• Recognize that the majority of reported penicillin allergies are
not confirmed upon testing and expose patients to undue
harm
• Understand when diagnostic testing, including skin testing, is
indicated to confirm an antimicrobial allergy
• Employ strategies to determine if cephalosporins can be used
in patients with reported penicillin allergies.
Pk pd analysis and mic interpretation in microbiological reportsCentral Govt, India
This presentation aims to highlight the role of pharmacokinetics and pharmacodynamics of antimicrobials in optimizing therapy in critically ill patients and also role of MIC breakpoint values in guiding antimicrobial therapy
• Recognize that the majority of reported penicillin allergies are
not confirmed upon testing and expose patients to undue
harm
• Understand when diagnostic testing, including skin testing, is
indicated to confirm an antimicrobial allergy
• Employ strategies to determine if cephalosporins can be used
in patients with reported penicillin allergies.
Pk pd analysis and mic interpretation in microbiological reportsCentral Govt, India
This presentation aims to highlight the role of pharmacokinetics and pharmacodynamics of antimicrobials in optimizing therapy in critically ill patients and also role of MIC breakpoint values in guiding antimicrobial therapy
This presentation focuses on appropriate selection of antibiotics in the ICU and discusses different strategies to optimize this selection with the aim to decrease resistance and improve appropriateness.
The newer antibiotics added to Our Arsenal against resistant bacteria. Know about the upcoming antibiotics and newer antibiotics in use.
Free text at
http://medchrome.com/basic-science/pharmacology/newer-antibiotics-review/
The lecture describes the performance and presentation of the antibiograms by the hospitals based upon recommendations of CLSI and shows experience of some of our MOH hospitals with the advantages and pitfalls in them.
This presentation focuses on appropriate selection of antibiotics in the ICU and discusses different strategies to optimize this selection with the aim to decrease resistance and improve appropriateness.
The newer antibiotics added to Our Arsenal against resistant bacteria. Know about the upcoming antibiotics and newer antibiotics in use.
Free text at
http://medchrome.com/basic-science/pharmacology/newer-antibiotics-review/
The lecture describes the performance and presentation of the antibiograms by the hospitals based upon recommendations of CLSI and shows experience of some of our MOH hospitals with the advantages and pitfalls in them.
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015Torsten Seemann
How genomics is changing the practice of public health microbiology. The role of whole genome sequencing as the "one true assay". Another powerful tool for the epidemiologist.
Presentation from the ECDC expert consultation on Whole Genome Sequencing organised by the European Centre of Disease Prevention and Control - Stockholm, 19 November 2015
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...Torsten Seemann
"Bioinformatics tools for the diagnostic laboratory" presented at the Australian Society for Antimicrobials 2016 annual conference in Melbourne Australia. Slides are aimed at a biological / pathology / clinican audience. Some material has been re-imagined from Nick Loman's ECCMID 2015 talk.
The Global Micorbial Identifier (GMI) initiative - and its working groupsExternalEvents
http://www.fao.org/about/meetings/wgs-on-food-safety-management/en/
The GMI initiative - and its working groups. Presentation from the Technical Meeting on the impact of Whole Genome Sequencing (WGS) on food safety management -23-25 May 2016, Rome, Italy.
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...nist-spin
"Next Generation Sequencing for Identification and Subtyping of Foodborne Pathogens" presentation at the Standards for Pathogen Identification via NGS (SPIN) workshop hosted by National Institute for Standards and Technology October 2014 by Rebecca Lindsey, PhD from Enteric Diseases Laboratory Branch of the CDC.
Metagenomics is the study of metagenomes, genetic material recovered directly from environmental samples. The broad field was referred to as environmental genomics, ecogenomics or community genomics. Recent studies use "shotgun" Sanger sequencing or next generation sequencing (NGS) to get largely unbiased samples of all genes from all the members of the sampled communities.
Introducing data analysis: reads to resultsAGRF_Ltd
AGRF in conjunction with EMBL Australia recently organised a workshop at Monash University Clayton. This workshop was targeted at beginners and biologists who are new to analysing Next-Gen Sequencing data. The workshop also aimed to provide users with a snapshot of bioinformatics and data analysis tips on how to begin to analyse project data. Introduction data analysis: reads to results was presented by Dr. Torsten Seemann from the Victorian Bioinformatics Consortium at Monash University, Clayton.
