Difficult to interpret with draft genomes.
- Computational intensive (≧ O(n2), limit ≈ 30-50 genomes).
- Not additive expandable, no nomenclature possible.
+ Works well for monomorphic organisms and ‘ad hoc’ analysis &
more discriminatory than cgMLST.
- Problematic with rearrangement / recombination events.
- Not additive expandable (at least if not always mapped to same reference).
+ Scalable, working on single gene to whole genome levels.
+ Both recombination & point mutation accommodated a single
event.
+ Additively expandable [≈ O(1)] & nomenclature possible.
…A C
GGGATACATACCTATGCTATAGCT…
…ACGTGATACATACCTATGATATAGCT…
…ACGTGATACATACCTATGCTATAGCT…
Surveillance and Phylogeny from Draft Genomes
‘Molecular Typing Esperanto’ by Standardized Genome Comparison
SNP, single nucleotide polymorphism; cgMLST, core genome multi locus sequence typing; n, number of isolates in database.
5. Alleles vs. Sequence/SNPs
ST1 = 1,1,1,1,1,1,1
ST2 = 1,2,1,1,1,1,1 ST3 = 1,1,1,2,1,1,1 ST4 = 1,1,1,1,1,1,2
A (clonal founder)
B (isolate) C D
A
B
C
D
Point mutation
Recombination
Allelic profiles
A
B
C
D
Sequence data
The use of allelic profiles, rather than (concatenated) sequences or SNPs,
results in the loss of information (reductionist), but patterns of descent are more
robust to the effects of horizontal genetic transfer. Using for analysis just genes –
bacteria have a high coding capacity – avoids frequently repetitive intergenic
regions that are anyway with 2nd generation NGS data difficult to assemble.
Modified from: Ed Feil; Univ. Bath, UK
each one genetic event
6. SNP vs. …
• M. tuberculosis
outbreak
• Reference mapped
against MtbC
H37Rv and SNP
calling.
• Outgroup strains
same MIRU-VNTR
type with no epi-
link. Kohl et al. (2014). JCM 52: 2479 [PubMed].
7. … cgMLST based Typing
• Reference mapped
against MtbC
H37Rv.
• Core genome
schema consists of
3,257 coding genes
(76.8% of whole
genome).
• 3,041 genes shared
by all 26 isolates
analyzed with
SeqSphere+.
Kohl et al. (2014). JCM 52: 2479 [PubMed].
Enterococcus: de Been. Et al. (2015). JCM pii: JCM.01946-15 [PubMed].
10. Jolley & Maiden (November, 2010). BMC Bioinformatics.
11: 595 [PubMed].
ClonalFrame trees were generated from 43 streptococcal
genome sequences, i.e., from concatenated sequences,
using A seven MLSA gene fragment loci and B 77 complete
genes found to be present throughout the genus identified
by BIGSdb.
11. Mellmann et al. (July, 2011). PLoS One. 6: e22751 [PubMed].
Phylogenetic Analysis of EHEC 0104:H4
Method
First real-time prospective outbreak genomics
outbreak analysis. Hybrid assembly from reference
mapping & de novo assembly with Ion Torrent PGM
WGS data and BIGSdb genome-wide gene-by gene
allele calling against a fixed set of loci/targets
n = 1,144 STEC core genome gene scheme defined
before outbreak analysis and SeqSphere minimum-
spanning tree (not yet termed so but first cgMLST
application; internally called at that time ‘super MLST’
and/or ‘MLST on steroids’)
12. Grant agreement number:
278864-2
EC contribution:
5.995.267 €
Duration:
54 months (01/01/2012 - 30/06/2016)
Funding scheme:
SME-targeted Collaborative Project
URL:
http://www.patho-ngen-trace.eu/
Scientific Advisory Board
Marc J. Struelens
European Centre for Disease Prevention and Control (ECDC), Stockholm, Sweden
Rene S. Hendriksen
Technical University of Denmark - National Food Institute, Lyngby, Denmark
Stephen H. Gillespie
University of St Andrews, St Andrews, Scotland UK
Gary Van Domselaar
National Microbiology Laboratory Public Health Agency of Canada
13. Consortium
Dag Harmsen
Universität Münster
Stefan Niemann
Coordinator, FZ Borstel
Philip Supply
