SlideShare a Scribd company logo
What can we do with
microbial WGS data?
A/Prof Torsten Seemann
Victorian Life Sciences Computation Initiative (VLSCI)
Microbiological Diagnostic Unit Public Health Laboratory (MDU PHL)
Doherty Applied Microbial Genomics (DAMG)
The University of Melbourne
What can we do with microbial WGS data? - T.Seemann - McGill Summer 2016 - Montreal, CA - Wed 22 June 2016
About me
Melbourne, Australia
Microbial genomics + bioinformatics
Doherty Centre for
Applied Microbial Genomics
Microbiological Diagnostic Unit
∷ Oldest public health lab in Australia
: established 1897 in Melbourne
: large historical isolate collection back to 1950s
∷ National reference laboratory
: Salmonella, Listeria, EHEC
∷ WHO regional reference lab
: vaccine preventable invasive bacterial pathogens
Bacterial genomics
Small genome
6,000,000,000
letters
30,000 genes
Genome
A T G C
3,000,000
letters
3,000 genes
Replicons
Usually 1 big
circular chromosome
(1M to 10M bases)
Sometimes 1-6
“mini” chromosomes
(4k - 300k bases)
(Relatively) fast growers
E.coli ~ 20 minutes
M.tb ~ 20 hours
Vertical transfer of DNA
Occurs during cell division
Sometimes it makes an
error copying the DNA
eg. A → T
Horizontal transfer of DNA
Occurs between bacterial cells
Plasmids: virulence & antibiotic resistance genes!
The real tree of life
A mixture of horizontal & vertical transmission.
Whole genome
sequencing
(WGS)
In an ideal world
The real world ( for now )
Shred
Reads are stored in “FASTQ” files
Genome
Sequence
WGS technologies
100 - 300 bp
100 - 400 bp
5,000 - 25,000+ bp
5,000 - 150,000+ bp
Which sequencing platform?
Long reads
Low
cost
High
quality
Pick
any 2
Workhorse for bacterial sequencing
100 - 300 bp
100 - 400 bp
5,000 - 25,000+ bp
5,000 - 150,000+ bp
Types of reads
DNA fragment
~500 bp
“Paired end”
“Single end”
R2R1
What you get back
Millions to billions of reads (big files):
ATGCTTCTCCGCCTTTAATTAAAATTCCATTTCGTGCACCAACACCCGTTCCTACCATAATAGCTGTTGGAGTCGCTAAACCTAATGCACATGGACACGC <- 1st read
CTAAGATACTGCCATCTTCTTCCAACGTAAATTGTACGTGATTTTCGATCCATTTTCTTCGAGGTTCTACTTTGTCACCCATTAGTGTGGTTACTCGACG <- 2nd read
GAATATGCGTGGACAGATGACGAATTGGCAGCAATGATTAAAAAAGTCGGCAAAGGATATATGCTACAGCGATATAAAGGACTTGGAGAGATGAATGCGG
ATCAATGCAAATACAAGATGTGACAATGCGCGCAATGCAATGATAACTGGTGTTGTCAAAAAGAAACCGAATGTCGTACCTAGTGCAACAGCCACTGCAA
GGAAAAAATGAGAAAAAATTCAGTTCGAAAACTAACGATTTCTGCTTTATTGATTGGGATGGGGGTCATTATCCCAATGGTTATGCCTAAAATCATGATC
GATGAAACAATCCAACAAATACCATTCAATAATTTCACAGGGGAAAATGAGACNCTAAGTTTCCCCGTATCAGAAGCAACAGAAAGAATGGTGTTTCGCT
...
... <--- 100 to 300 bp --->
...
AATTGGACTTTGTCACCGATTTTCAGTTCATCTATGTCCACGCTTATTTTTTCAGCAGTAGCATTCAAAATCACTCCGTCATTGCTGAATGATGTCCCCA
CTCCTGTTTCTTTATCTATAATTGAACTGTAAACATGAGGAATCACTTTTTTTACACCTGCATCGATTGCAATTTTCAGAATTTCTTCAAAGTTTGAAAG
AAACTGCCATTCAAATGCTGCAAGACATGGGAGGTACTTCAATCAAGTATTTCCCGATGAAAGGCTTAGCACATAGGGAAGAATTTAAAGCAGTTGCGGA
ATCATTCCTACGCCAGTCATTTCGCGTAGTTCTTTTACCATTTTAGCTGTAACGTCTGCCATGTTTAACTCCTCCTGTGTGTGTTCTTTTTAAAAAAAGC <- last read
Applications of WGS
∷ Diagnostics
: species ⇒ subspecies ⇒ strain identification
: in silico antibiogram and virulence profile
∷ Surveillance
: in silico genotyping - MLST, serotyping, VNTR, MLVA
: what’s lurking in our hospital/community?
∷ Forensics
: outbreak detection & source tracking
: phylogenomics
Not just genomes!
If you can transform your assay into sequencing
lots of short pieces of DNA, then NGS is applicable.
○ exome (targeted subsets of genomic DNA)
○ RNA-Seq (transcripts via cDNA)
○ ChIP-Seq (protein:DNA binding sites)
○ HITS-CLIP (protein:RNA binding sites)
○ methylation (bisulphite treatment of CpG)
FASTA sequence
file format
FASTA
>NM_006361.5 Alchohol dehydrogenase (ADH) EC 1.1.1.1
ATGTGCGTCAAGACGGCCGTGCTGAGCGAATGCAGGCGACTTGCGAGCTGGGAGCGAT
TTGGATTCCCCCGGCCTGGGTGGGGAGAGCGAGCTGGGTGCCCCCTAGATTCCCCGCC
CCCGGCCGACCCTCGGCTCCATGGAGCCCGGCAATTATGCCACCTTGGATGGAGCCAA
GGATATCTGGGAGCGGGAGGGGGGCGGAATTGA
FASTA components
>NM_006361.5 Alchohol dehydrogenase (ADH) EC 1.1.1.1
ATGTGCGTCAAGACGGCCGTGCTGAGCGAATGCAGGCGACTTGCGAGCTGGGAGCGAT
TTGGATTCCCCCGGCCTGGGTGGGGAGAGCGAGCTGGGTGCCCCCTAGATTCCCCGCC