Presented: 1st August 2012
Metagenome Sequence Assembly (CABBIO 20150629 Buenos Aires)bedutilh
This is a one-hour lecture about assembly. It is part of a one-day workshop about metagenome assembly of crAssphage, a bacteriophage virus found in human gut. The hands-on workflow can be found at http://tbb.bio.uu.nl/dutilh/CABBIO/ and should be doable in one afternoon with supervision. There is also an iPython notebook about this here: https://github.com/linsalrob/CrAPy
Metagenomic projects provide a unique window into the genetic composition of microbial communities. To date, metagenomic analyses have focused primarily on studying the composition of microbial populations and inferring shared metabolic pathways. In this work we analyze how high-quality metagenomic data can be leveraged to infer the composition of transcriptional regulatory networks through a combination of in silico and in vitro methods. Using the SOS response as a case example, we analyze human gut microbiome data to determine the composition of the SOS meta-regulon in a natural context. Our analysis provides proof of concept that the existing knowledgebase on regulatory networks and reference genomes can be effectively leveraged to mine meta-genomic data and reconstruct multi-species regulatory networks. This approach allows us to identify de novo the core elements of the human gut SOS meta-regulon, highlighting the relevance of error-prone polymerases in this stress response, and identifies putative novel SOS protein clusters involved in cell wall biogenesis, chromosome partitioning and restriction modification. The methodology implemented in this work can be applied to other metagenomic datasets and transcriptional systems, potentially providing the means to compare regulatory networks across metagenomes. The use of metagenomic data to analyze transcriptional regulatory networks provides a realistic snapshot of these systems in their natural context and allows probing at their extended composition in non-culturable organisms, yielding insights into their interconnection and into the overall structure of transcriptional systems in microbiomes.
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...Joseph Hughes
11th OIE Seminar at the XVII INTERNATIONAL SYMPOSIUM OF THE WORLD ASSOCIATION OF VETERINARY LABORATORY DIAGNOSTICIANS (WAVLD)
Saskatoon - 17th June 2015
Open pacbiomodelorgpaper j_landolin_20150121Jane Landolin
Jane Ladolin's slides on Open Data Paper (http://www.nature.com/articles/sdata201445) presented at Balti and Bioinformatics virtual meeting on Jan. 21st 2015. (http://bit.ly/1KYGxr4)
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...Torsten Seemann
This talk introduces a Linux Professional audience to bacterial genomics and modern sequencing technology. The title is slightly misleading and is a bit of clickbait. The diagrams are good.
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015Torsten Seemann
An introduction to basic genomics bioinformatics concepts in 20 minutes for an audience of clinicians, epidemiologists and other public health officials.
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015Torsten Seemann
Long read sequencing - the good, the bad, and the really cool. Covers Illumina SLR, Pacbio RSII and Oxford Nanopore as of June 2015. Discusses bioinformatics differences of long reads over short reads.
Why and how to clean Illumina genome sequencing reads. Includes illustrative examples, and a case where a project was saved by using Nesoni clip: to discover the cause of non-mapping reads.
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...Torsten Seemann
Invited talk at the Australian Society for Microbiology Annual Conference 2014 on "FriPan" our tool for visualizing bacterial pan genomes across 10-100s of isolates.
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Torsten Seemann
Using Snippy to call variants in bacterial short read datasets via alignment to reference, and then using these alignments to produce core SNP alignments for phylogenomics.
A presentation to a lay audience at Melbourne Knowledge Week on how bacteria are a part of our life and what we are doing with genomics to manage them.
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...Torsten Seemann
I describe the three levels of parallelism that can be exploited in bioinformatics software (1) clusters of multiple computers; (2) multiple cores on each computer; and (3) vector machine code instructions.
Richard's aventures in two entangled wonderlandsRichard Gill
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...University of Maribor
Slides from talk:
Aleš Zamuda: Remote Sensing and Computational, Evolutionary, Supercomputing, and Intelligent Systems.
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Inter-Society Networking Panel GRSS/MTT-S/CIS Panel Session: Promoting Connection and Cooperation
https://www.etran.rs/2024/en/home-english/
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Sérgio Sacani
Since volcanic activity was first discovered on Io from Voyager images in 1979, changes
on Io’s surface have been monitored from both spacecraft and ground-based telescopes.
Here, we present the highest spatial resolution images of Io ever obtained from a groundbased telescope. These images, acquired by the SHARK-VIS instrument on the Large
Binocular Telescope, show evidence of a major resurfacing event on Io’s trailing hemisphere. When compared to the most recent spacecraft images, the SHARK-VIS images
show that a plume deposit from a powerful eruption at Pillan Patera has covered part
of the long-lived Pele plume deposit. Although this type of resurfacing event may be common on Io, few have been detected due to the rarity of spacecraft visits and the previously low spatial resolution available from Earth-based telescopes. The SHARK-VIS instrument ushers in a new era of high resolution imaging of Io’s surface using adaptive
optics at visible wavelengths.