Genoscreen
Martin C.J. Maiden
University of Oxford
Bruno Pot
Applied Maths NV
Jörg Rothgänger
Ridom GmbH
Ronald Burggrave
Piext BV
Claudia Giehl
Eurice GmbH
Associated Partners
Alexander Mellmann
Univ. Münster, Germany
Roland Diel
Univ. Kiel, Germany
Joao Carrico
Univ. Lisbon, Portugal
14. Main Objectives
• Develop new, completely integrated bioinformatics
microbial genomics tools for: fast and easy quality-
controlled data extraction interpretation for general
diagnostics and public health applications
• Streamline and implement new quality control
procedures of the whole genomics process
• Test and validate the performances of NGS for early
diagnosing and monitoring the spread of major microbial
pathogens
15. Work-Packages
• WP1. Development of easy to use software tools for whole genome comparison
(Leader: Applied Maths, Partner: Ridom, Oxford; User: Genoscreen, Münster, Borstel,
Oxford)
• WP2. Next generation high throughput genome wide analysis – new technologies and
optimization
(Leader: Genoscreen, Partners: Münster, [Ion Torrent]; User: Borstel, Münster, Oxford)
• WP3. Use of whole genome sequencing & ODM for genotyping of MtbC
(Leader: Borstel, Partner: Genoscreen, Oxford, PiEXT [OpGen], Münster)
• WP4. Use of whole genome sequencing & ODM for genotyping of MRSA
(Leader: Münster, Partner: Genoscreen, Oxford, PiEXT [+OpGen])
• WP5. Use of whole genome sequencing & ODM for genotyping of Campylobacter
(Leader: Oxford, Partner: Genoscreen, Münster, PiEXT [+OpGen])
• WP6. Innovation related activities (IP, Dissemination, and Exploitation)
(Leader: Eurice, Partner: all)
• WP7. Management
(Leader: Eurice, Partner: all)
16. Prospective Real-time Studies
• Campylobacter: prospective surveillance in Oxfordshire,
UK has been ongoing with WGS data since 2010 – moving
to more real-time starting from 2015 (700-900 isolates
per year).
• MtbC: prospective surveillance in Hamburg, DE has been
ongoing with WGS data since 2005 – moving to more real-
time starting from 2015 (110-130 isolates per year).
• MRSA: prospective real-time (TaT 4-5 days) surveillance
of all multi-drug resistant bacteria (MDR; including MRSA)
of University Hospital Münster, DE since October 2013
(1,200-1,500 isolates per year).
17. Jolley et al. (April, 2012). Microbiology 158: 1005 [PubMed].
In 2013/2014 also rMLST STs added.
18. Jünemann et al. (April, 2013). Nature Biotechnology 31: 294 [PubMed].
Evaluation of contiguity and consensus accuracy
of draft de novo assemblies from benchtop
sequencers. a) evolution of genome contiguity for
GSJ, MiSeq and PGM. The contiguity of the de
novo assembly consensus sequences generated
by MIRA was analyzed for 4,671 non-pseudo- or
non-paralogous chromosomal coding E. coli
Sakai NCBI reference sequence genes. This
genome-wide gene-by-gene allele analysis
was performed with the Ridom SeqSphere+
software. (b) Venn diagram of consensus
sequencing accuracy for PGM 300 bp, MiSeq 2
× 250-bp PE (MIS) and GSJ. reported
consensus errors were analyzed for 4,632 coding
Sakai genes that could be retrieved using
SeqSphere+ for all three platforms. Numbers of
variants confirmed by bidirectional sanger
sequencing are indicated in parentheses.
*Avoidance of the term core genome as core genome genes are here determined from DNA
with rather high similarity values!
*
19. Maiden et al. (October, 2013). Nature Rev. Microbiol. 11: 728 [PubMed].
PathoNGenTrace Yearly Meeting (May 13th - 14th, 2013). Cambridge, UK.
Bruno Pot and Hannes Pouseele, Applied Maths. Kmers are the ways how to
compare genomes (work done together with Ilya Chorny, Illumina).
IMMEM X (October 2nd - 5th, 2013). Paris, France.