CCCGGCCGACCCTCGGCTCCATGGAGCCCGGCAATTATGCCACCTTGGATGGAGCCAA
GGATATCTGGGAGCGGGAGGGGGGCGGAATTGA
Start
symbol Sequence ID
(no spaces)
The sequence
(usually 60 letters per line)
Sequence description
(spaces allowed)
Multi-FASTA
>read00001
TCTTGCGTCAAGACGGCCGTGCTGAGCGAATGCAGGCGACTTGCGAGCTGGGAGCGA
>read00002
TGGATTCCCCCGGCCTGGGTGGGGAGAGCGAGCTGGGTGCCCCCTAGATTCCCCGCC
>read00003
GGCCGACCCTCGGCTCCATGGAGCCCGGCAATTATGCCACCTTGGATGGAGCCAAGG
>read00004
TCTGGGAGCGGGAGGGGGGCGGAATCTGGAGCGAGCTGGGTGCCCCCTAGATTCCCC
>read00004
GCGGAATCTGGAGCGAGCTGGGTGCCCCCTAGATTCCCCGCATCGTAGATTAGATAT
Concatenation of individual FASTA entries, using ">" as an
entry separator
The DNA alphabet
● Standard
○ A G T C
● Extended
○ adds N (unknown base)
● Full
○ adds R Y M S W K V H D B (ambiguous bases)
○ R = A or G (puRine)
○ Y = C or T (pYrimidine)
○ ... and so on for all the combinations
Sequence Quality
What data do we really have?
Isolate genome
Sequenced reads
Other isolates in
sequencing run
Contamination
Sequencing adaptors
Spike-in controls eg. phiX
Unsequenced
regions
Do we have enough data?
∷ Depth
: expressed as fold-coverage of genome eg. 25x
: means each base sequenced 25 times (on average)
∷ Coverage
: the % of genome sequenced with depth > 0
25x
Genome
Depth (of coverage)
Depth
● nonsense reads instrument oddness
● duplicate reads amplify a low complexity library
● adaptor read-through fragment too short
● indel errors skipping bases, inserting extra bases
● uncalled base couldn't reliably estimate, replace with "N"
● substitution errors reading wrong base
Sequences have errors
More common
Less common
Illumina reads
● Usually 100 - 300 bp
● Indel errors are rare
● Substitution errors < 1%
○ Error rate higher at 3' end
● Very high quality overall
DNA base quality
● DNA sequences often have a quality value
associated with each nucleotide
● A measure of reliability for each base
● Derived from a physical process
■ chromatogram (Sanger sequencing)
■ pH reading (Ion Torrent sequencing)
■ Voltage measurement (Oxford Nanopore)
“Phred” qualities
Q = -10 log10
P <=> P = 10- Q / 10
Q = Phred quality score P = probability of base being incorrect
Quality Chance it's wrong Accuracy Description
10 1 in 10 90% Bad
20 1 in 100 99% Maybe
30 1 in 1000 99.9% OK
40 1 in 10,000 99.99% Very good
50 1 in 100,000 99.999% Excellent
Quality plot (FastQC)
Y-axis is "Phred" quality values (higher is better)
Quality filtering
● Keep all reads
○ let the downstream software cope
● Reject some reads
○ average quality below some threshold
○ contain any ambiguous bases
● Trim reads
○ remove low quality bases from end(s)
○ keep longest "sub-read" that is acceptable
● Best strategy is analysis dependent
FASTQ files
FASTQ
@read00179
AGTCTGATATGCTGTACCTATTATAATTCTAGGCGCTCAT
+
8;ACCCD?DD???@B9<9<871CAC@=A;0.-&*,(0**#
FASTQ sequence entry looks like this:
FASTQ components
@read00179
AGTCTGATATGCTGTACCTATTATAATTCTAGGCGCTCAT
+
8;ACCCD?DD???@B9<9<871CAC@=A;0.-&*,(0**#
Start symbol Sequence ID Sequence
Separator line
Encoded quality values, one
symbol per nucleotide
FASTQ quality encoding
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJ
| | | | |
Q0 Q10 Q20 Q30 Q40
bad maybe ok good excellent
Uses letters/symbols to represent numbers:
Multi-FASTQ
Same as multi-FASTA, just concatenate:
@M00267:3:15997:1501
CTCGTGCTCTACTTTAGAAGCTAATGATTCTGTTTGTAGAACATTTTCTACCACTACATCTTTTTCTTGCTTCGCATCTT
+
:=?DD:BDDF>FFHI>E>B9AE>4C<4CCAE+AEG3?EAGEHCGIIIIIIIIIIIIGIIIEIIIIGGIDGIID/;4C<EE
@M00267:3:15997:1505
GCCTATAGTAGAAGAAAAAGAAGTGGCTCAAGAAATGAGTGCACCGCAGGAAGTTCCAGCGGCTGAATTACTTCATGAAA
+
<@@FFF?DHFHGHIIIFGIIGIGICDGEGCHIIIIIIIIIGIHIIFG<DA7=BHHGGIEHDBEBA@CECDD@CC>CCCAC
@M00267:3:14073:1508
GTCTTGCTAAATTTAAATAATCTGAAATAATTTGTTCTGCCCGGTCCAATTCAGCTAATACGAGACGCATATAATCCTTA
+
:?DDDDD?84CFHC><F>9EEH>B>+A4+CEH4FFEHFHIIIIIIIIIIIIIGGIIIIIIIIG>B7BBEBBB@CDDCFC
@M00267:3:14073:1513
ACGTACAGAGATGCAAAAGTCAGAGAAACTTAATATTGTAAGTGAGTTAGCAGCAAGTGTTGCACATGAGGTTCGAAATC
+
1@@DDDADHGDF?FBGGAFHHCHGGCGGFHIECHGIIGIGFGHGHIIHHEGCCFCB>GEDF=FCFBGGGD@HEHE9=;AD
Got my reads, now what?
Two options
∷ De novo genome assembly
: reconstruct original sequence from reads alone