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...University of Maribor
Slides from:
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Track: Artificial Intelligence
https://www.etran.rs/2024/en/home-english/
Seminar of U.V. Spectroscopy by SAMIR PANDASAMIR PANDA
Spectroscopy is a branch of science dealing the study of interaction of electromagnetic radiation with matter.
Ultraviolet-visible spectroscopy refers to absorption spectroscopy or reflect spectroscopy in the UV-VIS spectral region.
Ultraviolet-visible spectroscopy is an analytical method that can measure the amount of light received by the analyte.
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...Ana Luísa Pinho
Functional Magnetic Resonance Imaging (fMRI) provides means to characterize brain activations in response to behavior. However, cognitive neuroscience has been limited to group-level effects referring to the performance of specific tasks. To obtain the functional profile of elementary cognitive mechanisms, the combination of brain responses to many tasks is required. Yet, to date, both structural atlases and parcellation-based activations do not fully account for cognitive function and still present several limitations. Further, they do not adapt overall to individual characteristics. In this talk, I will give an account of deep-behavioral phenotyping strategies, namely data-driven methods in large task-fMRI datasets, to optimize functional brain-data collection and improve inference of effects-of-interest related to mental processes. Key to this approach is the employment of fast multi-functional paradigms rich on features that can be well parametrized and, consequently, facilitate the creation of psycho-physiological constructs to be modelled with imaging data. Particular emphasis will be given to music stimuli when studying high-order cognitive mechanisms, due to their ecological nature and quality to enable complex behavior compounded by discrete entities. I will also discuss how deep-behavioral phenotyping and individualized models applied to neuroimaging data can better account for the subject-specific organization of domain-general cognitive systems in the human brain. Finally, the accumulation of functional brain signatures brings the possibility to clarify relationships among tasks and create a univocal link between brain systems and mental functions through: (1) the development of ontologies proposing an organization of cognitive processes; and (2) brain-network taxonomies describing functional specialization. To this end, tools to improve commensurability in cognitive science are necessary, such as public repositories, ontology-based platforms and automated meta-analysis tools. I will thus discuss some brain-atlasing resources currently under development, and their applicability in cognitive as well as clinical neuroscience.
Nutraceutical market, scope and growth: Herbal drug technologyLokesh Patil
As consumer awareness of health and wellness rises, the nutraceutical market—which includes goods like functional meals, drinks, and dietary supplements that provide health advantages beyond basic nutrition—is growing significantly. As healthcare expenses rise, the population ages, and people want natural and preventative health solutions more and more, this industry is increasing quickly. Further driving market expansion are product formulation innovations and the use of cutting-edge technology for customized nutrition. With its worldwide reach, the nutraceutical industry is expected to keep growing and provide significant chances for research and investment in a number of categories, including vitamins, minerals, probiotics, and herbal supplements.
What is greenhouse gasses and how many gasses are there to affect the Earth.moosaasad1975
What are greenhouse gasses how they affect the earth and its environment what is the future of the environment and earth how the weather and the climate effects.
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Sérgio Sacani
We characterize the earliest galaxy population in the JADES Origins Field (JOF), the deepest
imaging field observed with JWST. We make use of the ancillary Hubble optical images (5 filters
spanning 0.4−0.9µm) and novel JWST images with 14 filters spanning 0.8−5µm, including 7 mediumband filters, and reaching total exposure times of up to 46 hours per filter. We combine all our data
at > 2.3µm to construct an ultradeep image, reaching as deep as ≈ 31.4 AB mag in the stack and
30.3-31.0 AB mag (5σ, r = 0.1” circular aperture) in individual filters. We measure photometric
redshifts and use robust selection criteria to identify a sample of eight galaxy candidates at redshifts
z = 11.5 − 15. These objects show compact half-light radii of R1/2 ∼ 50 − 200pc, stellar masses of
M⋆ ∼ 107−108M⊙, and star-formation rates of SFR ∼ 0.1−1 M⊙ yr−1
. Our search finds no candidates
at 15 < z < 20, placing upper limits at these redshifts. We develop a forward modeling approach to
infer the properties of the evolving luminosity function without binning in redshift or luminosity that
marginalizes over the photometric redshift uncertainty of our candidate galaxies and incorporates the
impact of non-detections. We find a z = 12 luminosity function in good agreement with prior results,
and that the luminosity function normalization and UV luminosity density decline by a factor of ∼ 2.5
from z = 12 to z = 14. We discuss the possible implications of our results in the context of theoretical
models for evolution of the dark matter halo mass function.