Hannes Pouseele, Applied Maths. Seven ways (= one of
them wgMLST) how to leave your lover (= PFGE).
cgMLST at that time for the
authors NOT a fixed set of
loci but ‘shared’ loci of
selected isolates under
study.
20. Kohl et al. (April, 2014). JCM 52: 2479 [PubMed].
First original publication using the term cgMLST and using a fixed genome-wide set of genes.
21.
22. Tools for Microbial
Genotypic Surveillance and Phylogeny
Wyres et al. (2014). WGS analysis and interpretation in clinical and public health microbiology laboratories:
what are the requirements and how do existing tools compare? Pathogens 3: 437 [doi:10.3390/pathogens3020437].
__________________________
ENA Sub- Included Nomen-
mission Database clature
__________________________
__________________________
Yes Yes No
No No No
No No No
__________________________
No Yes Yes
No No No
Yes Yes Yes
No No No
__________________________
WWW
WWW
WWW
WWW
23. Standardized Hierarchical Microbial WGS Typing
Pan-bacterial-specific
Jolley et al. (2012). Microbiology 158: 1005 [PubMed]
Global Nomenclature / Surveillance
rMLST
Species-specific
STEC: Mellmann et al. (2011). PLoS One. 6: e22751 [PubMed]
S. aureus: Leopold et al. (2014). JCM 52: 2365 [PubMed]
MtbC: Kohl et al. (2014). JCM 52: 2479 [PubMed]
K. pneumo.: Bialek et al. (2014). EID 20: 1812 [PubMed]
Lp: Moran-Gildad et al. (2015). Euro Surveill. 20: pii: 21186 [PubMed]
Listeria: Ruppitsch et al. (2015). JCM 53: 2869 [PubMed]
E. faecium: de Been et al. (2015). JCM 53: [PubMed]
cgMLST
MLST
SNPs
confirmatory/canonical
Standardized hierarchical microbial WGS typing approach. From bottom to
top with increasing discriminatory power. MLST, multi locus sequence typing;
rMLST, ribosomal MLST; cgMLST, core genome MLST; wgMLST, whole
genome MLST, and SNP, single nucleotide polymorphism.
Species-specific
e.g., Van Ert et al. (2007). JCM 45: 47 [PubMed]
Maiden et al. (1998). PNAS 95: 3140 [PubMed]
also needed for backwards compatibility
DiscriminatoryPower
Speciation by rMLST
Evolutionary Analysis
SNPs*
Alleles
from accessory reference ge-
nome genes or pan-genome
based wgMLST
Local Outbreak Investigation
Outbreak- / Lineage-specific
SNP
e.g., Köser et al (2012). NEJM 366: 2267 [PubMed]
wgMLST/’shared’ genome
N. meng.: Jolley et al. (2012). JCM. 50: 3046 [PubMed]
C. jejuni: Cody et al. (2013). JCM. 51: 2526 [PubMed]
*from de novo assembled [PubMed] and/or mapped genomes
25. cgMLST and API/Ontology Workshop
Organization: Martin Maiden and Dag Harmsen
Date: 2nd & 3rd March, 2015
Place: Oxford University, UK
Participants: Oxford Univ., Univ. Münster, FZ Borstel, Univ. Warwick,
Inst. Pasteur, Univ. Lisboa, PHE, CDC, Ridom, and Applied Maths
Informal agreement that cgMLST is a fixed and in the community
agreed upon set of genome-wide genes that is going to be at least the
minimum denominator for analyzing whole genome shotgun (WGS)
sequence data for surveillance purposes!
27. Nomenclature is in its essence a technique to reduce the
amount of available information by assigning a short, yet
still informative human [and machine] readable code to
isolates. Where two isolates share the same code, it implies
that they have the same properties as defined by the
nomenclature scheme that is assumed to be commonly
understood and adhered to.
An additional step in assigning allele identifiers to a
particular set of loci, which also further reduces the
information to a degree that it can be used effectively for
human communication, is to assign an additional unique
identifier to each combination of alleles observed within a
single genome.
Nomenclature Assignment
ECDC (October, 2015). Expert Opinion on the introduction of next-generation typing methods for food- and waterborne diseases in the EU and EEA.
http://ecdc.europa.eu/en/publications/Publications/food-and-waterborne-diseases-next-generation-typing-methods.pdf.