: like a giant jigsaw puzzle
: Create
∷ Align to reference
: identify where each read fits on a related genome
: can not always be uniquely placed
: Compare
Genome assembly
(the red pill)
De novo = without reference to other genomes
De novo genome assembly
De novo assembly
Ideally, one sequence per chromosome.
Millions of short
sequence
(reads)
A few long
sequences
(contigs)
Reconstruct the original genome sequence
from the sequence reads only
Overlap - Layout - Consensus
Amplified DNA
Shear DNA
Sequenced reads
Overlaps
Layout
Consensus ↠ “Contigs”
Draft vs Finished genomes
250 bp - Illumina - $250 8000 bp - Pacbio - $2500
Repeats
Repeat copy 1 Repeat copy 2
Collapsed repeat consensus
1 locus
4 contigs
Long reads can span repeats
Repeat copy 1 Repeat copy 2
long
reads
The law of repeats
● It is impossible to resolve repeats of length L
unless you have reads longer than L.
● It is impossible to resolve repeats of length L
unless you have reads longer than L.
Align to reference
(the blue pill)
Align to reference
Seven short 4bp reads
AGTC TTAC GGGA CTTT
TAGG TTTA ATAG
Aligned to 31bp reference
AGTCTTTATTATAGGGAGCCATAGCTTTACA
AGTC TAGG ATAG TTAC
TTTA GGGA CTTT
Eight short 4bp reads
AGTC TTAC GGGA CTTT
TAGG TTTA ATAG TTAT
Aligned to 31bp reference
AGTCTTTATTATAGGGAGCCATAGCTTTACA
AGTC TAGG ATAG TTAC
TTTA GGGA CTTT
TTAT
TTAT
Ambiguous alignment
D’oh!
AGTCTGATTAGCTTAGCTTGTAGCGCTATATTAT
AGTCTGATTAGCTTAGAT
ATTAGCTTAGATTGTAG
CTTAGATTGTAGC-C
TGATTAGCTTAGATTGTAGC-CTATAT
TAGCTTAGATTGTAGC-CTATATT
TAGATTGTAGC-CTATATTA
TAGATTGTAGC-CTATATTAT
Look at differences
Reference
Reads
Look at differences
AGTCTGATTAGCTTAGCTTGTAGCGCTATATTAT
AGTCTGATTAGCTTAGAT
ATTAGCTTAGATTGTAG
CTTAGATTGTAGC-C
TGATTAGCTTAGATTGTAGC-CTATAT
TAGCTTAGATTGTAGC-CTATATT
TAGATTGTAGC-CTATATTA
TAGATTGTAGC-CTATATTAT
Substitution Deletion
Reference
Reads
Types of variants we can detect
Type Reference Alternate
SNP (single) T G
MNP (multiple) TA GC
Insertion AGT ACGT
“ ATCGGG ATCTGAGGG
Deletion ACGT AGT
“ ATCTGAGGG ATCGGG
Synonymous & non-synonymous SNPs
Indel causing frame-shift
Indel causing truncation
Best practice
■ Use both approaches
□ reference-based + de novo
■ Best of both worlds
□ and worst of both worlds - interpretation is non-trivial
■ Still need
□ good epidemiology, metadata and domain knowledge!
Downstream bioinformatics
Correcting contigs
■ Pacbio - long reads
□ ~10 x 1bp homopolymer insertion errors per Mbp
□ Cause frame-shift errors in coding genes
■ Illumina - short reads
□ Don’t suffer from indel issues
■ Use Illumina to correct Pacbio!
□ It works well
Species identification
Annotation
Adding biological information to sequences.
ACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGA
AAAGCAGCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTC
CCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTG
GCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGG
ACAGAATGCCCTGCAGGAACTTCTTCTAGAAGACCTTCTCCTCCTG
CAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGA
CCTGAAACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCT
CTCCGTCCGTCCGTGGGCCACGGCCACCGCTTTTTTTTTTGCC
delta toxin
PubMed: 15353161
ribosome
binding site
transfer RNA
Leu-(UUR)
tandemrepeat
CCGTx3
homopolymer
10 x T
Antimicrobial resistance
Phylogenetics
Core genome
Core is common to all & has similar sequence.
Pan genome
Rows are genomes, columns are genes.
Application to public health
and clinical microbiology
Traditional workflow
A bacterial isolate
Focus on a small “informative” section
e.g. MLST, VNTR, PFGE, <insert genotyping method here>
Genotype shows isolates are related
D’oh!
Modern workflow
Does WGS deliver?
Yes!Bioinformatics Epidemiology
Technology
Microbiology
This means
scientists
not just software
Domain
expertise
Always changing...
Conclusions
Take home messages
■ Shorts reads & repeats
□ Can’t reconstruct genome fully
□ Can’t always align unambiguously
■ Bioinformatics is a skill
□ not just pushing buttons
□ be nice to us and we will enjoy helping you
Acknowledgements
Anne Syme
Simon Gladman
Anders da Silva
Dieter Bulach
Marcel Behr
Lynn Dery Capes
Robyn Lee
Ines Levade
The end.