This presentation explores a brief idea about the structural and functional attributes of nucleotides, the structure and function of genetic materials along with the impact of UV rays and pH upon them.
Professional air quality monitoring systems provide immediate, on-site data for analysis, compliance, and decision-making.
Monitor common gases, weather parameters, particulates.
What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - montreal, ca - wed 22 june 2016
1. What can we do with
microbial WGS data?
A/Prof Torsten Seemann
Victorian Life Sciences Computation Initiative (VLSCI)
Microbiological Diagnostic Unit Public Health Laboratory (MDU PHL)
Doherty Applied Microbial Genomics (DAMG)
The University of Melbourne
What can we do with microbial WGS data? - T.Seemann - McGill Summer 2016 - Montreal, CA - Wed 22 June 2016
4. Microbial genomics + bioinformatics
Doherty Centre for
Applied Microbial Genomics
5. Microbiological Diagnostic Unit
∷ Oldest public health lab in Australia
: established 1897 in Melbourne
: large historical isolate collection back to 1950s
∷ National reference laboratory
: Salmonella, Listeria, EHEC
∷ WHO regional reference lab
: vaccine preventable invasive bacterial pathogens
20. What you get back
Millions to billions of reads (big files):
ATGCTTCTCCGCCTTTAATTAAAATTCCATTTCGTGCACCAACACCCGTTCCTACCATAATAGCTGTTGGAGTCGCTAAACCTAATGCACATGGACACGC <- 1st read
CTAAGATACTGCCATCTTCTTCCAACGTAAATTGTACGTGATTTTCGATCCATTTTCTTCGAGGTTCTACTTTGTCACCCATTAGTGTGGTTACTCGACG <- 2nd read
GAATATGCGTGGACAGATGACGAATTGGCAGCAATGATTAAAAAAGTCGGCAAAGGATATATGCTACAGCGATATAAAGGACTTGGAGAGATGAATGCGG
ATCAATGCAAATACAAGATGTGACAATGCGCGCAATGCAATGATAACTGGTGTTGTCAAAAAGAAACCGAATGTCGTACCTAGTGCAACAGCCACTGCAA
GGAAAAAATGAGAAAAAATTCAGTTCGAAAACTAACGATTTCTGCTTTATTGATTGGGATGGGGGTCATTATCCCAATGGTTATGCCTAAAATCATGATC
GATGAAACAATCCAACAAATACCATTCAATAATTTCACAGGGGAAAATGAGACNCTAAGTTTCCCCGTATCAGAAGCAACAGAAAGAATGGTGTTTCGCT
...
... <--- 100 to 300 bp --->
...
AATTGGACTTTGTCACCGATTTTCAGTTCATCTATGTCCACGCTTATTTTTTCAGCAGTAGCATTCAAAATCACTCCGTCATTGCTGAATGATGTCCCCA
CTCCTGTTTCTTTATCTATAATTGAACTGTAAACATGAGGAATCACTTTTTTTACACCTGCATCGATTGCAATTTTCAGAATTTCTTCAAAGTTTGAAAG
AAACTGCCATTCAAATGCTGCAAGACATGGGAGGTACTTCAATCAAGTATTTCCCGATGAAAGGCTTAGCACATAGGGAAGAATTTAAAGCAGTTGCGGA
ATCATTCCTACGCCAGTCATTTCGCGTAGTTCTTTTACCATTTTAGCTGTAACGTCTGCCATGTTTAACTCCTCCTGTGTGTGTTCTTTTTAAAAAAAGC <- last read
21. Applications of WGS
∷ Diagnostics
: species ⇒ subspecies ⇒ strain identification
: in silico antibiogram and virulence profile
∷ Surveillance
: in silico genotyping - MLST, serotyping, VNTR, MLVA
: what’s lurking in our hospital/community?
∷ Forensics
: outbreak detection & source tracking
: phylogenomics
22. Not just genomes!
If you can transform your assay into sequencing
lots of short pieces of DNA, then NGS is applicable.
○ exome (targeted subsets of genomic DNA)
○ RNA-Seq (transcripts via cDNA)
○ ChIP-Seq (protein:DNA binding sites)
○ HITS-CLIP (protein:RNA binding sites)
○ methylation (bisulphite treatment of CpG)
25. FASTA components
>NM_006361.5 Alchohol dehydrogenase (ADH) EC 1.1.1.1
ATGTGCGTCAAGACGGCCGTGCTGAGCGAATGCAGGCGACTTGCGAGCTGGGAGCGAT
TTGGATTCCCCCGGCCTGGGTGGGGAGAGCGAGCTGGGTGCCCCCTAGATTCCCCGCC
CCCGGCCGACCCTCGGCTCCATGGAGCCCGGCAATTATGCCACCTTGGATGGAGCCAA
GGATATCTGGGAGCGGGAGGGGGGCGGAATTGA
Start
symbol Sequence ID
(no spaces)
The sequence
(usually 60 letters per line)
Sequence description
(spaces allowed)
27. The DNA alphabet
● Standard
○ A G T C
● Extended
○ adds N (unknown base)
● Full
○ adds R Y M S W K V H D B (ambiguous bases)
○ R = A or G (puRine)
○ Y = C or T (pYrimidine)