28. wgMLST principle: assignment of unique allele identifiers.
ECDC (October, 2015). Expert Opinion on the introduction of next-generation typing methods for food- and waterborne diseases in the EU and EEA.
http://ecdc.europa.eu/en/publications/Publications/food-and-waterborne-diseases-next-generation-typing-methods.pdf.
infinite growing*
*SeqSphere+ only uses the accessory genome of the ‘reference genome’.
BIGSdb and Bionumerics use the accessory genome of the pan genome. Furthermore,
for detecting loci/targets by similarity and overlap BIGSdb scans new draft genomes
against all alleles of a locus and not only against the allele of the ‘reference genome’ as
done by SeqSphere+ and Bionumerics. Thereby different results might be obtained
depending when the search was conducted (‘triangulation problem’).
Cluster/outbreak threshold calibration only possible on cgMLST level!
wgMLST Nomenclature
29. • MLST sequence type (ST) and clonal complex (CC) concept must and will be remain (among many others
reasons for backwards compatibility).
• For NGS genome-wide gene by gene allele typing with hundreds/thousands of genes/targets from a ‘WGS
typing scheme’ or with ‘core genome genes’ the allele nomenclature for every target/gene must be
controlled.
• For communication between humans (e.g. publication) and to make the results comparable on an
international scale the nomenclature of specific combinations of hundreds/thousands targets/genes
must also be controlled.
• For these specific combinations of hundreds/thousands targets/genes the term Cluster Type (CT) is
proposed.
• CT will be much more discriminatory than a ST; definition is mainly needed for outbreak
investigation/transmission chain analysis.
• CT concept must be able to cope with:
• some missing targets/genes (either not present or not sequenced by chance or not assembled well),
• a few target/gene allele differences due to NGS sequencing errors, intra-host variation and/or
micro-evolutionary changes during an outbreak, and
• different bacterial population structures (e.g., monomorphic vs. panmictic structure) and infection
dynamics (e.g., incubation period and/or transmission mode). Therefore, a CT will be species
specific.
• CT threshold is pragmatically defined as the highest observed number of allele differences in intra-
patient, consecutive and/or outbreak isolates plus 25% number of alleles (rounded) to rule-out recent
transmission for sure.
• As the CT will be ‘just’ a number and there will be no biological meaningful relationship between the CT
numbers – otherwise a single expanding nomenclature would be impossible – it is proposed to associate
with every CT the date and location (city and country) of isolation (e.g. CT 399; March 2013, Münster
Germany).
• As a CT will be specific for a ‘WGS typing scheme’ (cgMLST), it is proposed to use e.g. the phrase
Ridom cgMLST CT.
WGS Cluster Type (CT)
Problems due to:
• additive expansion
• missing data
• entry order
30. Taxonomical nomenclature principle based on SNP or wgMLST dendrogram.*
*Desirable BUT hardly possible for an additive expandable nomenclature system as there will be
always changes in the tree (was not possible in the past with MLST or canonical SNPs of monomorphic
bacteria; would violate stability of nomenclature). Furthermore, if done with ‘SNP addresses’ and not
with alleles very compute intensive to calculate.
ECDC (October, 2015). Expert Opinion on the introduction of next-generation typing methods for food- and waterborne diseases in the EU and EEA.
http://ecdc.europa.eu/en/publications/Publications/food-and-waterborne-diseases-next-generation-typing-methods.pdf.
Taxonomical/Phylogenetic Nomenclature
31. Vaz et al. (October, 2014). J Biomed Semantics 5: 43 [PubMed]
cgMLST Nomenclature Harmonization
The TypON microbial typing ontology foresees immediately a
REST application programming interface (API) for cgMLST allele
nomenclature services that allows software tools to bi-directional
communicate with each other.
32. cgMLST Nomenclature Server(s)
SeqSphere+: Query and authentication API to be released into public early 2016.
Submission for SeqSphere+ users already since 2013 possible without any manual curation
steps involved. Submission API for other tools foreseen for mid 2016.