More Related Content

What's hot

Pharmacodynamics of antibiotics
Pharmacodynamics of antibioticsPharmacodynamics of antibiotics
Pharmacodynamics of antibiotics
Htet Wai Moe
 
principles of antibiotic use in critical care
principles of antibiotic use in critical careprinciples of antibiotic use in critical care
principles of antibiotic use in critical care
Ahmed Abdelazeem
 
EUCAST disk diffusion method
EUCAST disk diffusion methodEUCAST disk diffusion method
EUCAST disk diffusion method
ILRI
 
Role of echinocandins in invasive fungal infection
Role of echinocandins in invasive fungal infectionRole of echinocandins in invasive fungal infection
Role of echinocandins in invasive fungal infection
Harsh shaH
 
Line probe assay 26 7-15
Line probe assay 26 7-15Line probe assay 26 7-15
Line probe assay 26 7-15
Yahya Noori, Ph.D
 
Testing
TestingTesting
Testingguru99
 
Optimal Antibiotic Strategies in ICU
Optimal Antibiotic Strategies in ICUOptimal Antibiotic Strategies in ICU
Optimal Antibiotic Strategies in ICU
Yazan Kherallah
 
Antibiotic Senstivity Testing 2017 Update
Antibiotic Senstivity Testing 2017 UpdateAntibiotic Senstivity Testing 2017 Update
Antibiotic Senstivity Testing 2017 Update
Margie Morgan
 
Newer antibiotics and uses
Newer antibiotics and usesNewer antibiotics and uses
Newer antibiotics and uses
Sujit Shrestha
 
Fosfomycin injection
Fosfomycin injectionFosfomycin injection
Fosfomycin injection
Harsh shaH
 
Antimicrobial Stewardship
Antimicrobial StewardshipAntimicrobial Stewardship
Antimicrobial Stewardship
Apollo Hospitals
 
Antibiotics stewardship in the emergency room
Antibiotics stewardship in the emergency roomAntibiotics stewardship in the emergency room
Antibiotics stewardship in the emergency room
Rashid Abuelhassan
 
Antimicrobial stewardship CME 04-03-19
Antimicrobial stewardship CME 04-03-19Antimicrobial stewardship CME 04-03-19
Antimicrobial stewardship CME 04-03-19
Tahseen Siddiqui
 
Prophylaxis and empirical uses of antibiotics
Prophylaxis and empirical uses of antibioticsProphylaxis and empirical uses of antibiotics
Prophylaxis and empirical uses of antibiotics
Aman Ullah
 
Growing antimicrobial resistance – meeting the challenges
Growing antimicrobial resistance – meeting the challengesGrowing antimicrobial resistance – meeting the challenges
Growing antimicrobial resistance – meeting the challengesNeha Sharma
 
Lecture 05.2014
Lecture 05.2014Lecture 05.2014
Lecture 05.2014
Dr. Geoffrey K. K. Maiyoh
 
Antibiotic stewardship programme hiht final 3nov2012
Antibiotic stewardship programme hiht final 3nov2012Antibiotic stewardship programme hiht final 3nov2012
Antibiotic stewardship programme hiht final 3nov2012Vikas Kesarwani
 
Antibiogram CLSI Recommendations
Antibiogram CLSI RecommendationsAntibiogram CLSI Recommendations
Antibiogram CLSI Recommendations
Mostafa Mahmoud
 
0VERVIEW OF ANTIBIOTIC RESISTANCE 111.pptx
0VERVIEW OF ANTIBIOTIC RESISTANCE 111.pptx0VERVIEW OF ANTIBIOTIC RESISTANCE 111.pptx
0VERVIEW OF ANTIBIOTIC RESISTANCE 111.pptx
KrishnaSupalkar
 

What's hot (20)

Pharmacodynamics of antibiotics
Pharmacodynamics of antibioticsPharmacodynamics of antibiotics
Pharmacodynamics of antibiotics
 
Post antibiotic-sub-mic-effects
Post antibiotic-sub-mic-effectsPost antibiotic-sub-mic-effects
Post antibiotic-sub-mic-effects
 
principles of antibiotic use in critical care
principles of antibiotic use in critical careprinciples of antibiotic use in critical care
principles of antibiotic use in critical care
 
EUCAST disk diffusion method
EUCAST disk diffusion methodEUCAST disk diffusion method
EUCAST disk diffusion method
 
Role of echinocandins in invasive fungal infection
Role of echinocandins in invasive fungal infectionRole of echinocandins in invasive fungal infection
Role of echinocandins in invasive fungal infection
 
Line probe assay 26 7-15
Line probe assay 26 7-15Line probe assay 26 7-15
Line probe assay 26 7-15
 