○ ... and so on for all the combinations
29. What data do we really have?
Isolate genome
Sequenced reads
Other isolates in
sequencing run
Contamination
Sequencing adaptors
Spike-in controls eg. phiX
Unsequenced
regions
30. Do we have enough data?
∷ Depth
: expressed as fold-coverage of genome eg. 25x
: means each base sequenced 25 times (on average)
∷ Coverage
: the % of genome sequenced with depth > 0
25x
Genome
32. ● nonsense reads instrument oddness
● duplicate reads amplify a low complexity library
● adaptor read-through fragment too short
● indel errors skipping bases, inserting extra bases
● uncalled base couldn't reliably estimate, replace with "N"
● substitution errors reading wrong base
Sequences have errors
More common
Less common
33. Illumina reads
● Usually 100 - 300 bp
● Indel errors are rare
● Substitution errors < 1%
○ Error rate higher at 3' end
● Very high quality overall
34. DNA base quality
● DNA sequences often have a quality value
associated with each nucleotide
● A measure of reliability for each base
● Derived from a physical process
■ chromatogram (Sanger sequencing)
■ pH reading (Ion Torrent sequencing)
■ Voltage measurement (Oxford Nanopore)
35. “Phred” qualities
Q = -10 log10
P <=> P = 10- Q / 10
Q = Phred quality score P = probability of base being incorrect
Quality Chance it's wrong Accuracy Description
10 1 in 10 90% Bad
20 1 in 100 99% Maybe
30 1 in 1000 99.9% OK
40 1 in 10,000 99.99% Very good
50 1 in 100,000 99.999% Excellent
37. Quality filtering
● Keep all reads
○ let the downstream software cope
● Reject some reads
○ average quality below some threshold
○ contain any ambiguous bases
● Trim reads
○ remove low quality bases from end(s)
○ keep longest "sub-read" that is acceptable
● Best strategy is analysis dependent
45. Two options
∷ De novo genome assembly
: reconstruct original sequence from reads alone
: like a giant jigsaw puzzle
: Create
∷ Align to reference
: identify where each read fits on a related genome
: can not always be uniquely placed
: Compare
47. De novo = without reference to other genomes
De novo genome assembly
48. De novo assembly
Ideally, one sequence per chromosome.
Millions of short
sequence
(reads)
A few long
sequences
(contigs)
Reconstruct the original genome sequence
from the sequence reads only
49. Overlap - Layout - Consensus
Amplified DNA
Shear DNA
Sequenced reads
Overlaps
Layout
Consensus ↠ “Contigs”
50. Draft vs Finished genomes
250 bp - Illumina - $250 8000 bp - Pacbio - $2500
52. Long reads can span repeats
Repeat copy 1 Repeat copy 2
long
reads
53. The law of repeats
● It is impossible to resolve repeats of length L
unless you have reads longer than L.
● It is impossible to resolve repeats of length L
unless you have reads longer than L.
59. Types of variants we can detect
Type Reference Alternate
SNP (single) T G
MNP (multiple) TA GC
Insertion AGT ACGT
“ ATCGGG ATCTGAGGG
Deletion ACGT AGT
“ ATCTGAGGG ATCGGG
63. Best practice
■ Use both approaches
□ reference-based + de novo
■ Best of both worlds
□ and worst of both worlds - interpretation is non-trivial
■ Still need
□ good epidemiology, metadata and domain knowledge!
65. Correcting contigs
■ Pacbio - long reads
□ ~10 x 1bp homopolymer insertion errors per Mbp
□ Cause frame-shift errors in coding genes
■ Illumina - short reads
□ Don’t suffer from indel issues
■ Use Illumina to correct Pacbio!
□ It works well
79. Does WGS deliver?
Yes!Bioinformatics Epidemiology
Technology
Microbiology
This means
scientists
not just software
Domain
expertise
Always changing...
81. Take home messages
■ Shorts reads & repeats
□ Can’t reconstruct genome fully
□ Can’t always align unambiguously
■ Bioinformatics is a skill
□ not just pushing buttons
□ be nice to us and we will enjoy helping you