BIGSdb: Query and authentication API available since mid 2015. Submission API
announced October 2015 (evaluation needed and SeqSphere+ and Bionumerics must
‘emulate’ BIGSdb mode of allele calling).
33. Other PathoNGenTrace Bioinformatics Activities
WGS
Genotyping
Standardization
Visualization of
four dimensions
and
Early Warning
From WGS
Geno- to
Phenotype
Prediction
(resistome &
virulome analysis)
From WGS to
Plain Language
Report
http://patho-ngen-trace.eu/
34. SeqSphere+ Visualization of Four Dimensions
released with version 3.0 early October 2015 (also MLST+ term no longer used since then)
Place
Ruppitsch et al. J Clin Microbiol. 2015; 53: 2869 [PubMed].
Time
#Missing
values Sample ID
Good
Targets ST
Collection
Date
Country of
Isolation
City of
Isolation
ZIP of
Isolation
Cluster
Type
4 12025647 99.8 398 unknown Austria ? (unknown) ? (unknown) 45
4 2010-00770 99.8 398 Feb 2, 2010 Austria Hartberg 8230 39
4 3230TP3 99.8 398 Jan 22, 2010 Austria Hartberg 8230 39
3 3230TP5 99.8 403 Jan 22, 2010 Austria Hartberg 8230 35
8 CIP105458 99.5 2 1959 USA ? (unknown) ? (unknown) 49
0 EGD-e 100.0 35 1924 United Kingdom Cambridge ? (unknown) 1
4 L10-10 99.8 398 Jan 12, 2010 Austria Zell am See 5700 39
4 L14-10 99.8 398 Jan 25, 2010 Austria Rohrbach 4150 39
4 L16-10 99.8 398 Jan 29, 2010 Austria Salzburg 5020 39
4 L17-10 99.8 398 Jan 30, 2010 Austria Krems 3500 39
4 L30-10 99.8 398 Jan 25, 2010 Austria Ried im Innkreis 4910 39
4 L33-10 99.8 398 Feb 22, 2010 Austria St. Pölten 3100 39
5 L38-11 99.7 398 2010 Austria Vienna 1010 41
4 L4-10 99.8 398 Dec 23, 2009 Austria Gänserndorf 2230 39
2 L71-09 99.9 403 Dec 10, 2009 Austria Mattersburg 7210 35
5 L75-09 99.7 398 Dec 16, 2009 Austria Vienna 1100 39
‘Person‘ by color
Type
All four dimensions
views are inter-linked
interactively and ex-
portable in publication
quality scalable vector
graphics (SVG) format.
35. allele calling (<5min)
Pure bacterial culture / single cell
DNA (≈3.5h)
Rapid NGS (≈28-43h)
De novo or reference
assisted assembly (<1h)
Phenotypic and
epidemiologic
information
LIMS
(e.g., via
Excel file or
HL7)
One Disruptive Technology Fits it All –
Genomic Surveillance and More
MLST/rMLST
Evolutionary
analysis
Resistome /
Virulome
Surveillance &
outbreak
investigation
cgMLST
SNP /
accessory targets Antibiotic
resistance targets
Toxins &
pathogenicity targets
Standardized
hierarchical microbial
typing and more
EBI ENA
(Backup raw
reads)
cgMLST
Nomen-
clature
Server
37. 2nd Conference
Rapid Microbial NGS and Bioinformatics: Translation Into Practice
The event will gather experts from all over the world active in applying
Next Generation Sequencing (NGS) techniques to discover the
epidemiology, anti-microbial resistance, ecology and evolution of
microorganisms. The program will be designed to build a bridge between
software developers and end-users.
At a Glance
Date: June 9-11, 2016
Place: Hamburg, Germany
Complete program to be announced online soon.
Registration: will open mid December 2015 at: www.RaMi-NGS.org
Contact: For questions or further information please send an email to
contact@rami-ngs.org
The research from the PathoNGen-Trace project has received funding from the European
Community's Seventh Framework Programme (FP7/2007-2013) under Grant Agreement N° 278864.
38. Dag Harmsen
Univ. Münster, Germany
dharmsen@uni-muenster.de
cgMLST Evolvement and Challenges for Harmonization
19th November, 2015
EU PathoNGenTrace Consortium