Testing
TestingTesting
Testing
 
Optimal Antibiotic Strategies in ICU
Optimal Antibiotic Strategies in ICUOptimal Antibiotic Strategies in ICU
Optimal Antibiotic Strategies in ICU
 
Antibiotic Senstivity Testing 2017 Update
Antibiotic Senstivity Testing 2017 UpdateAntibiotic Senstivity Testing 2017 Update
Antibiotic Senstivity Testing 2017 Update
 
Newer antibiotics and uses
Newer antibiotics and usesNewer antibiotics and uses
Newer antibiotics and uses
 
Fosfomycin injection
Fosfomycin injectionFosfomycin injection
Fosfomycin injection
 
Antimicrobial Stewardship
Antimicrobial StewardshipAntimicrobial Stewardship
Antimicrobial Stewardship
 
Antibiotics stewardship in the emergency room
Antibiotics stewardship in the emergency roomAntibiotics stewardship in the emergency room
Antibiotics stewardship in the emergency room
 
Antimicrobial stewardship CME 04-03-19
Antimicrobial stewardship CME 04-03-19Antimicrobial stewardship CME 04-03-19
Antimicrobial stewardship CME 04-03-19
 
Prophylaxis and empirical uses of antibiotics
Prophylaxis and empirical uses of antibioticsProphylaxis and empirical uses of antibiotics
Prophylaxis and empirical uses of antibiotics
 
Growing antimicrobial resistance – meeting the challenges
Growing antimicrobial resistance – meeting the challengesGrowing antimicrobial resistance – meeting the challenges
Growing antimicrobial resistance – meeting the challenges
 
Lecture 05.2014
Lecture 05.2014Lecture 05.2014
Lecture 05.2014
 
Antibiotic stewardship programme hiht final 3nov2012
Antibiotic stewardship programme hiht final 3nov2012Antibiotic stewardship programme hiht final 3nov2012
Antibiotic stewardship programme hiht final 3nov2012
 
Antibiogram CLSI Recommendations
Antibiogram CLSI RecommendationsAntibiogram CLSI Recommendations
Antibiogram CLSI Recommendations
 
0VERVIEW OF ANTIBIOTIC RESISTANCE 111.pptx
0VERVIEW OF ANTIBIOTIC RESISTANCE 111.pptx0VERVIEW OF ANTIBIOTIC RESISTANCE 111.pptx
0VERVIEW OF ANTIBIOTIC RESISTANCE 111.pptx
 

Viewers also liked

Toolbox for bacterial population analysis using NGS
Toolbox for bacterial population analysis using NGSToolbox for bacterial population analysis using NGS
Toolbox for bacterial population analysis using NGS
Mirko Rossi
 
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Torsten Seemann
 
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
Torsten Seemann
 
EU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for Harmonization
EU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for HarmonizationEU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for Harmonization
EU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for Harmonization
European Centre for Disease Prevention and Control (ECDC)
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Torsten Seemann
 
The Global Micorbial Identifier (GMI) initiative - and its working groups
The Global Micorbial Identifier (GMI) initiative - and its working groupsThe Global Micorbial Identifier (GMI) initiative - and its working groups
The Global Micorbial Identifier (GMI) initiative - and its working groups
ExternalEvents
 
Whole Genome Sequencing (WGS): How significant is it for food safety?
Whole Genome Sequencing (WGS): How significant is it for food safety? Whole Genome Sequencing (WGS): How significant is it for food safety?
Whole Genome Sequencing (WGS): How significant is it for food safety?
FAO
 
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
nist-spin
 
Rossen eccmid2015v1.5
Rossen eccmid2015v1.5Rossen eccmid2015v1.5
A Comparison of NGS Platforms.
A Comparison of NGS Platforms.A Comparison of NGS Platforms.
A Comparison of NGS Platforms.mkim8
 
Introduction to next generation sequencing
Introduction to next generation sequencingIntroduction to next generation sequencing
Introduction to next generation sequencing
VHIR Vall d’Hebron Institut de Recerca
 
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
Torsten Seemann
 
Metagenomics sequencing
Metagenomics sequencingMetagenomics sequencing
Metagenomics sequencing
cdgenomics525
 
Proposal for 2016 survey of WGS capacity in EU/EEA Member States
Proposal for 2016 survey of WGS capacity in EU/EEA Member StatesProposal for 2016 survey of WGS capacity in EU/EEA Member States
Proposal for 2016 survey of WGS capacity in EU/EEA Member States
European Center for Disease Prevention and Control (ECDC)
 
Aug2015 deanna church analytical validation
Aug2015 deanna church analytical validationAug2015 deanna church analytical validation
Aug2015 deanna church analytical validation
GenomeInABottle
 
Making Use of NGS Data: From Reads to Trees and Annotations
Making Use of NGS Data: From Reads to Trees and AnnotationsMaking Use of NGS Data: From Reads to Trees and Annotations
Making Use of NGS Data: From Reads to Trees and Annotations
João André Carriço
 
Whole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiologyWhole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiology
Philip Ashton
 
Genome Wide Methodologies and Future Perspectives
 Genome Wide Methodologies and Future Perspectives Genome Wide Methodologies and Future Perspectives
Genome Wide Methodologies and Future Perspectives
Brian Krueger
 
The Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome SequencingThe Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome Sequencing
Emiliano De Cristofaro
 

Viewers also liked (20)

Toolbox for bacterial population analysis using NGS
Toolbox for bacterial population analysis using NGSToolbox for bacterial population analysis using NGS
Toolbox for bacterial population analysis using NGS
 
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
 
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
 
EU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for Harmonization
EU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for HarmonizationEU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for Harmonization
EU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for Harmonization
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
 
Poster ESHG
Poster ESHGPoster ESHG
Poster ESHG
 
The Global Micorbial Identifier (GMI) initiative - and its working groups
The Global Micorbial Identifier (GMI) initiative - and its working groupsThe Global Micorbial Identifier (GMI) initiative - and its working groups
The Global Micorbial Identifier (GMI) initiative - and its working groups
 
Whole Genome Sequencing (WGS): How significant is it for food safety?
Whole Genome Sequencing (WGS): How significant is it for food safety? Whole Genome Sequencing (WGS): How significant is it for food safety?
Whole Genome Sequencing (WGS): How significant is it for food safety?
 
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
 
Rossen eccmid2015v1.5
Rossen eccmid2015v1.5Rossen eccmid2015v1.5
Rossen eccmid2015v1.5
 
A Comparison of NGS Platforms.
A Comparison of NGS Platforms.A Comparison of NGS Platforms.
A Comparison of NGS Platforms.
 
Introduction to next generation sequencing
Introduction to next generation sequencingIntroduction to next generation sequencing
Introduction to next generation sequencing
 
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
 
Metagenomics sequencing
Metagenomics sequencingMetagenomics sequencing
Metagenomics sequencing
 
Proposal for 2016 survey of WGS capacity in EU/EEA Member States
Proposal for 2016 survey of WGS capacity in EU/EEA Member StatesProposal for 2016 survey of WGS capacity in EU/EEA Member States
Proposal for 2016 survey of WGS capacity in EU/EEA Member States
 
Aug2015 deanna church analytical validation
Aug2015 deanna church analytical validationAug2015 deanna church analytical validation
Aug2015 deanna church analytical validation
 
Making Use of NGS Data: From Reads to Trees and Annotations
Making Use of NGS Data: From Reads to Trees and AnnotationsMaking Use of NGS Data: From Reads to Trees and Annotations
Making Use of NGS Data: From Reads to Trees and Annotations
 
Whole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiologyWhole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiology
 
Genome Wide Methodologies and Future Perspectives
 Genome Wide Methodologies and Future Perspectives Genome Wide Methodologies and Future Perspectives
Genome Wide Methodologies and Future Perspectives
 
The Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome SequencingThe Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome Sequencing
 

Similar to What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - montreal, ca - wed 22 june 2016

Introducing data analysis: reads to results
Introducing data analysis: reads to resultsIntroducing data analysis: reads to results
Introducing data analysis: reads to results
AGRF_Ltd
 
Introduction to bioinformatics
Introduction to bioinformaticsIntroduction to bioinformatics
Introduction to bioinformatics
Andrzej Stefan Czech
 
Metagenome Sequence Assembly (CABBIO 20150629 Buenos Aires)
Metagenome Sequence Assembly (CABBIO 20150629 Buenos Aires)Metagenome Sequence Assembly (CABBIO 20150629 Buenos Aires)
Metagenome Sequence Assembly (CABBIO 20150629 Buenos Aires)
bedutilh
 
2015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and22015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and2
Dan Gaston
 
Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013mcmahonUW
 
Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013
Torsten Seemann
 
RNA-seq: analysis of raw data and preprocessing - part 2
RNA-seq: analysis of raw data and preprocessing - part 2RNA-seq: analysis of raw data and preprocessing - part 2
RNA-seq: analysis of raw data and preprocessing - part 2
BITS
 
Blast fasta 4
Blast fasta 4Blast fasta 4
Blast fasta 4
Er Puspendra Tripathi
 
Gene prediction and expression
Gene prediction and expressionGene prediction and expression
Gene prediction and expression
ishi tandon
 
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Vall d'Hebron Institute of Research (VHIR)
 
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
Joseph Hughes
 
Use of bio-informatic tools in bacterial genetics
Use of bio-informatic tools in bacterial geneticsUse of bio-informatic tools in bacterial genetics
Use of bio-informatic tools in bacterial genetics
Debtanu Chakraborty
 
High Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can KnowHigh Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can Know
Brian Krueger
 
Coding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS eraCoding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS era
Lex Nederbragt
 
Unit B7 8 Protein Synthesis
Unit B7 8 Protein SynthesisUnit B7 8 Protein Synthesis
Unit B7 8 Protein Synthesissciencechris
 
Unit 2 Star Activity.pdf
Unit 2 Star Activity.pdfUnit 2 Star Activity.pdf
Unit 2 Star Activity.pdf
KhushiDuttVatsa
 
RNA-seq quality control and pre-processing
RNA-seq quality control and pre-processingRNA-seq quality control and pre-processing
RNA-seq quality control and pre-processing
mikaelhuss
 
Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121
Jane Landolin
 
Bioc4010 sample questions
Bioc4010 sample questionsBioc4010 sample questions
Bioc4010 sample questions
Dan Gaston
 

Similar to What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - montreal, ca - wed 22 june 2016 (20)

Introducing data analysis: reads to results
Introducing data analysis: reads to resultsIntroducing data analysis: reads to results
Introducing data analysis: reads to results
 
Introduction to bioinformatics
Introduction to bioinformaticsIntroduction to bioinformatics
Introduction to bioinformatics
 
Metagenome Sequence Assembly (CABBIO 20150629 Buenos Aires)
Metagenome Sequence Assembly (CABBIO 20150629 Buenos Aires)Metagenome Sequence Assembly (CABBIO 20150629 Buenos Aires)
Metagenome Sequence Assembly (CABBIO 20150629 Buenos Aires)
 
2015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and22015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and2
 
Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013
 
Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013
 
RNA-seq: analysis of raw data and preprocessing - part 2
RNA-seq: analysis of raw data and preprocessing - part 2RNA-seq: analysis of raw data and preprocessing - part 2
RNA-seq: analysis of raw data and preprocessing - part 2
 
Blast fasta 4
Blast fasta 4Blast fasta 4
Blast fasta 4
 
Lecture6.pptx
Lecture6.pptxLecture6.pptx
Lecture6.pptx
 
Gene prediction and expression
Gene prediction and expressionGene prediction and expression
Gene prediction and expression
 
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
 
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
 
Use of bio-informatic tools in bacterial genetics
Use of bio-informatic tools in bacterial geneticsUse of bio-informatic tools in bacterial genetics
Use of bio-informatic tools in bacterial genetics
 
High Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can KnowHigh Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can Know
 
Coding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS eraCoding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS era
 
Unit B7 8 Protein Synthesis
Unit B7 8 Protein SynthesisUnit B7 8 Protein Synthesis
Unit B7 8 Protein Synthesis
 
Unit 2 Star Activity.pdf
Unit 2 Star Activity.pdfUnit 2 Star Activity.pdf
Unit 2 Star Activity.pdf
 
RNA-seq quality control and pre-processing
RNA-seq quality control and pre-processingRNA-seq quality control and pre-processing
RNA-seq quality control and pre-processing
 
Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121
 
Bioc4010 sample questions
Bioc4010 sample questionsBioc4010 sample questions
Bioc4010 sample questions
 

More from Torsten Seemann

How to write bioinformatics software no one will use
How to write bioinformatics software no one will useHow to write bioinformatics software no one will use
How to write bioinformatics software no one will use
Torsten Seemann
 
How to write bioinformatics software people will use and cite - t.seemann - ...
How to write bioinformatics software people will use and cite -  t.seemann - ...How to write bioinformatics software people will use and cite -  t.seemann - ...
How to write bioinformatics software people will use and cite - t.seemann - ...
Torsten Seemann
 
Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016
Torsten Seemann
 
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...
Sequencing your poo with a usb stick -  Linux.conf.au 2016 miniconf  - mon 1 ...Sequencing your poo with a usb stick -  Linux.conf.au 2016 miniconf  - mon 1 ...
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...
Torsten Seemann
 
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
Torsten Seemann
 
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
Torsten Seemann
 
De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015Torsten Seemann
 
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Torsten Seemann
 
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Torsten Seemann
 
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Torsten Seemann
 
Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015
Torsten Seemann
 
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Torsten Seemann
 
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
Torsten Seemann
 
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
Torsten Seemann
 
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
Torsten Seemann
 
Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012
Torsten Seemann
 
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
Torsten Seemann
 

More from Torsten Seemann (17)

How to write bioinformatics software no one will use
How to write bioinformatics software no one will useHow to write bioinformatics software no one will use
How to write bioinformatics software no one will use
 
How to write bioinformatics software people will use and cite - t.seemann - ...
How to write bioinformatics software people will use and cite -  t.seemann - ...How to write bioinformatics software people will use and cite -  t.seemann - ...
How to write bioinformatics software people will use and cite - t.seemann - ...
 
Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016
 
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...
Sequencing your poo with a usb stick -  Linux.conf.au 2016 miniconf  - mon 1 ...Sequencing your poo with a usb stick -  Linux.conf.au 2016 miniconf  - mon 1 ...
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...
 
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
 
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
 
De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015
 
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
 
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
 
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
 
Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015
 
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
 
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
 
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
 
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
 
Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012
 
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
 

Recently uploaded

Hemostasis_importance& clinical significance.pptx
Hemostasis_importance& clinical significance.pptxHemostasis_importance& clinical significance.pptx
Hemostasis_importance& clinical significance.pptx
muralinath2
 
Richard's aventures in two entangled wonderlands
Richard's aventures in two entangled wonderlandsRichard's aventures in two entangled wonderlands
Richard's aventures in two entangled wonderlands
Richard Gill
 
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...
University of Maribor
 
platelets_clotting_biogenesis.clot retractionpptx
platelets_clotting_biogenesis.clot retractionpptxplatelets_clotting_biogenesis.clot retractionpptx
platelets_clotting_biogenesis.clot retractionpptx
muralinath2
 
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
Sérgio Sacani
 
Chapter 12 - climate change and the energy crisis
Chapter 12 - climate change and the energy crisisChapter 12 - climate change and the energy crisis
Chapter 12 - climate change and the energy crisis
tonzsalvador2222
 
in vitro propagation of plants lecture note.pptx
in vitro propagation of plants lecture note.pptxin vitro propagation of plants lecture note.pptx
in vitro propagation of plants lecture note.pptx
yusufzako14
 
S.1 chemistry scheme term 2 for ordinary level
S.1 chemistry scheme term 2 for ordinary levelS.1 chemistry scheme term 2 for ordinary level
S.1 chemistry scheme term 2 for ordinary level
ronaldlakony0
 
general properties of oerganologametal.ppt
general properties of oerganologametal.pptgeneral properties of oerganologametal.ppt
general properties of oerganologametal.ppt
IqrimaNabilatulhusni
 
Unveiling the Energy Potential of Marshmallow Deposits.pdf
Unveiling the Energy Potential of Marshmallow Deposits.pdfUnveiling the Energy Potential of Marshmallow Deposits.pdf
Unveiling the Energy Potential of Marshmallow Deposits.pdf
Erdal Coalmaker
 
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
University of Maribor
 
Seminar of U.V. Spectroscopy by SAMIR PANDA
 Seminar of U.V. Spectroscopy by SAMIR PANDA Seminar of U.V. Spectroscopy by SAMIR PANDA
Seminar of U.V. Spectroscopy by SAMIR PANDA
SAMIR PANDA
 
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...
Ana Luísa Pinho
 
BLOOD AND BLOOD COMPONENT- introduction to blood physiology
BLOOD AND BLOOD COMPONENT- introduction to blood physiologyBLOOD AND BLOOD COMPONENT- introduction to blood physiology
BLOOD AND BLOOD COMPONENT- introduction to blood physiology
NoelManyise1
 
Nutraceutical market, scope and growth: Herbal drug technology
Nutraceutical market, scope and growth: Herbal drug technologyNutraceutical market, scope and growth: Herbal drug technology
Nutraceutical market, scope and growth: Herbal drug technology
Lokesh Patil
 
Introduction to Mean Field Theory(MFT).pptx
Introduction to Mean Field Theory(MFT).pptxIntroduction to Mean Field Theory(MFT).pptx
Introduction to Mean Field Theory(MFT).pptx
zeex60
 
What is greenhouse gasses and how many gasses are there to affect the Earth.
What is greenhouse gasses and how many gasses are there to affect the Earth.What is greenhouse gasses and how many gasses are there to affect the Earth.
What is greenhouse gasses and how many gasses are there to affect the Earth.
moosaasad1975
 
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Sérgio Sacani
 
Nucleic Acid-its structural and functional complexity.
Nucleic Acid-its structural and functional complexity.Nucleic Acid-its structural and functional complexity.
Nucleic Acid-its structural and functional complexity.
Nistarini College, Purulia (W.B) India
 
Orion Air Quality Monitoring Systems - CWS
Orion Air Quality Monitoring Systems - CWSOrion Air Quality Monitoring Systems - CWS
Orion Air Quality Monitoring Systems - CWS
Columbia Weather Systems
 

Recently uploaded (20)

Hemostasis_importance& clinical significance.pptx
Hemostasis_importance& clinical significance.pptxHemostasis_importance& clinical significance.pptx
Hemostasis_importance& clinical significance.pptx
 
Richard's aventures in two entangled wonderlands
Richard's aventures in two entangled wonderlandsRichard's aventures in two entangled wonderlands
Richard's aventures in two entangled wonderlands
 
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...
 
platelets_clotting_biogenesis.clot retractionpptx
platelets_clotting_biogenesis.clot retractionpptxplatelets_clotting_biogenesis.clot retractionpptx
platelets_clotting_biogenesis.clot retractionpptx
 
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
 
Chapter 12 - climate change and the energy crisis
Chapter 12 - climate change and the energy crisisChapter 12 - climate change and the energy crisis
Chapter 12 - climate change and the energy crisis
 
in vitro propagation of plants lecture note.pptx
in vitro propagation of plants lecture note.pptxin vitro propagation of plants lecture note.pptx
in vitro propagation of plants lecture note.pptx
 
S.1 chemistry scheme term 2 for ordinary level
S.1 chemistry scheme term 2 for ordinary levelS.1 chemistry scheme term 2 for ordinary level
S.1 chemistry scheme term 2 for ordinary level
 
general properties of oerganologametal.ppt
general properties of oerganologametal.pptgeneral properties of oerganologametal.ppt
general properties of oerganologametal.ppt
 
Unveiling the Energy Potential of Marshmallow Deposits.pdf
Unveiling the Energy Potential of Marshmallow Deposits.pdfUnveiling the Energy Potential of Marshmallow Deposits.pdf
Unveiling the Energy Potential of Marshmallow Deposits.pdf
 
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
 
Seminar of U.V. Spectroscopy by SAMIR PANDA
 Seminar of U.V. Spectroscopy by SAMIR PANDA Seminar of U.V. Spectroscopy by SAMIR PANDA
Seminar of U.V. Spectroscopy by SAMIR PANDA
 
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...
 
BLOOD AND BLOOD COMPONENT- introduction to blood physiology
BLOOD AND BLOOD COMPONENT- introduction to blood physiologyBLOOD AND BLOOD COMPONENT- introduction to blood physiology
BLOOD AND BLOOD COMPONENT- introduction to blood physiology
 
Nutraceutical market, scope and growth: Herbal drug technology
Nutraceutical market, scope and growth: Herbal drug technologyNutraceutical market, scope and growth: Herbal drug technology
Nutraceutical market, scope and growth: Herbal drug technology
 
Introduction to Mean Field Theory(MFT).pptx
Introduction to Mean Field Theory(MFT).pptxIntroduction to Mean Field Theory(MFT).pptx
Introduction to Mean Field Theory(MFT).pptx
 
What is greenhouse gasses and how many gasses are there to affect the Earth.
What is greenhouse gasses and how many gasses are there to affect the Earth.What is greenhouse gasses and how many gasses are there to affect the Earth.
What is greenhouse gasses and how many gasses are there to affect the Earth.
 
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
 
Nucleic Acid-its structural and functional complexity.
Nucleic Acid-its structural and functional complexity.Nucleic Acid-its structural and functional complexity.
Nucleic Acid-its structural and functional complexity.
 
Orion Air Quality Monitoring Systems - CWS
Orion Air Quality Monitoring Systems - CWSOrion Air Quality Monitoring Systems - CWS
Orion Air Quality Monitoring Systems - CWS
 

What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - montreal, ca - wed 22 june 2016